Mouse hepatitis virus antibodies and uses thereof
By using Fab phage display technology to screen mouse hepatitis virus antibodies, the problem of insufficient antibody affinity and specificity in existing technologies has been solved, enabling rapid and efficient MHV detection and promoting the advancement of infectious disease prevention and control in laboratory animals.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GUANGZHOU NAT LAB
- Filing Date
- 2025-05-20
- Publication Date
- 2026-07-21
AI Technical Summary
Existing technologies for detecting mouse hepatitis virus (MHV) antigens suffer from insufficient antibody affinity and specificity, making it difficult to rapidly adapt to different subtypes or variants. Furthermore, the detection methods are time-consuming and costly, failing to meet the needs for rapid screening and on-site immediate testing.
Using Fab phage display technology, mice are immunized with viral particles to screen for antibodies with high affinity and specificity. Antibody fragments are then displayed on the surface of the phage to achieve rapid screening and optimization to adapt to different subtypes or variants of MHV.
High-affinity and high-specificity antibodies were obtained, which improved detection efficiency, met the needs of basic research, vaccine development and laboratory animal infectious disease prevention and control, reduced dependence on foreign countries, and improved research efficiency and the speed of results transformation.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to mouse hepatitis virus antibodies and their applications. Background Technology
[0002] Mouse hepatitis virus (MHV) is a widely studied coronavirus belonging to the family Coronaviridae and the genus Coronavirus. It is a single-stranded positive-sense RNA virus. It is highly infectious and primarily infects the liver, lungs, and central nervous system of mice.
[0003] Laboratory animals are an indispensable part of biomedical research. Animal-borne infectious diseases can seriously affect the normal survival of animals and the results of scientific experiments. MHV remains one of the most common pathogens infecting laboratory mice worldwide. Therefore, antibodies targeting MHV antigen detection have significant scientific value and application prospects in basic research, vaccine development, and drug screening.
[0004] The most common detection methods are ELISA or PCR, but these methods have some shortcomings in practical applications. While ELISA has good quantitative capabilities, it mostly uses antibodies prepared from recombinant proteins immunized in animals. These recombinant proteins have simple structures, often resulting in undetectable levels in practice. RT-PCR, although highly sensitive, typically requires complex equipment and has a long detection time, making it unsuitable for rapid screening and on-site testing.
[0005] The development of effective antibodies against MHV currently faces numerous challenges, particularly in terms of antibody affinity, specificity, and the efficiency of the production process. Currently available antibody screening technologies mainly include hybridoma technology and antibody library technology. While these methods have achieved some success in certain aspects, they generally suffer from the following drawbacks: long processing time, high cost, low efficiency, insufficient specificity, and limited ability to address different subtypes or variants. They also exhibit significant limitations in obtaining high-affinity and specific MHV antibodies, making it difficult for existing methods to quickly adapt to new challenges. Summary of the Invention
[0006] To address one of the aforementioned technical problems in the prior art, this invention provides a novel method for preparing antibodies against mouse hepatitis virus or their antigen-binding fragments. Immunizing mice with viral particles achieves superior immunization effects compared to existing recombinant protein immunization strategies, inducing a stronger and more durable immune response, thus laying the foundation for obtaining antibodies with greater affinity and specificity. This method is superior to traditional recombinant protein immunization methods, providing a more physiologically relevant environment for antibody production.
[0007] This invention employs Fab phage display technology to display antibody fragments on the surface of phages. This technology can effectively screen for high-affinity and specific antibodies in a short time, significantly improving screening efficiency. By selecting antibody fragments that bind to the target antigen, this technology obtains antibodies with high affinity and high specificity, further enhancing their recognition ability. More importantly, this technology can rapidly screen and optimize specific antibodies against different subtypes or variants of MHV, meeting ever-changing research needs.
[0008] Therefore, the high-affinity and specific antibody against the N protein obtained in this invention not only provides important raw materials for basic research on mouse hepatitis virus, vaccine development, and antibody therapy, but will also promote progress in the field of infectious disease prevention and control in laboratory animals. This innovation will promote the autonomy of domestic antibody research and development, reduce dependence on foreign countries, and thus improve research efficiency and the speed of results transformation.
[0009] In a first aspect, the present invention provides an antibody or antigen-binding fragment thereof that specifically binds to the N protein of mouse hepatitis virus.
[0010] In some embodiments, the antibody or its antigen-binding fragment includes: a heavy chain variable region containing heavy chain complementarity-determining regions VH-CDR1, VH-CDR2, and VH-CDR3, and a light chain variable region containing light chain complementarity-determining regions VL-CDR1, VL-CDR2, and VL-CDR3.
[0011] In some implementations, VH-CDR1 is selected from: VH-CDR1 containing the amino acid sequence of SEQ ID NO:2, VH-CDR1 containing the amino acid sequence of SEQ ID NO:10, VH-CDR1 containing the amino acid sequence of SEQ ID NO:18, VH-CDR1 containing the amino acid sequence of SEQ ID NO:26, VH-CDR1 containing the amino acid sequence of SEQ ID NO:34, VH-CDR1 containing the amino acid sequence of SEQ ID NO:42, VH-CDR1 containing the amino acid sequence of SEQ ID NO:50, VH-CDR1 containing the amino acid sequence of SEQ ID NO:58, and VH-CDR1 containing the amino acid sequence of SEQ ID NO:66.
[0012] In some implementations, VH-CDR2 is selected from: VH-CDR2 containing the amino acid sequence of SEQ ID NO:3, VH-CDR2 containing the amino acid sequence of SEQ ID NO:11, VH-CDR2 containing the amino acid sequence of SEQ ID NO:19, VH-CDR2 containing the amino acid sequence of SEQ ID NO:27, VH-CDR2 containing the amino acid sequence of SEQ ID NO:35, VH-CDR2 containing the amino acid sequence of SEQ ID NO:43, VH-CDR2 containing the amino acid sequence of SEQ ID NO:51, VH-CDR2 containing the amino acid sequence of SEQ ID NO:59, and VH-CDR2 containing the amino acid sequence of SEQ ID NO:67.
[0013] In some implementations, VH-CDR3 is selected from: VH-CDR3 containing the amino acid sequence of SEQ ID NO:4, VH-CDR3 containing the amino acid sequence of SEQ ID NO:12, VH-CDR3 containing the amino acid sequence of SEQ ID NO:20, VH-CDR3 containing the amino acid sequence of SEQ ID NO:28, VH-CDR3 containing the amino acid sequence of SEQ ID NO:36, VH-CDR3 containing the amino acid sequence of SEQ ID NO:44, VH-CDR3 containing the amino acid sequence of SEQ ID NO:52, VH-CDR3 containing the amino acid sequence of SEQ ID NO:60, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:68.
[0014] In some embodiments, at least one of VH-CDR1, VH-CDR2, and VH-CDR3 contains a mutation, which is a substitution, deletion, or addition of one or more amino acids or any combination thereof (e.g., a substitution, deletion, or addition of one, two, or three amino acids or any combination thereof).
[0015] In some implementations, VL-CDR1 is selected from: VL-CDR1 containing the amino acid sequence of SEQ ID NO:6, VL-CDR1 containing the amino acid sequence of SEQ ID NO:14, VL-CDR1 containing the amino acid sequence of SEQ ID NO:22, VL-CDR1 containing the amino acid sequence of SEQ ID NO:30, VL-CDR1 containing the amino acid sequence of SEQ ID NO:38, VL-CDR1 containing the amino acid sequence of SEQ ID NO:46, VL-CDR1 containing the amino acid sequence of SEQ ID NO:54, VL-CDR1 containing the amino acid sequence of SEQ ID NO:62, and VL-CDR1 containing the amino acid sequence of SEQ ID NO:70.
[0016] In some implementations, VL-CDR2 is selected from: VL-CDR2 containing the amino acid sequence KVS, VL-CDR2 containing the amino acid sequence SAS, VL-CDR2 containing the amino acid sequence KVS, VL-CDR2 containing the amino acid sequence RAN, VL-CDR2 containing the amino acid sequence LVS, VL-CDR2 containing the amino acid sequence KVS, VL-CDR2 containing the amino acid sequence KVS, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR2 containing the amino acid sequence LVS.
[0017] In some implementations, VL-CDR3 is selected from: VL-CDR3 containing the amino acid sequence of SEQ ID NO:8, VL-CDR3 containing the amino acid sequence of SEQ ID NO:16, VL-CDR3 containing the amino acid sequence of SEQ ID NO:24, VL-CDR3 containing the amino acid sequence of SEQ ID NO:32, VL-CDR3 containing the amino acid sequence of SEQ ID NO:40, VL-CDR3 containing the amino acid sequence of SEQ ID NO:48, VL-CDR3 containing the amino acid sequence of SEQ ID NO:56, VL-CDR3 containing the amino acid sequence of SEQ ID NO:64, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:72.
[0018] In some embodiments, at least one of VL-CDR1, VL-CDR2, and VL-CDR3 contains a mutation, which is a substitution, deletion, or addition of one or more amino acids or any combination thereof (e.g., a substitution, deletion, or addition of one, two, or three amino acids or any combination thereof).
[0019] In some implementations, VH-CDR1, VH-CDR2, and VH-CDR3 are selected from: (1) VH-CDR1 containing the amino acid sequence of SEQ ID NO:2, VH-CDR2 containing the amino acid sequence of SEQ ID NO:3, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:4; (2) VH-CDR1 containing the amino acid sequence of SEQ ID NO:10, VH-CDR2 containing the amino acid sequence of SEQ ID NO:11, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:12; (3) VH-CDR1 containing the amino acid sequence of SEQ ID NO:18, VH-CDR2 containing the amino acid sequence of SEQ ID NO:19, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:20; (4) VH-CDR1 containing the amino acid sequence of SEQ ID NO:26, VH-CDR2 containing the amino acid sequence of SEQ ID NO:27, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:28; (5) VH-CDR1 containing the amino acid sequence of SEQ ID NO:34, VH-CDR2 containing the amino acid sequence of SEQ ID NO:35, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:36; (6) VH-CDR1 containing the amino acid sequence of SEQ ID NO:42, VH-CDR2 containing the amino acid sequence of SEQ ID NO:43, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:44; (7) VH-CDR1 containing the amino acid sequence of SEQ ID NO:50, VH-CDR2 containing the amino acid sequence of SEQ ID NO:51, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:52; (8) VH-CDR1 containing the amino acid sequence of SEQ ID NO:58, VH-CDR2 containing the amino acid sequence of SEQ ID NO:59, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:60; (9) VH-CDR1 containing the amino acid sequence of SEQ ID NO:66, VH-CDR2 containing the amino acid sequence of SEQ ID NO:67, and VH-CDR3 containing the amino acid sequence of SEQ ID NO:68; (10) VH-CDR1, VH-CDR2 and VH-CDR3 described in (1) to (9), wherein at least one CDR contains a mutation, the mutation being a substitution, deletion or addition of one or more amino acids or any combination thereof (e.g., a substitution, deletion or addition of one, two or three amino acids or any combination thereof).
[0020] In some implementations, VL-CDR1, VL-CDR2, and VL-CDR3 are selected from: (11) VL-CDR1 containing the amino acid sequence of SEQ ID NO:6, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:8; (12) VL-CDR1 containing the amino acid sequence of SEQ ID NO:14, VL-CDR2 containing the amino acid sequence SAS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:16; (13) VL-CDR1 containing the amino acid sequence of SEQ ID NO:22, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:24; (14) VL-CDR1 containing the amino acid sequence of SEQ ID NO:30, VL-CDR2 containing the amino acid sequence RAN, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:32; (15) VL-CDR1 containing the amino acid sequence of SEQ ID NO:38, VL-CDR2 containing the amino acid sequence LVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:40; (16) VL-CDR1 containing the amino acid sequence of SEQ ID NO:46, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:48; (17) VL-CDR1 containing the amino acid sequence of SEQ ID NO:54, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:56; (18) VL-CDR1 containing the amino acid sequence of SEQ ID NO:62, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:64; (19) VL-CDR1 containing the amino acid sequence of SEQ ID NO:70, VL-CDR2 containing the amino acid sequence LVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:72; (20) (11) to (19) VL-CDR1, VL-CDR2 and VL-CDR3, wherein at least one CDR contains a mutation, the mutation being a substitution, deletion or addition of one or more amino acids or any combination thereof (e.g., substitution, deletion or addition of 1, 2 or 3 amino acids or any combination thereof); the antibody containing the mutation or its antigen-binding fragment can still specifically bind to mouse hepatitis virus N protein.
[0021] In some embodiments, the antibody or its antigen-binding fragment comprises: a heavy chain variable region containing heavy chain complementarity-determining regions VH-CDR1, VH-CDR2, and VH-CDR3, and a light chain variable region containing light chain complementarity-determining regions VL-CDR1, VL-CDR2, and VL-CDR3, wherein, VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2, and VL-CDR3 are selected from: (1) VH-CDR1 containing the amino acid sequence of SEQ ID NO:2, VH-CDR2 containing the amino acid sequence of SEQ ID NO:3, VH-CDR3 containing the amino acid sequence of SEQ ID NO:4, VL-CDR1 containing the amino acid sequence of SEQ ID NO:6, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:8; (2) VH-CDR1 containing the amino acid sequence of SEQ ID NO:10, VH-CDR2 containing the amino acid sequence of SEQ ID NO:11, VH-CDR3 containing the amino acid sequence of SEQ ID NO:12, VL-CDR1 containing the amino acid sequence of SEQ ID NO:14, VL-CDR2 containing the amino acid sequence SAS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:16; (3) VH-CDR1 containing the amino acid sequence of SEQ ID NO:18, VH-CDR2 containing the amino acid sequence of SEQ ID NO:19, VH-CDR3 containing the amino acid sequence of SEQ ID NO:20, VL-CDR1 containing the amino acid sequence of SEQ ID NO:22, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:24; (4) VH-CDR1 containing the amino acid sequence of SEQ ID NO:26, VH-CDR2 containing the amino acid sequence of SEQ ID NO:27, VH-CDR3 containing the amino acid sequence of SEQ ID NO:28, VL-CDR1 containing the amino acid sequence of SEQ ID NO:30, VL-CDR2 containing the amino acid sequence RAN, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:32; (5) VH-CDR1 containing the amino acid sequence of SEQ ID NO:34, VH-CDR2 containing the amino acid sequence of SEQ ID NO:35, VH-CDR3 containing the amino acid sequence of SEQ ID NO:36, VL-CDR1 containing the amino acid sequence of SEQ ID NO:38, VL-CDR2 containing the amino acid sequence LVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:40; (6) VH-CDR1 containing the amino acid sequence of SEQ ID NO:42, VH-CDR2 containing the amino acid sequence of SEQ ID NO:43, VH-CDR3 containing the amino acid sequence of SEQ ID NO:44, VL-CDR1 containing the amino acid sequence of SEQ ID NO:46, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:48; (7) VH-CDR1 containing the amino acid sequence of SEQ ID NO:50, VH-CDR2 containing the amino acid sequence of SEQ ID NO:51, VH-CDR3 containing the amino acid sequence of SEQ ID NO:52, VL-CDR1 containing the amino acid sequence of SEQ ID NO:54, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:56; (8) VH-CDR1 containing the amino acid sequence of SEQ ID NO:58, VH-CDR2 containing the amino acid sequence of SEQ ID NO:59, VH-CDR3 containing the amino acid sequence of SEQ ID NO:60, VL-CDR1 containing the amino acid sequence of SEQ ID NO:62, VL-CDR2 containing the amino acid sequence KVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:64; (9) VH-CDR1 containing the amino acid sequence of SEQ ID NO:66, VH-CDR2 containing the amino acid sequence of SEQ ID NO:67, VH-CDR3 containing the amino acid sequence of SEQ ID NO:68, VL-CDR1 containing the amino acid sequence of SEQ ID NO:70, VL-CDR2 containing the amino acid sequence LVS, and VL-CDR3 containing the amino acid sequence of SEQ ID NO:72; and (10) The VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2 and VL-CDR3 mentioned in (1) to (9) contain at least one CDR containing a mutation, said mutation being a substitution, deletion or addition of one or more amino acids or any combination thereof (e.g., substitution, deletion or addition of 1, 2 or 3 amino acids or any combination thereof); said antibody containing the mutation or its antigen-binding fragment can still specifically bind to mouse hepatitis virus N protein.
[0022] In some embodiments, the antibody or its antigen-binding fragment includes a heavy chain variable region (VH) containing an amino acid sequence selected from any one of SEQ ID NO: 1, 9, 17, 25, 33, 41, 49, 57, and 65, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions or any combination thereof (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, or 5 amino acids or any combination thereof), or an amino acid sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.
[0023] In some embodiments, the antibody or its antigen-binding fragment includes a light chain variable region (VL) containing an amino acid sequence selected from any one of SEQ ID NO: 5, 13, 21, 29, 37, 45, 53, 61, and 69, or an amino acid sequence having one or more amino acid substitutions, deletions, or additions or any combination thereof (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, or 5 amino acids or any combination thereof), or an amino acid sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.
[0024] In some embodiments, the antibody or its antigen-binding fragment includes a heavy chain variable region (VH) and a light chain variable region (VL), wherein the heavy chain variable region (VH) and the light chain variable region (VL) are selected from: (1) Contains a heavy chain variable region (VH) of the amino acid series shown in SEQ ID NO:1 and a light chain variable region (VL) of the amino acid series shown in SEQ ID NO:5; (2) Contains a heavy chain variable region (VH) of the amino acid series shown in SEQ ID NO:9 and a light chain variable region (VL) of the amino acid series shown in SEQ ID NO:13; (3) Contains a heavy chain variable region (VH) of the amino acid series shown in SEQ ID NO:17 and a light chain variable region (VL) of the amino acid series shown in SEQ ID NO:21; (4) Contains a heavy chain variable region (VH) of the amino acid series shown in SEQ ID NO:25 and a light chain variable region (VL) of the amino acid series shown in SEQ ID NO:29; (5) Contains a heavy chain variable region (VH) of the amino acid series shown in SEQ ID NO:33 and a light chain variable region (VL) of the amino acid series shown in SEQ ID NO:37; (6) Contains a heavy chain variable region (VH) of the amino acid series shown in SEQ ID NO:41 and a light chain variable region (VL) of the amino acid series shown in SEQ ID NO:45; (7) Contains a heavy chain variable region (VH) of the amino acid series shown in SEQ ID NO:49 and a light chain variable region (VL) of the amino acid series shown in SEQ ID NO:53; (8) Containing a heavy chain variable region (VH) of the amino acid series shown in SEQ ID NO:57 and a light chain variable region (VL) of the amino acid series shown in SEQ ID NO:61; and (9) Containing a heavy chain variable region (VH) of the amino acid series shown in SEQ ID NO:65 and a light chain variable region (VL) of the amino acid series shown in SEQ ID NO:69; Or, the VH contained in the antibody or its antigen-binding fragment has one or more amino acid substitutions, deletions or additions or any combination thereof (e.g., substitutions, deletions or additions of 1, 2, 3, 4 or 5 amino acids or any combination thereof) compared to the VH and / or VL described in (1) to (9); preferably, the substitution is a conservative substitution. Or, the amino acid sequence of VH and / or VL contained in the antibody or its antigen-binding fragment has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence of VH and / or VL described in (1) to (9).
[0025] In some embodiments, the antibody or its antigen-binding fragment comprises scFv, Fab, Fab′, F(ab′)2, Fv fragment, disulfide-linked Fv(dsFv), biantibody, bispecific antibody, and multispecific antibody. In some preferred embodiments, the antibody comprises Fab.
[0026] In some embodiments, the antibody or its antigen-binding fragment may be a full-length antibody, such as immunoglobulin G (IgG), IgM, IgE, IgA, or IgD.
[0027] In some embodiments, the antibody or its antigen-binding fragment comprises a constant region of IgG1, IgG2, IgG3, or IgG4, or a variant thereof.
[0028] In some embodiments, the antibody or its antigen-binding fragment comprises: (1) The CH (heavy chain constant region) of human immunoglobulin or a variant thereof, said variant having one or more amino acid substitutions, deletions, or additions compared to its derived wild-type sequence (e.g., substitutions, deletions, or additions of up to 20, 15, 10, or 5 amino acids; e.g., substitutions, deletions, or additions of 1, 2, 3, 4, or 5 amino acids); and / or, (2) The CL (light chain constant region) of human immunoglobulin or a variant thereof, said variant having one or more amino acid substitutions, deletions or additions compared to the wild-type sequence from which it is derived (e.g., substitutions, deletions or additions of up to 20, up to 15, up to 10 or up to 5 amino acids; e.g., substitutions, deletions or additions of 1, 2, 3, 4 or 5 amino acids). Preferably, CH is an IgG heavy chain constant region, such as the IgG1, IgG2, IgG3 or IgG4 heavy chain constant region; Preferably, the antibody comprises the heavy chain constant region of human IgG1; Preferably, the CL is the constant region of the κ light chain.
[0029] In some embodiments, the antibody is a chimeric antibody.
[0030] In some embodiments, the antibody is a humanized antibody.
[0031] In a second aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a heavy chain variable region and / or a light chain variable region encoding an antibody or an antigen-binding fragment thereof as described in the first aspect.
[0032] In some embodiments, the nucleic acid molecule comprises: (i) A nucleotide sequence containing SEQ ID NO:73 and a nucleotide sequence containing SEQ ID NO:74; (ii) A nucleotide sequence containing SEQ ID NO:75 and a nucleotide sequence containing SEQ ID NO:76; (iii) A nucleotide sequence containing SEQ ID NO:77 and a nucleotide sequence containing SEQ ID NO:78; (iv) A nucleotide sequence containing SEQ ID NO:79 and a nucleotide sequence containing SEQ ID NO:80; (v) A nucleotide sequence containing SEQ ID NO:81 and a nucleotide sequence containing SEQ ID NO:82; (vi) A nucleotide sequence containing SEQ ID NO:83 and a nucleotide sequence containing SEQ ID NO:84; (vii) A nucleotide sequence containing SEQ ID NO:85 and a nucleotide sequence containing SEQ ID NO:86; (viii) A nucleotide sequence containing SEQ ID NO:87 and a nucleotide sequence containing SEQ ID NO:88; (ix) A nucleotide sequence containing SEQ ID NO:89 and a nucleotide sequence containing SEQ ID NO:90; or (x) The nucleic acid molecule contains a nucleotide sequence that has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the nucleotide sequence described in (i-ix).
[0033] Thirdly, the present invention provides an expression vector comprising the nucleic acid molecule of the second aspect.
[0034] Fourthly, the present invention provides a host cell comprising the nucleic acid molecule described in the second aspect and the vector described in the third aspect.
[0035] Fifthly, the present invention provides a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof as described in the first aspect, the nucleic acid molecule as described in the second aspect, the expression vector as described in the third aspect, the host cell as described in the fourth aspect, and a pharmaceutically acceptable carrier.
[0036] In a sixth aspect, the present invention provides the use of the antibody or antigen-binding fragment thereof described in the first aspect, the nucleic acid molecule described in the second aspect, the expression vector described in the third aspect, the host cell described in the fourth aspect, and the pharmaceutical composition described in the fifth aspect in the preparation of a medicament for use in neutralizing MHV virus in a subject, preventing and / or treating MHV infection or diseases related to MHV infection.
[0037] In a seventh aspect, the present invention provides a reagent for detecting the presence or level of MHV in a biological sample. In some embodiments, the biological sample may correspond to (but is not limited to) tissue, biological fluid, or cell samples infected with MHV. The biological fluid includes, for example, blood, plasma, lymph, urine, sputum, feces, cerebrospinal fluid, leukocyte exudate, tissue extracts, or homogenates.
[0038] In some embodiments, the reagent comprises the antibody or antigen-binding fragment thereof described in the first aspect.
[0039] In some embodiments, the reagent comprises at least two antibodies or antigen-binding fragments thereof as described in the first aspect.
[0040] In some embodiments, the reagent comprises an antigen capture agent and / or an antigen detection agent, each independently selected from the antibodies or antigen-binding fragments thereof described in the first aspect.
[0041] In some embodiments, the reagent comprises an antigen capture agent and an antigen detection agent selected from: (a) Antigen capture agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 65 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 69 as the light chain variable region (VL); and antigen detection agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 49 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 53 as the light chain variable region (VL); (b) Antigen capture agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 33 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 37 as the light chain variable region (VL); and antigen detection agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 57 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 61 as the light chain variable region (VL). (c) Antigen capture agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 33 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 37 as the light chain variable region (VL); and antigen detection agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 65 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 69 as the light chain variable region (VL). (d) Antigen capture agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 17 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 21 as the light chain variable region (VL); and antigen detection agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 65 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 69 as the light chain variable region (VL); or (e) Antigen capture agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 17 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 21 as the light chain variable region (VL), and an antigen detection agent: comprising an antibody or an antigen-binding fragment thereof containing the amino acid sequence shown in SEQ ID NO: 33 as the heavy chain variable region (VH) and the amino acid sequence shown in SEQ ID NO: 37 as the light chain variable region (VL).
[0042] In some embodiments, the antibody or its antigen-binding fragment is conjugated to a detectable marker.
[0043] In some embodiments, the antigen detection agent comprises a detectable marker selected from magnetic beads, fluorescent dyes, radioactive isotopes, enzymes, biotin, metals, or any combination thereof.
[0044] In some embodiments, the reagent is an enzyme-linked immunosorbent assay (ELISA) reagent comprising an antigen capture agent and / or an enzyme-labeled antigen detection agent. The antigen capture agent and / or enzyme-labeled antigen detection agent are independently selected from one or more of the MHV antibodies or their antigen-binding fragments described in the first aspect.
[0045] In some embodiments, the labeling enzyme on the enzyme-labeled antibody is selected from horseradish peroxidase, alkaline phosphatase, and glucose oxidase, or any combination thereof.
[0046] In some embodiments, the reagent is a lateral flow immunochromatographic plate comprising an antigen capture agent and / or a metal-labeled antigen detection agent, wherein the antigen capture agent and / or the metal-labeled antigen detection agent are attached to a membrane.
[0047] In some embodiments, the membrane is made of a material selected from mixed cellulose, nitrocellulose, nitrocellulose, glass cellulose, cotton, woven web, nonwoven material, porous plastic, polymer, polyester, or any combination thereof.
[0048] Eighthly, the present invention provides a method for detecting the presence or level of MHV in a biological sample.
[0049] In some embodiments, the method includes contacting the biological sample with the antibody or antigen-binding fragment described in the first aspect, and detecting the binding of the antibody or antigen-binding fragment to MHV, thereby detecting the presence or level of MHV in the biological sample.
[0050] In some embodiments, the method uses the reagents described in the seventh aspect.
[0051] In some implementations, the method is an immunological detection method.
[0052] In some embodiments, the method for detecting the presence or level of MHV in a biological sample is selected from: ELISA, liquid microarray, immunofluorescence, immunohistochemistry, immunochromatography, flow cytometry, cell sorting, radioimmunoassay, immunodiffusion, immunoprecipitation, and / or Western blotting.
[0053] In a ninth aspect, the present invention provides the use of the antibody or antigen-binding fragment thereof described in the first aspect in the preparation of a reagent for detecting the presence or level of MHV in a biological sample.
[0054] In a tenth aspect, the present invention provides a method for screening antibodies or antigen-binding fragments thereof that specifically bind to mouse hepatitis virus N protein, comprising: Mouse hepatitis virus particles are provided for immunizing animals, and antibodies or antigen-binding fragments of the mouse hepatitis virus N protein that specifically bind to the particles are screened for.
[0055] In some embodiments, the method includes: (a) collecting spleen mononuclear cells from the immunized animal and generating an antibody sequence display library expressing antibody fragments using cDNA derived from the spleen mononuclear cells; and (b) contacting the antibody sequence display library with the mouse hepatitis virus N protein and screening to obtain target antibody sequences that specifically bind to the mouse hepatitis virus N protein.
[0056] In some embodiments, the antibody sequence display library is selected from phage display libraries, yeast display libraries, ribosome display libraries, and mammalian cell display libraries.
[0057] In some embodiments, the antibody sequence display library is a phage display library.
[0058] In some embodiments, the antibody fragment includes a Fab heavy chain and / or a light chain Ig fragment.
[0059] In some embodiments, the antibody fragment includes a Fab heavy chain variable region and / or a light chain variable region and constant region fragment.
[0060] In some embodiments, the method includes amplifying cDNA derived from the spleen mononuclear cells to obtain IgG1, IgG2A, and IgG2B antibody heavy chain Fab amplification products and κ antibody light chain Fab amplification products, and ligating the heavy chain variable region amplification products and light chain variable region amplification products to an expression vector to obtain an expression vector of Fab.
[0061] In some embodiments, the expression vector comprises a phage particle vector, in which case the antibody sequence display library is a phage display library.
[0062] In some embodiments, the method further includes obtaining amplification products of the heavy chain variable region and light chain variable region of the target antibody sequence, and ligating them into human IgG1 and IgK expression vectors to obtain human IgG1 antibody heavy chain expression vector and IgK antibody light chain expression vector.
[0063] In some embodiments, the method includes co-transferring the antibody heavy chain expression vector and the light chain expression vector into host cells for expression to obtain a humanized antibody.
[0064] The beneficial effects of this invention are: 1. Enhanced antibody affinity and specificity This invention employs Fab phage display technology, which enables highly efficient screening of mouse hepatitis virus (MHV)-related antibodies by displaying antibody fragments on the surface of phages. It can generate a large number of different antibody variants in a short time, from which high-affinity and specific antibodies can be selected. This advantage significantly improves the antibody's recognition ability, enabling it to accurately target specific MHV antigens and reduce the risk of non-specific binding.
[0065] 2. Adapting to the diverse needs of viruses As coronavirus strains constantly evolve and their potential mutations increase, traditional antibody development methods struggle to rapidly adapt to emerging viral subtypes. The method of this invention allows for rapid screening and optimization against different subtypes and variants of MHV, resulting in broadly applicable specific antibodies. This flexibility enables researchers to respond promptly to the challenges posed by viral mutations, providing more effective tools for vaccine development and treatment.
[0066] 3. Accelerated the research and development process By immunizing mice with viral particles, this invention induces a stronger and more durable immune response, promoting the production of high-affinity and specific antibodies. Compared to traditional recombinant protein immunization strategies, this method shortens the antibody development cycle and accelerates the research and development process. This is of great significance for basic research, clinical applications, and public health, helping to respond quickly to the threats posed by viral infections.
[0067] 4. Applicable to multiple fields The high-affinity and specific antibodies obtained in this invention are not only of significant value in basic research, such as revealing the biological characteristics of MHV and the host immune response, but can also serve as important components in vaccine development, enhancing vaccine immunogenicity. Furthermore, these antibodies can be used for the early diagnosis of MHV infection, improving the sensitivity and specificity of detection and providing reliable protection for disease prevention and control.
[0068] 5. Reduced R&D costs The technical processes and methods employed in this invention improve the efficiency and success rate of antibody screening, reduce resource waste, and thus lower overall R&D costs. This advantage makes antibody production more economically feasible, promotes the autonomy of domestic antibody R&D, and reduces dependence on foreign sources.
[0069] 6. Enhanced market competitiveness The high-affinity, specific antibodies developed using this invention provide high-quality research materials for domestic research institutions and biotechnology companies. This not only enhances the international competitiveness of related domestic research but also provides stronger technical support for public health and infectious disease control.
[0070] In summary, this invention has achieved significant and beneficial technical effects in the development of high-affinity specific antibodies against mouse hepatitis virus through innovative technical methods. These effects not only meet the urgent needs of scientific research and clinical applications, but also lay a solid foundation for future antibody research and vaccine development, possessing broad market prospects and social value. Attached Figure Description
[0071] Figure 1 A flowchart for the preparation of MHV-N antibody is shown.
[0072] Figure 2 An electrophoresis diagram of the MHV-N protein is shown.
[0073] Figure 3 The serum titer of immunized mice is shown.
[0074] Figure 4 The diagram shows the roadmap for constructing Fab library fragments.
[0075] Figure 5 The image shows a PCR electrophoresis diagram of the antibody Fab region gene.
[0076] Figure 6 An electrophoresis diagram of the LinkD PCR fragment is shown.
[0077] Figure 7 The electrophoresis diagram of the Fab overlap extension PCR fragment is shown.
[0078] Figure 8 This is a schematic diagram showing the phage-mid of the Fab.
[0079] Figure 9 The results of ELISA and sequence analysis of some positive clones are shown.
[0080] Figure 10 A map of mammalian cell expression vectors is shown.
[0081] Figure 11 The purified antibody was shown as an SDS-PAGE electrophoresis image.
[0082] Figure 12 The antibody affinity test results are shown.
[0083] Figure 13 The results of western blotting detection of MHV-infected samples are shown.
[0084] Figure 14 The results of immunofluorescence detection of MHV expression of N protein are shown.
[0085] Figure 15The results of colloidal gold detection of the N protein in MHV are shown.
[0086] Figure 16 The results of colloidal gold detection of MHV virus and different infected tissues are shown. Detailed Implementation
[0087] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.
[0088] Definitions Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.
[0089] Unless the context clearly indicates otherwise, references to a specific quantity herein include their plural forms. For example, the term "cell" includes one or more such cells and equivalents known to those skilled in the art, etc.
[0090] As used herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value.
[0091] The term "Mouse Hepatitis Virus (MHV)" as used in this article refers to a capsidd RNA virus belonging to the genus Coronavirus. First isolated in 1949, it comprises several named and unnamed strains. Based on tissue preference, MHV can be classified into respiratory and enteric types. Respiratory MHV strains include MHV-1, MHV-2, MHV-3, MHV-JHM (MHV-4), MHV-A59, and MHV-S. Enteric MHV strains include MHV-D, MHV-DVIM, MHV-Y, and MHV-RI. Therefore, MHV typically infects the respiratory tract (respiratory pathogenicity) or the gastrointestinal tract (enteropathic pathogenicity), causing various diseases such as hepatitis, enteritis, and encephalomyelitis. The severity of the disease depends on the strain, age, and immune status of the infected mouse. MHV is highly infectious and has been one of the most prevalent viruses in mouse populations both domestically and internationally for decades. It can be transmitted through direct contact and through various media, including aerosols, contaminants, cell cultures, and grafts (such as tumors).
[0092] MHV, with a diameter of approximately 80–169 nm, contains 4–6 structural proteins and is the largest virus in the Coronaviridae family. It consists of a single-stranded 32 kb RNA genome and a nucleocapsid, forming a spiral viral particle that replicates within the cytoplasm of infected cells. MHV has three main structural proteins: a core (nucleocapsid, N) protein, a transmembrane (M) protein, and a surface (S) protein, also known as a spike protein. The N protein is a basic phosphoprotein that, along with the M protein, forms the core of the protein. The N protein is a highly conserved antigenic protein; the N gene sequence shares at least 94% homology among different MHV strains, and the N protein exhibits strong antigenicity and a relatively concentrated antigenic epitope. The amino acid sequence of the N protein used in this paper is shown in SEQ ID NO:91, and the nucleotide sequence is shown in SEQ ID NO:92.
[0093] The term "antibody" as used in this article refers to whole antibodies and any antigen-binding fragment or its single chain. Antibodies typically consist of glycoproteins containing one or more heavy chains (H) linked by disulfide bonds and one or more light chains (L), or their antigen-binding portion. Immunoglobulin light chains are generally classified as κ or λ. Immunoglobulin heavy chains are classified as γ, μ, α, δ, or ε, thus determining the immunoglobulin types: IgG, IgM, IgA, IgD, and IgE, respectively. Several major antibody classes are further divided into subclasses; mouse IgG mainly includes subtypes such as IgG1, IgG2a, IgG2b, and IgG3. Each heavy chain consists of a variable region (abbreviated as VH in this article) and a constant region.
[0094] The term "variable region" as used in this article refers to a segment of the IgG chain whose sequence varies between different antibodies. The variable region of the heavy chain can be referred to as "VH," and the variable region of the light chain as "VL." Typically, the variable regions of both the heavy and light chains contain three hypervariable regions, also known as complementarity-determining regions (CDRs), located within relatively conserved frame regions (FRs). These CDRs are usually arranged within the frame regions to enable the binding of specific epitopes. Typically, from the N-terminus to the C-terminus, the variable domains of both the light and heavy chains contain FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.
[0095] As used herein, “complementarity-determining regions (CDRs)” refer to one of the three hypervariable regions (H1, H2, or H3) within the non-framework region of the antibody VH β-sheet frame, or one of the three hypervariable regions (L1, L2, or L3) within the non-framework region of the antibody VL β-sheet frame. Therefore, a CDR is a variable region sequence scattered within the framework region sequence. The definition of CDR regions is known to those skilled in the art and has been defined, for example, by Kabat as the region of highest variability within the antibody variable domain. Chothia also structurally defines CDR regions as those residues that are not conserved β-sheet frame portions and are therefore adaptable to different conformations. Both definitions are known in the art. IMGT has also defined CDR regions. The relationship between numbering systems, including, for example, Kabat numbering and the IMGT unique numbering system, is well known to those skilled in the art. In some embodiments, the CDR is defined by the Kabat numbering system. In some embodiments, the CDR is defined by the IMGT numbering system. In some embodiments, the CDR is defined by the Chothia numbering system.
[0096] The term "frame" or "frame region" as used in this paper refers to the region remaining after subtracting the CDR from the variable region. Because the precise definition of the CDR sequence can be determined using different systems, the meaning of the frame sequence requires correspondingly different interpretations. The six CDRs (CDR-L1, CDR-L2, and CDR-L3 for the light chain and CDR-H1, CDR-H2, and CDR-H3 for the heavy chain) further divide the frame region on both the light and heavy chains into four sub-regions (FR1, FR2, FR3, and FR4) on each chain. CDR1 is located between FR1 and FR2, CDR2 between FR2 and FR3, and CDR3 between FR3 and FR4. As used in this paper, FR represents one of the four sub-regions, or FR represents two or more of the four sub-regions that constitute the frame region.
[0097] The antibodies of this invention can exist in a variety of forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab')2, as well as single-chain antibodies (scFv), scFv dimers, multispecific antibodies formed from a portion of an antibody containing one or more CDRs, camelified single-domain antibodies, nanobodies, domain antibodies, bivalent domain antibodies, humanized antibodies and human antibodies, or any other antibody fragment capable of binding to the same antigen as the parent antibody or a fragment of the parent antibody (e.g., the parental scFv) but not containing a complete antibody structure.
[0098] As used herein, the term "antigen-binding moiety" (or "antigen-binding fragment") of an antibody refers to one or more antibody fragments that retain the specific binding ability of a full-length antibody to an antigen (e.g., MHV). It has been demonstrated that fragments of full-length antibodies can perform the antigen-binding function of an antibody. Examples of binding fragments encompassed within the scope of the "antigen-binding moiety" of an antibody include, but are not limited to: (i) Fab fragments, which are monovalent fragments consisting of VL, VH, CL, and CH1 domains; (ii) F(ab′)2 fragments, which are bivalent fragments comprising two Fab fragments linked by disulfide bonds in a hinge region; (iii) Fd fragments, which consist of VH and CH1 domains; (iv) Fv fragments, which consist of VL and VH domains on a single arm of the antibody; (v) a single domain or dAb fragment consisting of a VH domain; and (vi) separate complementarity-determining regions (CDRs), or (vii) combinations of two or more separate CDRs optionally linked by synthetic linkers. These antibody fragments can be obtained using conventional techniques known to those skilled in the art, and can be screened for utilization in the same manner as intact antibodies. Antigen-binding moieties can be prepared using recombinant DNA technology or by enzymatic or chemical cleavage of intact immunoglobulins.
[0099] Full antibody digestion with papain yields two identical antigen-binding fragments, each called a "Fab" fragment (each "Fab" fragment having a single antigen-binding site), and a residual "Fc" fragment. In addition to the variable regions of the heavy and light chains, the Fab fragments also contain a constant region of the light chain and a first constant region (CH1) of the heavy chain. Fab fragments can be generated, for example, by recombinant methods or by digestion of the full-length antibody with papain. In some embodiments, the antibody can be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of a phage particle carrying their encoding polynucleotide sequences. In a particular embodiment, the phage can be used to display antigen-binding domains, such as Fab and Fv or disulfide-stabilized Fv. For phages displaying antigen-binding domains that bind to the antigen of interest, they can be selected or identified using antigens, such as labeled antigens or antigens bound to or captured on a solid surface. Following phage selection, antibody coding regions can be isolated from the phages and used to generate complete antibodies, or any other desired fragments, which can then be expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, bacteria, etc. Recombinant techniques can also be used to generate Fab, Fab′, and F(ab′)2 fragments, employing methods known in the art. The amino acid residues used in this article are abbreviated as follows: alanine (Ala; A), asparagine (Asn; N), aspartic acid (Asp; D), arginine (Arg; R), cysteine (Cys; C), glutamic acid (Glu; E), glutamine (Gln; Q), glycine (Gly; G), histidine (His; H), isoleucine (Ile; I), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y), and valine (Val; V).
[0100] The “conserved amino acid substitutions” used in this article include: (1) glycine, alanine, valine, leucine and isoleucine, (2) phenylalanine, tyrosine and tryptophan, (3) serine and threonine, (4) aspartic acid and glutamic acid, (5) glutamine and asparagine, and (6) lysine, arginine and histidine.
[0101] As used herein, “identical” or “percentage of identity” has the meaning known in the art and refers to a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by sequence comparison. When comparing and aligning for maximum consistency, two or more sequences or subsequences are identical or have a specified percentage of the same amino acid residues or nucleotides, as determined by one of the following sequence comparison algorithms or by visual measurement. Methods typically used to determine identity are encoded in computer programs. Preferred computer methods for determining identity between two sequences include, but are not limited to, BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software.
[0102] In some embodiments, the anti-N protein antibody may include, individually or collectively, a heavy chain CDR having at least 80% (e.g., 85%, 90%, 95%, or 98%) sequence identity compared to the VH-CDR of the exemplary antibody described herein. Alternatively or additionally, the anti-N protein antibody may include, individually or collectively, a light chain CDR having at least 80% (e.g., 85%, 90%, 95%, or 98%) sequence identity compared to the VL-CDR of the exemplary antibody described herein. As used herein, “individually” means the sequence identity of one CDR of an antibody relative to the corresponding CDR of the exemplary antibody. “Collectively” means the sequence identity of the three VH or VL-CDRs of the combined antibody relative to the corresponding three VH or VL-CDRs of the combined exemplary antibody.
[0103] "KD" is used interchangeably with "Kd" and can represent the strength or affinity of specific binding interactions between molecules. KD values can be measured using any effective method. As used herein, "KD" refers to the dissociation equilibrium constant of the interaction between the antibody or its antigen-binding fragment and the antigen, describing the binding affinity between the antibody or its antigen-binding fragment and the antigen. A smaller equilibrium dissociation constant indicates a tighter binding and a higher affinity between the antibody or its antigen-binding fragment and the antigen. The dissociation constant can be measured using surface plasmon resonance (SPR), or alternatively, biomembrane interferometry or KinExA. In some embodiments, affinity is measured by competitive radioimmunoassay. In some embodiments, affinity is determined by ELISA. In some embodiments, the affinity KD is measured using surface plasmon resonance (SPR).
[0104] As used herein, "specific binding" refers to a non-random binding reaction between two molecules. For example, an antibody that specifically binds to a target (which may be an antigenic epitope) has a greater affinity, stronger affinity, easier binding, and / or longer duration of binding to that target than it binds to other targets. An antibody is said to "specifically bind" to an epitope when it binds to the epitope more easily through its antigen-binding domain than to a random, unrelated epitope. The antibodies or their antigen-binding portions described herein have a KD 10 -5 M (10000nM) or lower, such as 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, 10 - 10 M, 10 -11 M, 10 -12 The ability of M or a lower dissociation constant to bind to mouse hepatitis virus N protein.
[0105] The MHV antibody or its antigen-binding fragment may contain amino acids in addition to the twenty "naturally occurring" amino acids. Many amino acids (including terminal amino acids) can be modified by natural methods (e.g., processing or other post-translational modifications) or by chemical modification techniques known in the art. Known modifications include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of proheme moieties, covalent attachment of nucleotides or nucleotide derivatives, covalent attachment of lipids or lipid derivatives, covalent attachment of phosphatidylinositol, cross-linking, cyclization, formation of disulfide bonds, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamic acid, formylation, γ-carboxylation, glycosylation, formation of GPI anchoring, hydroxylation, iodination, methylation, myristylation, oxidation, hydrolytic processing, phosphorylation, isopreneation, racemization, selenization, sulfidation, and t-RNA-mediated addition of amino acids to proteins (such as arginination and ubiquitination). Such modifications are known to those skilled in the art.
[0106] Antibody display Antibody display technology is a class of molecular biology methods used for screening and engineering antibodies, and is widely applied in antibody discovery and optimization. It includes phage display, mRNA and DNA display, ribosome display, eukaryotic virus display, bacterial display, yeast display, and mammalian cell display to screen combinatorial libraries of recombinant proteins for desired characteristics. These display technologies have been widely used for antibody screening to identify antibodies with improved stability and desired binding affinity and activity, and have been applied to various applications, including directed evolution, affinity maturation, antibody engineering, biofuel production, and epitope localization.
[0107] Recombinant bacteriophage display technology for antibody screening Immunoglobulin heavy chain Fab region genes and light chain Fab region genes were amplified and ligated by PCR and then cloned into a phage vector. These genes were incorporated into the phage particles during phage assembly. Each recombinant phage contains a gene for a different antibody molecule displayed on its surface within its genome. The phage library was panned in antigen-coated microculture wells; non-specific phages were washed away, and antigen-bound phages were eluted. The genomes from antigen-specific clones were isolated, and the Fab sequences were obtained. The phage display library (also known as a phage peptide / antibody library, phage library, or peptide / antibody library) contains a large number of phages (102). 8 (or more), each phage particle displays a different peptide or polypeptide sequence. These peptide or polypeptide fragments can be constructed in various lengths.
[0108] Several commonly used phage display systems have been developed. For example, the filamentous phage display system utilizes the unique life cycle of M13 phage and several phage proteins it expresses to screen for ligands with high affinity and high copy number released in secretory form. Furthermore, filamentous phages have excellent immunogenicity and are of great value in the research and development of biological vaccines.
[0109] The vectors for phage display are mainly divided into two categories: phage particle display vectors and phage display vectors.
[0110] Phage vectors are commonly used in genetic engineering. They are formed by replacing or inserting foreign genes into the phage genome. Most phage vectors have multiple protein display sites on their surface, typically multivalent display. Generally, multivalent display can lead to false positives in weakly binding clones, making it difficult to screen for highly specific clones. However, when using phages to display peptides, because peptides have weaker binding affinity to antigens, multivalent display can actually be more beneficial for screening target clones. Conversely, monovalent display can increase the likelihood of screening for high-affinity clones. Therefore, phage particles are chosen as vectors for monovalent display to screen for high-affinity clones.
[0111] Phagemid vectors are a type of plasmid vector containing a phage replication origin. They cleverly combine the characteristics of plasmids and phages, and are artificially constructed vectors containing single-stranded phage packaging sequences, replicons, plasmid replicons, cloning sites, and marker genes. Phagemids require helper phages to provide the proteases and coat proteins needed for replication and packaging. When helper phages are present in a bacterial cell, they can be induced into single-stranded DNA phagemids, which can replicate like phages or plasmids.
[0112] Phagemids possess the following characteristics: 1. They produce stable and highly productive double-stranded DNA, exhibiting characteristics of conventional plasmids; 2. They eliminate the tedious and time-consuming step of subcloning foreign DNA fragments from plasmids into phage vectors; 3. Due to their sufficiently small size, single-stranded foreign DNA segments up to 10 kb can be obtained. Among these, the Lerner laboratory constructed vectors pCBAKS, pComb3, and plumb8 based on pBluescript, primarily for the construction of Fab antibody libraries.
[0113] As used herein, "chimeric antibody" refers to an antibody containing variable region sequences of heavy and light chains from one species and constant region sequences from another species, such as antibodies with variable regions of mouse heavy and light chains linked to human constant regions. Humanized antibodies are chimeric antibodies containing the minimal sequence of a non-human immunoglobulin, including variable region framework residues substantially derived from human antibodies and complementarity-determining regions substantially derived from non-human antibodies (e.g., mouse antibodies). In most cases, humanized antibodies are human immunoglobulins in which hypervariable region residues are replaced by hypervariable region residues from non-human (donor antibodies) (e.g., mouse, rat, rabbit, or non-human primate antibodies with the desired specificity, affinity, and activity). In some cases, framework region (FR) residues of human immunoglobulins may be replaced by corresponding non-human residues. Additionally, humanized antibodies may include modifications that further enhance antibody performance. Typically, humanized antibodies contain virtually all (at least one, usually two) of the variable regions, where all or virtually all of the hypervariable regions correspond to the hypervariable regions of non-human immunoglobulins, and all or virtually all of the FR regions are the FR regions of the human immunoglobulin sequence. The variable region framework residues of the heavy and light chains may be substantially similar to regions of the same or different human antibody sequences.
[0114] As used herein, the terms "isolated nucleic acid molecule" and "isolated polynucleotide" are used interchangeably throughout the text, including DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), DNA or RNA analogs produced using nucleotide analogs (e.g., peptide nucleic acids and non-naturally produced nucleotide analogs), and their hybrids. Nucleic acid molecules can be single-stranded or double-stranded. In some embodiments, the nucleic acid molecule contains consecutive open reading frames encoding the antibody or fragments, derivatives, mutant proteins, or variants thereof. The isolated nucleic acid molecule may not be associated with all or part of a polynucleotide found in nature, or may be linked to a polynucleotide to which it is not linked in nature.
[0115] The “expression vector” as used herein contains necessary regulatory sequences encoding the nucleic acid molecule and coding sequences for transcription and translation incorporated into a suitable host cell. Plasmids are typically used as expression vectors. Suitable plasmids are well-known and commercially available. The selection of the regulatory sequences in this invention depends on the type of host cell and can be readily performed by those skilled in the art. Examples of such regulatory sequences are transcription promoters and enhancers or RNA polymerase-binding sequences that include a transcription initiation signal preceding the inserted coding sequence, a ribosome-binding sequence, and a transcription termination sequence following the inserted coding sequence. Furthermore, depending on the host cell and vector used, other sequences may be introduced into the expression vector, such as replication initiators, additional DNA restriction sites, enhancers, and sequences that allow induction of transcription. The expression vector also contains a marker gene sequence that confers a specific phenotype on the transformed cells and enables specific selection of transformed cells. Additionally, the vector may contain a second marker sequence that allows differentiation between cells transformed with a recombinant plasmid containing the inserted target protein sequence and cells that have taken up a plasmid without the insert. Typically, conventional antibiotic resistance markers are used; however, any other reporter gene known in the art may be used, whose presence in cells (in vivo) can be readily determined using autoradiography, spectrophotometry, or bioluminescence and chemiluminescence methods. For example, depending on the host cell, reporter genes such as β-galactosidase, β-glucuronidase, luciferase, chloramphenicol acetyltransferase, or green fluorescent protein may be used.
[0116] In addition, the expression vector may contain signal sequences to transport the protein to a suitable cellular compartment, such as the periplasm, where folding is facilitated. Additionally, sequences encoding markers / tags, such as a His-Tag linked to the N-terminus or a GST linked to the C-terminus, may be present to facilitate subsequent affinity chromatography purification of the resulting protein using a nickel column. Further sequences may also be present to protect the protein from proteolytic degradation in the host cell and to enhance its solubility.
[0117] As used herein, "host cell" refers to a cell that can be used to express nucleic acids, such as those of this invention. The host cell can be a prokaryote, for example, *Escherichia coli* (E. coli). E. coliThe host cell can be a eukaryote, such as a single-celled eukaryote (e.g., yeast or other fungi), a plant cell (e.g., tobacco or tomato plant cells), an animal cell (e.g., human cells, monkey cells, hamster cells, rat cells, mouse cells, or insect cells), or a hybridoma. Examples of host cells include the COS-7 line of monkey kidney cells, L cells, C127 cells, 3T3 cells, Chinese hamster ovary (CHO) cells or derivatives thereof, HeLa cells, BHK cell lines, the CV1 / EBNA cell line derived from the African green monkey kidney cell line CV1, human embryonic kidney cells such as 293, 293EBNA, or MSR293, human epidermal A431 cells, human Colo205 cells, other transformed primate cell lines, normal diploid cells, cell lines derived from primary tissues cultured in vitro, primary explants, HL-60, U937, HaK, or Jurkat cells. Typically, the host cell is a cultured cell transformed or transfected with a peptide-encoded nucleic acid, which can then be expressed in the host cell. "Recombinant host cell" can be used to refer to a host cell that has been transformed or transfected with the nucleic acid to be expressed. In this invention, a suitable host cell can be transformed or transfected with DNA and can be used to express and / or secrete the antibody.
[0118] As used herein, “transformation,” “transfection,” and “transduction” refer to any method or means by which nucleic acids are introduced into a cell or host organism, and are used interchangeably to convey the same meaning. Such methods include, but are not limited to, transfection, electroporation, microinjection, and PEG fusion. The introduced nucleic acid may be integrated (covalently linked) or not integrated into the nucleic acid of the recipient cell or organism. For example, in bacterial, yeast, plant, and mammalian cells, the introduced nucleic acid may be maintained as a free element or an independent replicon such as a plasmid. Alternatively, the introduced nucleic acid may become integrated into the nucleic acid of the recipient cell or organism and be stably maintained in that cell or organism, and further transferred or inherited by the recipient cell or organism's progeny cells or organisms. Finally, the introduced nucleic acid may exist only transiently in the recipient cell or host organism.
[0119] Diagnostic applications This invention provides the diagnostic application of the antibody or its antigen-binding fragment for detecting MHV in animals known or suspected of being infected with mouse hepatitis virus.
[0120] The MHV antibody or its antigen-binding fragment can be used for immunoassays to detect or quantify MHV in a sample. Various clinical assay methods are well known in the art, such as competitive binding assays, direct and indirect sandwich assays, lateral flow assays (e.g., in strip form), bead-based assays, and immunoprecipitation assays. The samples include tissue biopsy samples, blood, serum, and fecal samples, or samples collected from animal subjects and administered with a biological fluid containing the aforementioned substances. The MHV antibody or its antigen-binding fragment can be paired together for compatibility in sandwich immunoassays. A sandwich immunoassay refers to the assay of the N protein of the target molecule MHV, wherein an antigen capture agent is attached to a solid surface, a mixture possibly containing MHV is contacted with the antigen capture agent, rinsed, and then contacted with one or more further antigen detection agents to detect or quantify the presence of MHV bound to the antigen capture agent. Therefore, the present invention allows for the selection of antibody pairs for sandwich immunoassays against the target molecule MHV, wherein one member of the antibody pair is an antigen capture agent and the second member of the antibody pair is an antigen detection agent. The present invention can utilize the MHV antibody or its antigen-binding fragment to determine antibody pairs in an immunoassay. In some embodiments, an antigen-capturing agent is used and paired with a variety of different MHV antibodies or antigen-binding fragments thereof in an immunoassay. In some embodiments, in a sandwich immunoassay, a variety of different antigen-capturing agents are paired with one of the MHV antibodies or antigen-binding fragments thereof.
[0121] In some embodiments, the antigen-capturing agent is attached to a solid support. The solid support refers to a support on which antigens and / or antibodies can be immobilized. Exemplary solid supports include porous plates, membranes (including nitrocellulose membranes and polyethylene membranes), cells and cell membranes, beads, microparticles, microspheres, and microbeads. The method of the present invention can be implemented with microparticles, microspheres, microbeads, or beads of any material, such as silica, gold, latex, polymers such as polystyrene, polysulfone, polyethylene, or hydrogels. Additionally, the microparticles, microspheres, beads, or microbeads may be magnetic. In some embodiments, the solid support comprises polystyrene. Optionally, the MHV antibody or its antigen-binding fragment may be attached to different solid supports depending on the detection method. Numerous methods for attaching antibodies to the surface of solid supports are known in the art.
[0122] In some embodiments, the MHV antibody or its antigen-binding fragment is conjugated to a detectable marker as an antigen detection agent. In some embodiments, the detectable marker is a reagent that directly generates a signal. For example, a fluorescent tag is directly detectable; or, for example, by binding to an enzyme or fluorophore. The target enzyme as a detectable marker is primarily a hydrolase, such as a phosphatase, esterase, or glycosidase, or an oxidotase, such as a peroxidase. Fluorescent compounds include luciferin and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, etc. Chemiluminescent compounds include luciferin and 2,3-dihydrophthalazinedione, such as luminol.
[0123] In some embodiments, the MHV antibody or its antigen-binding fragment is linked to an indirectly detectable marker, such as an affinity reagent. Affinity reagents include, but are not limited to, biotin, avidin, or streptavidin.
[0124] The detectable marker used in the assay can be any substance having detectable physical or chemical properties. Such detectable markers have been well developed in the field of immunoassays, and virtually any marker useful in this method can be applied to the present invention. Therefore, a detectable marker is any composition detectable by methods such as spectrophotometry, photochemical methods, biochemical methods, immunochemical methods, electrical methods, optical methods, or chemical methods. Detectable markers useful in the present invention include magnetic beads, fluorescent dyes (e.g., fluorescein isothiocyanate, Texas red, rhodamine, etc.), radioactive isotopes, enzymes (e.g., horseradish peroxidase, alkaline phosphatase, and other enzymes commonly used in ELISA), antibodies, ligands, antigens, receptors, and colorimetric labels such as colloidal gold or colored glass or plastic beads (e.g., polystyrene, polypropylene, latex, etc.) or combinations thereof.
[0125] Multiple detectable markers can be used simultaneously, and the selection of detectable markers depends on the required sensitivity, ease of conjugation with the compound, stability requirements, available equipment, and processing specifications.
[0126] Methods for detecting labels are well known to those skilled in the art. Therefore, for example, when the detectable label is a radioactive reagent, detection methods include scintillation counters or photographic film, such as in autoradiography. When the detectable label is a fluorescent reagent, it can be detected by exciting a fluorescent dye with light of a suitable wavelength and detecting the resulting fluorescence. Fluorescence can be visually detected using photographic film with electronic detectors such as charge-coupled devices (CCDs) or photomultiplier tubes. Similarly, enzyme reagents can be detected by providing the enzyme with a suitable substrate and detecting the resulting reaction product. Simple colorimetric reagents can be detected by observing the color associated with the label. Thus, in various test strip assays, conjugated gold typically appears pink, while different conjugated beads exhibit the color of the beads.
[0127] Some assays do not require the use of labeled components. For example, agglutination assays can be used to detect the presence of a target antigen. In this case, sample particles containing the target antigen agglutinate. In this assay, no labeling of the components is required, and the presence of the target antigen is detected by simple visual inspection.
[0128] Lateral flow immunochromatographic strips (or test strips, colloidal gold) In some embodiments, the detection reagent is a lateral flow immunochromatographic plate (plate) or test strip that utilizes the lateral flow principle. The constituent elements (or components) of the lateral flow immunochromatographic plate may be made from materials already available in the art.
[0129] A typical lateral flow immunochromatographic strip consists of the following components: (1) a sample pad—an absorbent pad on which the test sample is applied; (2) a conjugate or reactant pad—containing the MHV antibody or its antigen-binding fragment conjugated to colored particles (usually colloidal gold particles or latex microspheres), also known as an antigen detection agent; (3) a reaction membrane—usually a hydrophobic nitrocellulose or cellulose acetate membrane on which the MHV antibody or its antigen-binding fragment (also known as an antigen capture agent) is fixed with a line across the membrane as a capture zone or test line (a control zone may be present, containing an antibody specific to the conjugate antibody); and (4) a waste reservoir—another absorbent pad designed to draw the sample through the reaction membrane by capillary action and collect the sample. The components are typically fixed to an inert backing material and are presented in the form of a simple impregnated sheet, or contained in a plastic housing with a sample port and a reaction window displaying the capture zone and control zone.
[0130] There are two types of lateral flow immunochromatographic assays used for testing: the double-antibody sandwich assay and the competitive assay. In the double-antibody sandwich assay, the sample migrates from the sample pad through the conjugate pad, where any target analyte present will bind to the conjugate. The sample then continues to migrate across the membrane until it reaches the capture zone, where the target / conjugate complex binds to the immobilized antigen capture agent, creating a visible line on the membrane. The sample then migrates further along this zone until it reaches the control zone, where excess conjugate binds and creates a second visible line on the membrane. The control line indicates that the sample has migrated across the membrane as expected. Two clear lines on the membrane indicate a positive result. A single line in the control zone indicates a negative result. The competitive assay differs from the double-antibody sandwich assay in that the conjugate pad contains an antigen detection agent that has already bound to the target analyte or its analogue. If the target analyte is present in the sample, it will not bind to the conjugate. As the sample migrates along the membrane and reaches the capture zone, excess unlabeled target analyte binds to the immobilized antibody and blocks the capture conjugate, preventing the formation of a visible line. The unbound conjugate then binds to the antigen detection agent in the control zone, producing a visible control line. A single control line on the membrane indicates a positive result. Two visible lines in both the capture and control zones indicate a negative result. However, if excess unlabeled target analyte is absent, a weak line will be produced in the capture zone, indicating an indeterminate result. Many variations exist in flow measurement techniques. The capture zone on the membrane may contain immobilized antigen or enzyme—depending on the target analyte—rather than an antibody. Multiple capture zones may also be applied to produce multiplex assays. It should be understood that the scope of this invention is not limited to these.
[0131] The lateral flow immunochromatographic strip of the present invention has a simple, lightweight, and portable structure, allowing for on-site testing without the need for expensive equipment. The entire test for MHV using the lateral flow immunochromatographic strip can be completed within 10-20 minutes.
[0132] As used in this article, "subject" or "patient" refers to an animal affected by MHV that requires diagnosis or treatment. The animals include vertebrates, such as mammals like mice.
[0133] As used herein, “treatment” refers to both therapeutic procedures and preventative or preventative measures. Animals requiring treatment include those already infected with or exposed to MHV, as well as those requiring prevention of MHV infection. Treatment of a disease or condition includes prevention or protection against the disease or condition (i.e., preventing the development of clinical symptoms); suppression of the disease or condition (i.e., stopping or inhibiting the development of clinical symptoms); and / or relief of the disease or condition (i.e., causing the clinical symptoms to subside). Therefore, “prevention” as used herein should be understood as a part of “treatment,” encompassing both “prevention” and “suppression.”
[0134] Example The following embodiments and accompanying drawings are provided to aid in understanding the present invention. However, it should be understood that these embodiments and drawings are for illustrative purposes only and do not constitute any limitation. The actual scope of protection of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.
[0135] The flowchart for MHV virus antibody preparation is as follows: Figure 1 As shown. A. Mice were immunized with MHV-A59 virus via nasal drops for a total of four immunizations, and tail vein blood was collected to detect serological titers; B. Spleen tissue from mice was collected and milled to obtain a spleen cell suspension; C. Total RNA was extracted from mouse spleen cells and cDNA was synthesized using reverse transcription technology; D. A Fab library of mouse antibodies was constructed using nested PCR and homologous recombination, and then electroporated into TG1 bacteria to establish a phage display library; E. Using solid-phase screening technology, the amplified phage particles were screened in three rounds, and monoclonal antibodies from TG1 cells after the second and third rounds of elution were selected for ELISA and sequencing identification to obtain specific positive antibody sequences; F. The positive antibody sequences were subcloned into a mammalian cell expression vector, expressed in HEK293F cells, and purified to obtain monoclonal IgG antibodies; G. The affinity, specificity, and biological activity of the antibodies were verified using ELISA, Western blotting, and immunofluorescence methods, respectively.
[0136] Example 1. Preparation of MHV virus This embodiment relates to the preparation of MHV virus, which is carried out in a biosafety cabinet by culturing 17CL-1 cells to obtain a sufficient quantity and activity of MHV virus. The process involves multiple steps, including virus infection, amplification, collection, and purification.
[0137] 1.1 Methods 1) Cell seeding: 17Cl-1 cells were seeded at a depth of 90 mm. 2 In a cell culture dish, infection is performed when the cells have grown to a density of 80-90%.
[0138] 2) Viral infection: During the infection process, retain 5 mL of culture medium in the petri dish, add an appropriate amount of MHV-A59 virus to achieve an infection dose (MOI) of 0.1. Gently shake to mix the culture medium, and then incubate it in a 37°C incubator.
[0139] 3) Change the culture medium: Two hours after infection, discard the cell culture supernatant and add 10 mL of fresh culture medium to promote further viral replication.
[0140] 4) Virus collection: 48 hours after infection, collect the viral supernatant and centrifuge at 4000 rpm for 10 minutes to remove cell debris.
[0141] 5) Virus preservation: The collected MHV-A59 virus supernatant was aliquoted and stored in a freezer at -80°C to ensure the stability and activity of the virus.
[0142] 1.2 Results The harvested MHV virus titer was approximately 10. 5 pfu / mL.
[0143] Example 2. Immunization of C57BL / 6 mice with MHV virus In this embodiment, C57BL / 6 mice were infected to induce a specific immune response against mouse hepatitis virus, including activating the immune response and promoting plasma cell differentiation and maturation, thereby producing antibodies.
[0144] 1) Mouse preparation: Prepare 10 five-week-old C57 wild-type mice, with half being female and half being male (5 mice each).
[0145] 2) Viral infection: Five female and five male mice were selected and infected with MHV-A59 virus via nasal instillation. The viral titer was 1 × 10⁻⁶. 4 pfu / mL. Immunization was performed every 10 days, for a total of 4 immunizations.
[0146] 3) Observation and recording: Throughout the challenge process, the weight of the mice was monitored and the mortality rate was recorded to assess the impact of viral infection on the health of the mice.
[0147] 4) Blood sample collection: Blood samples were collected from the tail vein of mice on day 25 of immunization. After centrifugation at 4000 rpm for 10 minutes at 4°C, the supernatant serum was collected and stored at -80°C for subsequent serological titer determination.
[0148] 5) Spleen Collection: On day 37 (7 days after the last immunization), mice were deeply anesthetized and then sacrificed by cervical dislocation to obtain the spleen. The collected spleen tissue was aseptically cut and ground into a single-cell suspension. Subsequently, the cells were separated using Ficoll gradient centrifugation to obtain an enriched immune cell population for subsequent RNA extraction and cDNA transcription.
[0149] Example 3. Preparation of MHV virus N protein 3.1 Methods 1) The DNA sequence encoding the N antigen of MHV virus (SEQ ID NO: 92) was inserted into the pET28a vector using molecular cloning technology, and the six consecutive histidine (his) residues of the vector were used as affinity purification tags.
[0150] 2) Transform the recombinant plasmid into the Escherichia coli BL21(DE3) expression system, pick a single colony and inoculate it into 20 mL of LB medium, and incubate overnight at 37°C.
[0151] 3) The next day, transfer the culture to 1L of LB medium for further culture. When the bacterial culture OD... 600 When the concentration reaches 0.8, add IPTG inducer to a final concentration of 0.4 mM and continue incubation overnight at 16°C. Collect the cell pellet by centrifugation at 8000 rpm for 10 minutes and remove the supernatant.
[0152] 4) Resuspend the cell pellet in 60 mL of 1 × PBS buffer and sonicate at 300 W for 20 minutes.
[0153] 5) Centrifuge at 8000 rpm for 10 minutes and collect the supernatant. Filter the supernatant through a 0.45 μm filter membrane and incubate the filtered supernatant with an equilibrated nickel affinity chromatography column to bind the target protein.
[0154] 6) Optimize the use of different concentrations of imidazole eluent to remove non-specifically bound proteins and improve the purity of the target protein. For example, use 5 column volumes of 20 mM imidazole eluent to remove weakly bound proteins; then use 5 column volumes of 50 mM imidazole eluent for further washing to remove proteins with moderate affinity. Use incrementally increasing concentrations of imidazole eluent to obtain the best protein elution effect, such as using 3 column volumes of 100 mM, 150 mM, 200 mM, and 250 mM, respectively, and collect the eluent to concentrate and enrich the protein.
[0155] 7) Concentrate the target protein eluted at 250 mM using a 50 kDa ultrafiltration tube, centrifuge at 8000 rpm for 20-40 minutes, and measure the protein concentration.
[0156] 3.2 Results Electrophoresis results as follows Figure 2 As shown, the recombinant target protein was consistent with the expected size. The measured concentration was approximately 1 mg / mL, and the protein was aliquoted and stored at -80°C.
[0157] Example 4. Serological titer identification in mice This embodiment assesses the strength of the immune response against a specific MHV virus by measuring the antibody concentration in mouse serum. This process generally employs techniques such as dilution and ELISA to determine the antibody titer in the serum and assess the mouse's immune level against MHV infection.
[0158] 4.1 Methods 1) Antigen coating: The N antigen of MHV-A59 virus was coated onto the ELISA plate at a concentration of 300 ng / well. The control group was coated with PBS. The coated ELISA plates were incubated overnight at 4°C to ensure sufficient antigen adsorption.
[0159] 2) Washing and blocking: After coating, wash the wells of the ELISA plate three times with PBS to remove unadsorbed antigen. Then, add 2% BSA blocking buffer and incubate at 37°C for 1 hour to reduce nonspecific binding.
[0160] 3) Wash again: After sealing, wash the wells of the ELISA plate three times with PBS to prepare for the next experiment.
[0161] 4) Serum dilution and incubation: Collect serum from mice on day 25 after immunization and dilute it according to a concentration gradient (10... -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Dilute the sample to 100 μL in each well. Dilute the serum from control mice in the same proportion to serve as control wells. Incubate the ELISA plate at 37°C for 1 hour to allow the antibody to fully bind to the coated antigen.
[0162] 5) Washing and secondary antibody incubation: After incubation, wash the plate five times with PBS for 5 minutes each time. Then, add Goat anti-mouse HRP secondary antibody (Abcam, ab97625) diluted to 1:10000 and incubate at 37°C for 1 hour.
[0163] 6) Final washing and colorimetric reaction: After incubation, wash the plate five times with PBS for 5 minutes each time to ensure removal of unbound secondary antibody. After drying the plate, add 100 μL of TMB substrate solution (Beyotime, P0209) for colorimetric reaction. After the reaction has continued for 10 minutes, add 100 μL of 0.3 M H2SO4 stop solution to stop the colorimetric process.
[0164] 7) OD value determination: The OD value of each well was measured at a wavelength of 450 nm using an ELISA reader to assess the antibody titer in mouse serum, and the data was analyzed and the results were compiled.
[0165] 4.2 Results The antibody titer results in the serum of immunized mice are as follows: Figure 3 As shown. From Figure 3 It can be seen that the MHV virus successfully infected mice, and the serological titer of the infected mice was approximately 10. -5 Up to 10-4 between.
[0166] Example 5. RNA extraction This embodiment utilizes a microRNA extraction kit to rapidly and efficiently separate and purify intracellular RNA, and effectively remove DNA, proteins and other impurities, thereby ensuring that the extracted RNA has high purity and integrity.
[0167] 5.1 Methods 1) Using a micro RNA extraction kit (omega BIO-TEK, Cat#R6831-01), at a rate of 5-10 × 10⁻⁶ ppm. 5 Add 350 μL of cell lysis buffer to each cell and add the cell lysis buffer to the collected cell pellet.
[0168] 2) Lyse on ice for 10 minutes, gently mixing every 2-3 minutes to ensure complete cell lysis. Then, centrifuge at 12,000 rpm for 5 minutes at 4°C. Carefully aspirate the supernatant and add an equal volume of 70% ethanol, mixing thoroughly by inverting the container.
[0169] 3) Add the processed supernatant in batches (700 μL / batch) to the RNA recovery column and let it stand at room temperature for 2-5 minutes to allow the RNA to be fully adsorbed onto the RNA column.
[0170] 4) Next, centrifuge at 12000 rpm for 30 seconds and discard the filtrate. Dissolve the RNA in DEPC water preheated to 37°C and centrifuge again to obtain 30-50 μL of RNA, and measure the concentration using a Nanodrop 2000.
[0171] 5.2 Results The RNA concentration was measured to be approximately 550 ng / μL. The total RNA obtained can be used for reverse transcription to generate cDNA, or stored in a -80°C freezer for subsequent experiments.
[0172] Compared to traditional methods using chemical reagents such as chloroform or TRIzol to extract RNA, RNA extraction kits offer superior purity and integrity. High-purity RNA can serve as a template for cDNA synthesis, laying a solid foundation for subsequent DNA library construction.
[0173] Example 6. cDNA Synthesis In this embodiment, cDNA is synthesized using RNA as a template under the action of reverse transcriptase.
[0174] Using the SuperScript II reverse transcriptase kit (Thermo Fisher Scientific, Cat#18064014), 4 μg of RNA was reverse transcribed into cDNA. The reaction system preparations are shown in Tables 1 and 2. Reverse transcription reaction system 1 was prepared according to Table 1.
[0175] Table 1
[0176] Mix reverse transcription reaction system 1 thoroughly and place it on ice immediately after heating at 72°C for 3 minutes. Prepare reverse transcription reaction system 2 according to Table 2.
[0177] Table 2
[0178] Mix reaction system 1 and reaction system 2 thoroughly to a total volume of 50 μL. Place in a PCR instrument and set the reaction conditions as follows: 25℃ for 5 minutes; 42℃ for 60 minutes; 50℃ for 30 minutes; 70℃ for 10 minutes, then maintain at 4℃. After PCR, the synthesized cDNA can be used directly for subsequent experiments or stored at -20℃.
[0179] Example 7. Construction of Fab phage display library This embodiment describes a biobank constructed using phage display technology, which contains a large number of variable regions of heavy and light chains, enabling it to specifically recognize and bind antigens.
[0180] 7.1 Primer Design and PCR Amplification 7.1.1 Method 1) such as Figure 4 As shown, specific primers were designed targeting the heavy chain of mouse IgG1, IgG2A / IgG2B antibodies and the Fab region of the kappa light chain.
[0181] mVH-F: 5'-ATGGCAGACGTCMAGCTTCAGGAGTCRGGACC -3' (SEQ ID NO: 93); mVH -R: 5'-ATCCCTGGGGCACAATTTTCTTGTCCACC -3' (SEQ ID NO: 94); mVκ F: 5'-ATGGCARAMATTKTGCTGACYCARTYTCC-3' (SEQ ID NO: 95); mVκR: 5'- TGCGGCCGCACACTCATTCCTGTTGAAGCTCTTGAC -3' (SEQ ID NO: 96).
[0182] 2) The Fab region genes (approximately 700 bp) of mouse IgG1, IgG2A / IgG2B antibody heavy chains and kappa light chains were amplified by PCR. The PCR reaction system and reaction procedure for antibody Fab region gene amplification are shown in Tables 3 and 4, respectively.
[0183] Table 3
[0184] Table 4
[0185] 3) The amplification products were analyzed by agarose gel electrophoresis.
[0186] 7.1.2 Results: Electrophoresis results of amplification products are as follows Figure 5 As shown, in A, Lanes a to k are PCR products of the Fab gene induced by different primers for the IgG1 antibody heavy chain; in B, Lanes A to J are PCR products of the Fab gene induced by different primers for the IgG2A and IgG2B antibody heavy chains; and in C, Lanes 1 to 8 are PCR products of the Fab gene induced by different primers for the kappa antibody light chain. m is the DNA Ladder 2000 marker. Figure 5 It can be seen that the band sizes of the IgG1 antibody heavy chain Fab product, the IgG2A and IgG2B antibody heavy chain Fab product, and the kappa antibody light chain Fab product are all consistent with the design.
[0187] 7.2 Preparation of LinkD Fragments 7.2.1 Method 1) Design primers to prepare a LinkD fragment (approximately 120 bp) that connects the heavy and light chains.
[0188] 2) The amplification PCR reaction system and reaction procedure are shown in Table 5 and Table 6, respectively.
[0189] Table 5
[0190] Table 6
[0191] 3) The amplification products were analyzed by agarose gel electrophoresis.
[0192] 7.2.2 Results Electrophoresis results of amplification products are as follows Figure 6 As shown in the figure, the PCR product band size of LinkD is consistent with the design.
[0193] 7.3 Glue Recycling and Library Construction 7.3.1 Method 1) The antibody Fab region fragment and LinkD fragment were separately excised and recovered using gel electrophoresis. 2) Using overlap extension PCR technology, Fab-H, LinkD, and Fab-K were ligated. The reaction system and procedure for the first reaction of the Fab library overlap extension PCR are shown in Tables 7 and 8, respectively, and the reaction system and procedure for the second reaction are shown in Tables 9 and 10, respectively.
[0194] Table 7
[0195] Table 8
[0196] Table 9
[0197] Table 10
[0198] 3) The product was analyzed by agarose gel electrophoresis, and the library concentration was measured.
[0199] 7.3.2 Results The result of overlapping extension is as follows Figure 7 As shown, Figure 7 Lanes 1 and 2 are both Fab overlap extension PCR products. From... Figure 7 It can be seen that the antibody Fab library fragment size obtained through two-step PCR and gel recovery is approximately 1500 bp, consistent with the design, and the library concentration was measured to be approximately 300 ng / μL.
[0200] 7.4 Enzyme digestion of phage vectors 7.4.1 Method The phage vector pFab His-Display was double-digested with NcoI and SpeI restriction endonucleases. The vector and restriction site map are shown below. Figure 8 As shown in the figure. Electrophoretic gel recovery was then performed to prepare a linear support, and its concentration was measured.
[0201] 7.4.2 Results The carrier concentration was measured to be approximately 100 ng / μL.
[0202] 7.5 Homologous recombination reaction 7.5.1 Method Homologous recombination technology was used to mix the linear vector pFab His-Display with the Fab library fragment at a molar ratio of 1:4, with a total DNA volume of 1 μg. Homologous recombination was performed using 2 × SeamLess Mix (Biomed, Cat#CL117-01) at 50°C for 30 minutes. Finally, the ligation products were recovered using a standard PCR product recovery kit (Tiangen, Cat#DP204), and the concentration of the recovered products was measured.
[0203] 7.5.2 Results The measured concentration was approximately 50 ng / μL.
[0204] Fab fragments are typically smaller than intact antibodies, making them easier to apply. The construction process for Fab fragment display libraries is flexible and efficient, enabling the rapid generation and screening of a variety of different antibody variants. This approach not only reduces costs but also shortens the development cycle, greatly facilitating new drug development and clinical treatment.
[0205] Example 8. Phage Display and Screening In this embodiment, the constructed Fab phage library was introduced into TG1 competent cells via electroporation. After successful transformation, these phages displayed specific antibody fragments on the cell surface. A solid-phase screening method was used to bind the specific antibodies displayed on the phage surface to the target antigen. To improve the accuracy and specificity of the screening, 3-4 rounds of panning were required, each round including washing, elution, and phage amplification. In each round, unbound or weakly bound phages were continuously removed, ultimately yielding high-affinity positive clones.
[0206] 8.1 Demonstration 1) Dilute the homologous recombination ligation product with sterile water to 40 ng / μL, and electroporate 5 μL of ligation product per competent cell for a total of 4 TG1 cells (Zhuangmeng Biotechnology, Cat#ZC1018D).
[0207] 2) Before electroporation, 10 mL of SOC medium was preheated to 37°C and subjected to 8 150 mm [cells / cells / etc.]. 2 2 × YT-GA plates (containing 2% glucose and 100 μg / mL ampicillin) and 4 90 mm agar plates. 2 Two × YT-GA plates were used. Meanwhile, the 0.1 cm electroporation cup and ligation products were pre-cooled on ice, and four TG1 competent cells were thawed on ice.
[0208] 3) Transfer TG1 cells to an electroporation cuvette, add 5 μL of ligation product and electroporate. The electroporation parameters are set as follows: voltage 1.8 kV, pulse duration 10 μF, and impedance 600 Ω.
[0209] 4) After electroporation, TG1 cells were transferred to SOC medium and incubated at 37°C and 250 rpm for 1 hour. Subsequently, after centrifugation at 4000 rpm for 10 minutes, the supernatant was discarded, and the cell pellet was resuspended in 1 mL of medium. 1 μL of the bacterial culture was serially diluted 10-fold to a final volume. -1 10 -2 10 -3 10 -4 10 -5 and 10 -6 10 -3 10 -4 10 -5 and 10 -6 Take 100 μL of each grade of bacterial suspension and spread it to a depth of 90 mm. 2 The volume was determined on 2 × YT-GA plates. 1 mL of culture medium was added to the remaining bacterial culture, and then 250 μL was spread onto 150 mm thick plates. 2 2 × YT-GA plates. Place the plates in a 37°C incubator and incubate upside down overnight.
[0210] 5) On the second day, from 90 mm 2 Ten colonies were picked from a 2 × YT-GA plate, transferred to a 2 × YT-Amp medium, and cultured. Sequencing was performed to detect sequence diversity, ultimately yielding an actual library volume of 2 × 10⁻⁶. 8 A library of mice exhibiting anti-Fab phage.
[0211] 6) Collect 150 mm of the medium using 2 × YT-Amp. 2 All colonies on 2 × YT-GA plates were measured, and OD was measured. 600 value.
[0212] 7) Add 50 mL of 2 × YT-GA medium to a bacterial culture solution with a bacterial OD of 500, and incubate at 37℃ and 250 rpm until the OD reaches 0.5. 600 ≈0.6. Then, add approximately 6 × 10⁻⁶. 11 PFU M13K07 helper phage particles (bacteria to helper phage particles ratio of 1:10 to 1:20) were incubated at 37°C and 250 rpm for 30 minutes and then transferred to 50 mL centrifuge tubes.
[0213] 8) After centrifuging at 4000 rpm for 10 min, remove the supernatant, resuspend the cells in 50 mL of 2 × YT-Amp-Kan-IPTG (Amp 100 μg / mL, Kan 50 μg / mL, 1 mM IPTG) medium in a 250 mL culture flask, and express the cells overnight at 28℃ and 250 rpm.
[0214] 9) On day 3, the expressed phage particles were collected using PEG / NaCl precipitation technology, and 1 μL was serially diluted and used to infect TG1 cells to detect their titer.
[0215] 8.2 Selection Following solid-phase panning techniques, the amplified phage particles were panned three times. The concentrations of mouse hepatitis virus N protein used in each panning round were set to 15 μg / mL, 7.5 μg / mL, and 2.5 μg / mL, respectively. The amount of phage particles added in each round was approximately 1 × 10⁻⁶. 12 pfu.
[0216] 1) During the screening process, the MHV protein (MHV-N His-Tag) was diluted to the screening concentration using coating buffer and added to the microplate at 100 μL / well (10 wells per round of coating, and 2 negative control wells were prepared with PBS added). The plate was coated overnight at 4°C to ensure sufficient binding.
[0217] 2) The next day, seal with 5% PBSM (skimmed milk powder) for 2 hours, approximately 1 × 10 12 Pfu phage was diluted to 1.2 mL with PBSM and added to an ELISA plate at a rate of 100 μL / well. The plate was incubated at 37°C for 1 hour to specifically capture the phage.
[0218] 3) After incubation, discard the unbound phage liquid and wash with 0.05% PBST (10 washes in the first round, 15 washes in the second round, and 20 washes in the third round). After drying, add 100 μL of 0.2M glycine (pH 2.5) elution buffer to each well, incubate at room temperature for 10 min, collect the elution buffer into a 1.5 mL centrifuge tube, and immediately add 1M Tris-HCl (pH 9.0) for neutralization.
[0219] 4) At the same time, prepare OD 600 Fresh TG1 cells with a titer of approximately 0.6 were used. 10 μL of elution buffer was serially diluted 10-fold to infect TG1 cells. 5 μL of bacterial culture was added to 2 × YT-GA plates for each dilution to determine the elution titer.
[0220] 5) In addition, 900 μL of elution buffer was used to inoculate 5 mL of TG1 cells and spread to a depth of 150 mm. 2 Place the plates on 2 × YT-GA plates and incubate them upside down in a 37°C incubator overnight.
[0221] 6) On the second day, repeat the phage amplification steps to carry out the next round of phage amplification and expression.
[0222] Example 9. Identification of positive clones and sequence extraction In this embodiment, the phage elution buffer from the second or third round of panning is used to inoculate phages. Single clones are selected for expression and verification of their affinity for the target antigen. The antigen-antibody complex is detected by ELISA to confirm their binding ability and affinity. After confirming its specificity, the phages of positive clones are amplified, and their DNA is extracted and subjected to Sanger sequencing to obtain the Fab gene sequence.
[0223] 9.1 Methods 1) The second and third rounds of elution buffer were serially diluted and used to inoculate TG1 cells, which were then plated onto 2 × YT-GA plates. The next day, single clones were selected from the plates and transferred to 250 μL of 2 × YT-Amp medium (using a 96-well deep-well plate). After incubation at 37°C and 250 rpm for 3 hours, 50 μL of the bacterial culture was collected and stored for subsequent experiments.
[0224] 2) Add approximately 3 × 10⁻⁶ to 200 μL of bacterial culture. 9 PFU's M13K07 helper phage was incubated at 37°C and 250 rpm for 30 min to promote the adsorption and infection of the helper phage.
[0225] 3) Subsequently, antibiotics (kanamycin) were added to the bacterial culture to a final concentration of 50 μg / mL, and IPTG was added to a final concentration of 1 mM. The culture flasks were then incubated overnight at 28°C and 250 rpm to express the recombinant phage.
[0226] 4) On the third day, the supernatant of the expressed phage was collected by centrifugation at 4000 rpm for 10 min and single-clone identification was performed using the ELISA method.
[0227] 5) Select OD from the experimental group 450 For samples with an OD value greater than 0.5, the negative control's OD value should also be confirmed. 450 The result was negative to ensure that the selected phage could specifically bind to the MHV viral nucleoprotein (MHV-N His-Tag). Subsequently, next-generation sequencing technology was used for sequencing and antibody sequence analysis.
[0228] 9.2 Results In this embodiment, a total of 45 experimental groups of OD were selected. 450 The value is greater than 0.8, and the OD value of the negative control group is also higher. 450 Phage clones with a ELISA value less than 0.2 were sequenced. Analysis and comparison of the sequencing results yielded 21 unique antibody sequences, which will be further validated through expression and characterization. Some ELISA data and sequencing results are shown below. Figure 9 As shown in Table 11.
[0229] Table 11
[0230] Example 10. Subcloning of positive antibody sequences into human IgG1 and IgK expression vectors In this embodiment, the VH and VL sequences obtained from positive clones were cloned into expression vectors for the human IgG1 heavy chain and IgK light chain, respectively. Plasmids with correct and verified sequences were extracted and transfected into HEK293F cells. Recombinant antibodies were then expressed in a eukaryotic cell system.
[0231] 1) Design specific primers and use PCR and homologous recombination techniques to subclone the heavy chain variable region and light chain variable region of the positive antibody into the mammalian cell expression vector IgG1 heavy chain and IgK light chain, respectively.
[0232] 2) In antibody backbone construction, the antibody targeting MHV-N protein utilizes the constant region of human IgG1 and the constant region of the kappa light chain. The expression vector map is shown below. Figure 10 As shown.
[0233] 3) After the recombinant plasmid was confirmed to be correct by sequencing, the plasmid was prepared using the Tiangen endotoxin-free plasmid extraction kit (Tiangen Biochemistry, Cat#DP118-02) to ensure the efficiency and safety of subsequent experiments.
[0234] Example 11. Antibody expression and purification in HEK293F cells In this embodiment, plasmids encoding the heavy and light chains were mixed in a 1:1 ratio and co-transfected into HEK293F cells using PEI transfection reagent. After transfection, the cells were cultured at 37°C and 5% CO2. After 72 hours, the supernatant from the culture medium was collected to obtain the expressed recombinant antibody. Antibody purification was performed using an affinity chromatography column packed with Protein A, which specifically binds to antibodies against human IgG. Unbound impurities were removed in washing buffer, and the antibody was eluted with an appropriate elution buffer (such as Glycine / Tris-HCl buffer). Finally, the purified antibody was analyzed by SDS-PAGE to assess its purity and molecular size, thereby verifying its quality and function.
[0235] 11.1 Methods 1) Remove HEK293F cells from the liquid nitrogen container and rapidly resuscitate them in a 37°C water bath. Then, transfer the resuscitated cells to 10 mL of OPM-293 CD05 medium preheated to 37°C, centrifuge at 200 × g for 5 min, and discard the supernatant. Resuspend the cells and count them at 0.5 × 10⁻⁶ cells / mL. 6 The cells were seeded into shake flasks at a density of cells / mL and cultured at 37°C, 130 rpm, and 8% CO2.
[0236] 2) Within 3 to 4 days after resuscitation, perform cell dilution passages, with a seeding density of 0.3–0.5 × 10⁻⁶ cells per passage. 6 cells / mL. After three passages, the cell viability recovers to over 95%, and transient expression experiments can be performed.
[0237] 3) One day before transfection (D-1), based on the cell count results, take an appropriate amount of cell suspension, centrifuge at 200 × g for 5 min, discard the supernatant, and resuspend the cell pellet in fresh culture medium to 0.9 × 10⁻⁶. 6 cells / mL, continue culturing.
[0238] 4) On the day of transfection (D0), prepare a DNA-PEI suspension using PBS according to the volume of the cell suspension. After incubating at room temperature for 5-10 min, add the suspension dropwise to the cell suspension, mix gently, and then express the cells at 37℃, 130 rpm, and 8% CO2. The transfection system is shown in Table 12.
[0239] Table 12
[0240] 5) 48 to 72 hours after transfection (D2~D3), add 5% OPM-293 ProFeed to the cell suspension to continuously support cell expression. Continue culturing to D5, then centrifuge the cell suspension at 4000 rpm for 20 min and collect the supernatant for subsequent purification.
[0241] 6) The collected supernatant was purified by gravity column chromatography using Protein A affinity chromatography media. During this process, the antibody was captured by Protein A and washed with PBS to remove non-specifically bound impurities. Subsequently, the bound antibody was eluted with 0.1M glycine elution buffer at pH 3.4 and immediately neutralized with 1M Tris-HCl buffer at pH 8.5 to prevent antibody denaturation at low pH.
[0242] 7) The purified antibody was processed by Amicon. ® An ultrafiltration filter (MWCO = 50 kDa) was used to replace the glycine buffer with PBS. Antibody concentration was then measured using Nanodrop, and SDS-P... AGE Electrophoretic identification.
[0243] 11.2 Results SDS-PAGE electrophoresis results are as follows: Figure 11 As shown. From Figure 11It can be seen that some of the selected antibodies, 2G2, 2G6, 3A6, 3G10, 4A1, 4B11, and 4C7, after reduction, have a heavy chain of approximately 50 kDa and a light chain of approximately 25 kDa, which is consistent with the expected results and verifies the successful expression and purification of the antibodies.
[0244] Example 12. ELISA detection of antigen-antibody binding affinity This embodiment evaluated the binding affinity of the antibody to its target (antigen), typically expressed as the dissociation constant (Kd). A lower Kd value indicates a higher affinity between the antibody and the antigen, and vice versa. Different types of antibodies may have different affinity ranges; generally, high-affinity antibodies typically have a Kd value in the range of 10. -10 Up to 10 -12 Mullions (M) exhibit strong binding affinity. The most commonly used affinity detection methods include enzyme-linked immunosorbent assay (ELISA), surface plasmon resonance (SPR), and biomembrane interferometry (BLI). These techniques can effectively monitor the kinetics and thermodynamics of antibody-antigen interactions.
[0245] 12.1 Method 1) Dilute the MHV virus N protein to 1 μg / mL with coating buffer, add it to a 96-well microplate at a ratio of 100 μL / well, and incubate overnight at 4°C to ensure sufficient protein binding.
[0246] 2) On the second day, after discarding the coating solution, wash the plate three times with 0.05% PBST, then add 200 μL of 5% PBSM to each well and block at 37°C for 2 hours to reduce nonspecific binding.
[0247] 3) After discarding the blocking buffer and washing again, add 100 μL of serially diluted antibody to each well and incubate at 37°C for 1 hour. Then discard the samples and wash 5 times with PBST to remove unbound antibodies. Next, add 100 μL of the detection secondary antibody anti-human IgG Fc (HRP, 1:10000 diluted in 1% PBSM) to each well and incubate at 37°C for 1 hour.
[0248] 4) After incubation, discard the secondary antibody and wash five times with PBST. Then, add 100 μL of TMB chromogenic solution to each well and incubate at room temperature in the dark for approximately 10 minutes. Finally, add 50 μL of stop solution and read the OD using a microplate reader. 450 value.
[0249] 5) Use GraphPadPrism8 software to perform four-parameter nonlinear regression analysis on the experimental data to calculate the antibody affinity.
[0250] 12.2 Results Determining antigen-antibody affinity, such as Figure 12 As shown, from Figure 12 It can be seen that the affinity range between MHV-N antigen and antibody is within 10. -10 Up to 10 -12 Between M. These results demonstrate that high-affinity antibodies with good binding properties were successfully screened using Fab phage display technology, laying a solid foundation for subsequent applications. The amino acid and nucleotide sequences of the variable regions of the antibodies are available in the sequence listing, and they have the SEQ ID NOs shown in Table 13 below. In these sequences, the CDR is determined based on the IMGT numbering system.
[0251] Table 13
[0252] Example 13. Western blotting to validate the detection of MHV virus samples by the prepared antibody. This embodiment uses Western blotting to verify the specificity of the prepared antibody against mouse hepatitis virus (MHV) samples. When verifying the specificity of the prepared antibody against MHV samples, this method can accurately identify and quantify the target protein through steps such as electrophoretic separation, membrane transfer, and antibody binding, thereby confirming the effectiveness and specificity of the prepared antibody.
[0253] 13.1 Methods 1) Sample preparation: 17CL-1 cells were cultured in 6-well plates until the cell density reached approximately 60%. They were then infected with MHV virus at an infection titer of approximately 1 MOI. The culture medium was changed 8 hours after infection, and the cells were cultured for another 24 hours to obtain sufficient viral expression. A Blank group was set up in the experiment, using uninfected MHV-1 cells as a control group.
[0254] 2) Cell lysis: Digest cells in 6-well plates with trypsin, centrifuge at 1500 rpm for 5 min, and discard the supernatant. Add 150 μL of lysis buffer to each sample, incubate on ice for 30 min to lyse the cells, then centrifuge at 12000 rpm at 4℃ for 10 min, collect the supernatant and determine the protein concentration.
[0255] 3) Protein sample processing: Mix 20-30 μg of protein sample with SDS buffer, and then boil the sample in a metal bath at 95℃ for 10 min.
[0256] 4) SDS-PAGE electrophoresis: Load the prepared sample into an SDS-PAGE gel and perform electrophoretic separation at 100V until the dye front reaches the bottom of the gel.
[0257] 5) Transfer: After electrophoresis, the SDS-PAGE gel is bound to a PVDF or nylon membrane, and the protein is transferred from the SDS-PAGE gel to the membrane using a wet transfer method. The transfer conditions are usually set to a constant current of 400 mA for 60 min.
[0258] 6) Blocking: After the transfer is complete, block the membrane with 5% milk or BSA solution at room temperature for 1 hour to reduce nonspecific binding.
[0259] 7) Primary antibody incubation: Wash the membrane three times with 0.2% PBST for 5 minutes each time. Incubate the membrane with an antibody against MHV-N protein (diluted 1:1000, concentration 1 mg / mL) overnight at 4°C to ensure effective binding of the antibody to the N protein.
[0260] 8) Washing: Wash the membrane 5 times with 0.2% PBST or TBST buffer for 5 minutes each time to remove unbound primary antibody.
[0261] 9) Secondary antibody incubation: Immerse the membrane in diluted HRP-labeled secondary antibody solution (dilution ratio 1:5000) and incubate at room temperature for 1 hour.
[0262] 10) Wash again: Wash the membrane 6 times with 0.2% PBST or TBST buffer for 5 minutes each time to remove unbound secondary antibody.
[0263] 11) Color development and imaging: The film is treated with a chemiluminescent substrate (ECL), and the signal is detected using an imaging system at an appropriate exposure time.
[0264] 13.2 Results The results are as follows Figure 13 As shown, from Figure 13 As can be seen, antibodies with clone numbers 2G6, 3G10, 2G2, 3A6, 4B11, 4C7, and 4A1 can specifically detect MHV virus-infected samples, while no signal was detected in the Blank group (uninfected cell samples) used as a control. This indicates that the prepared antibodies can specifically recognize the N protein of MHV virus. In particular, 3G10 and 2G2 showed the best results.
[0265] Example 14. Immunofluorescence detection This embodiment uses fluorescently labeled antibodies to detect the specific binding between antibodies and mouse hepatitis virus (MHV), and observes the fluorescence signal under a microscope to confirm whether the antibodies can specifically recognize and bind to the N antigen in MHV samples.
[0266] 14.1 Methods 1) Cell preparation: 17CL-1 cells were cultured in confocal microscope dishes until the cell density reached approximately 60%. Subsequently, the cells were transfected with the MHV-N mCheery plasmid. The culture medium was replaced with fresh medium 8 hours after transfection, and the cells were cultured for another 24 hours to ensure the expression of the red fluorescent N protein.
[0267] 2) Cell fixation: Remove the culture medium from the confocal dish and wash once with PBS to remove residual culture medium. Then fix the cells with 4% paraformaldehyde for 10 minutes to maintain cell morphology and fix intracellular proteins.
[0268] 3) Cell permeabilization: Wash three times with PBS for 5 minutes each time to remove paraformaldehyde fixative. Then, perform permeabilization treatment with 0.1% Triton X-100 for 5-10 minutes to enhance the ability of antibodies to enter cells.
[0269] 4) Cell blocking: Add 2.5% BSA blocking solution and incubate at room temperature for 1 hour to reduce non-specific binding, thereby improving the specificity and sensitivity of subsequent experiments.
[0270] 5) Primary antibody incubation: Dilute the antibodies (2G6, 3G10, 2G2, 3A6, 4B11, 4C7, and 4A1) at a ratio of 1:1000 to a concentration of approximately 1 mg / mL. Add 200 μL of the diluted antibody solution to each sample and incubate overnight at 4°C to improve the binding specificity of the antibody to the target protein.
[0271] 6) PBS washing: Wash the confocal dish with PBS 3-5 times, 5 minutes each time, to remove unbound primary antibody and ensure signal specificity.
[0272] 7) Secondary antibody incubation: Add FITC fluorescent secondary antibody, dilute it at a ratio of 1:500, and incubate at room temperature in the dark for 1 hour to facilitate efficient recognition of the primary antibody.
[0273] 8) Wash again: Wash the confocal dish 5 times with PBS for 5 minutes each time to remove unbound secondary antibody and reduce background signal.
[0274] 9) DAPI staining: Dilute the DAPI stock solution to a working concentration of 0.1-1 μg / mL and incubate at room temperature in the dark for 5-10 minutes to stain the cell nuclei.
[0275] 10) Observe the experimental results using a fluorescence microscope.
[0276] 13.2 Results Immunofluorescence assays showed the binding of MHV-N antibodies to MHV-infected cells as follows: Figure 14 As shown. From Figure 14As can be seen, transfected MHV-N positive cells exhibit red fluorescence, while cells stained with MHV-N antibody show green fluorescence. The red and green fluorescence completely overlap, indicating that the N protein expressed in transfected MHV-N mCherry cells can be recognized by the prepared N antibody.
[0277] Antibodies with high affinity and specificity provide important tools for a deeper understanding of the biological characteristics and pathological mechanisms of MHV.
[0278] Example 15. Colloidal gold reagent kit for MHV virus detection This embodiment uses a colloidal gold reagent kit to validate MHV antibodies. Colloidal gold is an immunochromatographic assay that utilizes gold nanoparticles to form colloidal gold complexes with specific antibodies or ligands to capture target molecules. The sample to be tested (such as blood, urine, or other biological fluids) is applied to the sample window of the test strip, and the sample flows downwards through capillary action. During this process, the target molecules in the sample bind to the colloidal gold-labeled antibody, forming a visible result line. Detection results can be obtained within minutes, making this method ideal for rapid diagnosis. Its greatest advantage lies in the lack of complex equipment and its simple operation, making it suitable for on-site testing. Furthermore, colloidal gold offers high sensitivity and affordability, and is widely used in medical diagnostics, food safety monitoring, and environmental applications.
[0279] 15.1 Methods 1) Pretreatment of sample pad Place the sample pad in the sample pad treatment solution and spread it evenly to fully wet it. Then, place the sample pad in an oven at 37°C and dry it overnight. After drying, seal and store it for later use.
[0280] 2) Preparation of gold-labeled probes Add 1 mL of gold nanoparticles (AuNPs) to a 2 mL centrifuge tube, followed by 24 μL of 0.2 M K₂CO₃ solution to adjust the pH of the AuNPs. Then, add 10 μg of labeled antibody, mix well at room temperature, and allow to bind for 20 minutes. Subsequently, add 10 μL of blocking buffer and react for 15 minutes. Centrifuge at 4 °C and 1000 rpm for 10 minutes. Finally, reconstitute with 20 μL of gold-labeled dilution buffer to obtain the gold-labeled antibody.
[0281] 3) Gold spraying The gold-labeled antibody was diluted to 60 OD / μL using gold-labeled diluent. At room temperature, the gold-labeled antibody was sprayed onto the gold-labeled pad using an XYZ 3D gold sprayer (HM3030, Goldlabel Biotech, China) at a rate of 2.5 μL / cm. After spraying, the gold-labeled antibody pad was placed in a 37°C oven overnight to dry and then sealed for storage.
[0282] 4) Scratching membrane The capture antibody was diluted to 1 mg / mL as the T line, and the Goat Anti-Human IgG was diluted to 1 mg / mL as the C line. The strips were then drawn using an XYZ three-dimensional gold-spraying spectrometer at a speed of 100 mm / s. After drawing, the strips were placed in a 37°C oven and dried overnight before being sealed and stored.
[0283] 5) Test strip assembly Apply NC film to the center of the PVC backing, ensuring that the T line faces the front and the C line faces the rear.
[0284] Place the gold label pad on the side closest to the T line, so that the gold label pad overlaps the NC film by about 1.5 mm.
[0285] Place the sample pad on the outside of the gold label pad, ensuring a 1.5 mm overlap between them.
[0286] Place the absorbent pad on the side closest to the C line, ensuring that the absorbent pad overlaps the NC membrane by approximately 1.5 mm.
[0287] Cut the assembled test strips into 3 mm wide strips and seal them for storage.
[0288] 6) Testing Add 60 μL of different test samples to the sample pad and wait 15 minutes before recording the results. If both the T line and the C line develop color, the result is positive; if the T line does not develop color but the C line does, the result is negative; if neither the T line nor the C line develops color, or only the T line develops color, the result is invalid. In positive results, a lighter T line indicates a weak positive, while a darker T line indicates a strong positive.
[0289] 15.2 Results 1) Results of colloidal gold detection of N protein in recombinant MHV are as follows: Figure 15 As shown. From Figure 15 It can be seen that some of the selected antibody pairs, such as 5B9-4C7, 4A1-4E6, 4C7-5B9, 3A6-5B9, and 3A6-4A1, can effectively recognize the N protein antigen of MHV.
[0290] 2) The screened 5B9-4C7 antibody pair was further used to detect MHV virus particles and different tissues of MHV-infected mice. The results are as follows: Figure 16 As shown. From Figure 16 It can be seen that the 5B9-4C7 antibody pair can effectively detect the N protein of recombinant MHV, MHV virus particles, liver and blood of MHV-infected mice, etc.
[0291] The colloidal gold detection kit is simple and fast, providing results in 15-20 minutes. It requires no special equipment or professional personnel and is suitable for large-scale screening. The price is 1 / 10 to 1 / 50 of that of ELISA and qPCR kits on the market, and it has potential translational application value in the detection of mouse hepatitis virus.
[0292] The sequences of some light chain complementarity determination regions in this paper are shown in the table below.
[0293] This invention employs Fab phage display technology to display antibody fragments on the surface of phages, enabling the rapid screening of a large number of antibody variants and significantly improving screening efficiency. Furthermore, this technology selects antibody fragments that bind to the target antigen, thereby obtaining antibodies with high affinity and high specificity, further enhancing their recognition capabilities. Crucially, this technology allows for the rapid screening and optimization of specific antibodies against different subtypes or variants of MHV, meeting ever-evolving research needs.
[0294] This invention also employs a method of immunizing mice with viral particles. This strategy helps induce a stronger and more durable immune response, thereby obtaining antibodies with higher affinity and specificity. This method is superior to traditional recombinant protein immunization methods, providing a more physiologically relevant environment for antibody production.
[0295] The high-affinity and specific antibody against the N protein of mouse hepatitis virus developed in this invention provides a new tool for the early diagnosis of mouse hepatitis virus, not only for basic research on coronaviruses (revealing the biological characteristics of MHV and its interaction with the host immune response) and vaccine development (as an important component of vaccine development to improve vaccine immunogenicity), but also for animal facilities and large animal centers.
[0296] In summary, this invention, based on Fab phage display technology and a novel strategy for viral particle immunization, lays the foundation for developing high-affinity and specific mouse hepatitis virus antibodies. It not only provides important support for MHV-related research and applications but also has broad market prospects and social value.
[0297] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.
Claims
1. An antibody or antigen-binding fragment thereof that specifically binds to mouse hepatitis virus N protein, wherein the antibody or antigen-binding fragment thereof comprises: Heavy chain variable regions containing heavy chain complementarity-determining regions VH-CDR1, VH-CDR2, and VH-CDR3, and light chain variable regions containing light chain complementarity-determining regions VL-CDR1, VL-CDR2, and VL-CDR3. The heavy chain variable region includes: (a) VH-CDR1, whose amino acid sequence is shown in SEQ ID NO:10; (b) VH-CDR2, whose amino acid sequence is shown in SEQ ID NO:11; (c) VH-CDR3, whose amino acid sequence is shown in SEQ ID NO:12; The light chain variable region includes: (e) VL-CDR1, whose amino acid sequence is shown in SEQ ID NO:14; (f) VL-CDR2, whose amino acid sequence is SAS; (g) VL-CDR3, whose amino acid sequence is shown in SEQ ID NO:
16.
2. The antibody or its antigen-binding fragment according to claim 1, wherein, The heavy chain variable region contains the amino acid sequence shown in SEQ ID NO: 9, and the light chain variable region contains the amino acid sequence shown in SEQ ID NO:
13.
3. The antibody or its antigen-binding fragment according to claim 1, wherein the antibody is immunoglobulin G (IgG), IgM, IgE, IgA or IgD.
4. The antibody or its antigen-binding fragment according to claim 3, characterized in that, The antibody contains a constant region of IgG1, IgG2, IgG3, or IgG4.
5. An isolated nucleic acid molecule comprising a nucleotide sequence encoding a heavy chain variable region and a light chain variable region of an antibody or an antigen-binding fragment thereof as described in any one of claims 1-4.
6. The nucleic acid molecule according to claim 5, characterized in that, The nucleic acid molecule comprises: Nucleotide sequences containing SEQ ID NO:75 and SEQ ID NO:
76.
7. An expression vector comprising the nucleic acid molecule of claim 5 or 6.
8. A host cell comprising the nucleic acid molecule of claim 5 or 6 or the expression vector of claim 7.
9. A pharmaceutical composition comprising an antibody or antigen-binding fragment thereof as described in any one of claims 1-4, a nucleic acid molecule as described in claim 5 or 6, an expression vector as described in claim 7, a host cell as described in claim 8, and a pharmaceutically acceptable carrier.
10. Use of the antibody or antigen-binding fragment thereof of any one of claims 1-4, the nucleic acid molecule of claim 5 or 6, the expression vector of claim 7, the host cell of claim 8, or the pharmaceutical composition of claim 9 in the preparation of a medicament for neutralizing MHV virus in a subject, preventing and / or treating MHV infection.
11. A reagent for detecting the presence or level of MHV in a biological sample, comprising an antigen capture agent and / or an antigen detection agent selected from the antibodies or antigen-binding fragments thereof according to any one of claims 1-4.
12. The reagent of claim 11, wherein the antigen detection agent is conjugated with a detectable marker.
13. The reagent according to claim 12, wherein the detectable marker is selected from magnetic beads, fluorescent dyes, radioactive isotopes, enzymes, biotin, metals, or any combination thereof.
14. The reagent according to any one of claims 11-13, wherein the antigen detection reagent comprises a metal marker.
15. The reagent of claim 14, wherein the reagent is a lateral flow immunochromatographic slide comprising an antigen capture agent and a metal-labeled antigen detection agent.
16. Use of the antibody or antigen-binding fragment thereof of any one of claims 1-4 in the preparation of a reagent for detecting the presence or level of MHV in a biological sample.