A molecular marker related to the testis traits of heterologous tetraploid crucian carp and application thereof
By analyzing the SNP sites of the ZSWIM7 gene in allotetraploid crucian carp using PCR amplification and Sanger sequencing, the problem of screening testicular traits in allotetraploid crucian carp was solved, enabling efficient screening of individuals with strong reproductive capacity and ensuring the continuation of germplasm resources and breeding effectiveness.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUNAN NORMAL UNIVERSITY
- Filing Date
- 2025-09-02
- Publication Date
- 2026-07-31
AI Technical Summary
Existing technologies are insufficient for efficiently screening testicular traits in allotetraploid crucian carp, leading to a decline in their reproductive performance and impacting the continuation of germplasm resources and breeding outcomes.
By designing specific primer pairs for PCR amplification of the SNP site of the ZSWIM7 gene in allotetraploid crucian carp, combined with Sanger sequencing analysis, the gonadal development of allotetraploid crucian carp was screened, and individuals with strong reproductive capacity were selected.
This method enables efficient and accurate screening of allogeneic tetraploid crucian carp with strong reproductive capacity. It features high genetic stability, simple operation, low testing cost, minimal harm to fish fry, protection of experimental materials, and improved utilization of experimental materials.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker related to the testicular traits of allotetraploid crucian carp and carp and its application. Background Technology
[0002] Allotetraploid crucian carp (scientific name: *Allotetraploid Carassius auratus red* var. *xCyprinus carpio*) is a sexually fertile tetraploid fish independently bred in my country. It is the world's first tetraploid fish strain obtained through interspecific hybridization, holding significant importance in fish genetics, breeding, and species evolution research. Triploid varieties such as *Xiangyun* crucian carp, *Xiangyun* crucian carp No. 2, and *Xiangyun* carp, obtained by crossing allotetraploid crucian carp with diploids, exhibit excellent traits such as rapid growth, delicious flesh, and strong resistance to adverse conditions, demonstrating significant economic value in actual production. As a high-quality parent, the reproductive capacity of allotetraploid crucian carp is closely related to economic benefits. Testicular development is a crucial step in producing high-quality sperm, directly affecting sperm quality and quantity, thus influencing the fertilization process, embryonic development, and offspring health, and is vital for producing high-quality offspring and perpetuating this germplasm resource. However, during long-term self-pollination, the reproductive performance of allotetraploid crucian carp has declined. Therefore, it is necessary to develop germplasm resource preservation technologies, establish a sound preservation system, and improve the preservation population to provide a basic guarantee for the continuation of the valuable allotetraploid crucian carp strain and for the breeding of polyploid fish.
[0003] Meiosis, a core stage in germ cell development, plays a crucial role in maintaining genetic stability and diversity. Studies have shown that the ZSWIM7 gene plays a key role in meiosis. During homologous recombination, ZSWIM7 interacts with key proteins such as RAD51 and DMC1, promoting the correct assembly of these proteins on chromosomes and ensuring the formation and stability of early meiotic recombination intermediates. This mechanism is essential for the successful progression of meiosis. Simultaneously, as a core pathway for DNA repair, homologous recombination mediates the precise pairing and repair of damaged DNA fragments with intact homologous DNA sequences. The ZSWIM7 gene plays a vital role in the normal function of the testes and sperm production; mutations or functional abnormalities can lead to impaired sperm production, resulting in diseases such as non-obstructive azoospermia (NOA). Therefore, applying molecular markers present in the coding region of the ZSWIM7 gene to screen for gonadal development in allotetraploid crucian carp will provide a basis for the continuation and breeding of allotetraploid crucian carp germplasm resources.
[0004] In fish reproductive and developmental studies, molecular marker technology is an important screening tool. Traditional molecular marker methods are mainly based on molecular hybridization and PCR techniques, including restriction fragment length polymorphism (RELP) and amplified fragment length polymorphism (AFLP) marker technologies. RELP marker technology works by using restriction endonucleases to digest DNA and detecting the size of DNA fragments, thereby analyzing the variation characteristics of DNA sequences among different individuals or populations. However, AFLP marker technology involves multiple steps such as DNA extraction, enzyme digestion, and electrophoresis, making it cumbersome, time-consuming, and requiring extremely high DNA quality, thus limiting its application. Furthermore, it can only provide limited DNA sequence information, identifying only single-copy sequences of the genome and cannot explain complex genetic variations. AFLP marker technology works by detecting DNA fragments of different lengths after restriction endonuclease digestion. However, AFLP marker kits are expensive, and the experiment involves isotope labeling, requiring strict quality control of the sample DNA.
[0005] Single nucleotide polymorphisms (SNPs) are third-generation molecular markers, essentially sequence polymorphisms resulting from single-base substitution events occurring throughout the entire genome. SNP sites are widely distributed and highly dense in the genomes of various organisms: on average, there is one SNP site per 300 base pairs in the human genome, while the SNP density in fish can range from several to tens per thousand base pairs. Compared to other DNA polymorphic markers, SNPs have advantages such as high genetic stability and strong data reliability. Currently, SNPs have been applied to variety identification of crops such as wheat and rice, screening for disease-resistant strains in fish such as grouper and large yellow croaker, and screening for growth and developmental traits in livestock such as cattle and pigs. Therefore, analyzing the distribution of SNP sites and genotypes in the allotetraploid crucian carp ZSWIM7 gene will provide important evidence for developing new SNP markers, promoting the continuation of germplasm resources, and advancing breeding efforts for this fish species. Summary of the Invention
[0006] To address the above problems, this invention provides a molecular marker related to the testicular traits of allotetraploid crucian carp and its application. This method analyzes the distribution of SNP sites and genotypes of the ZSWIM7 gene in allotetraploid crucian carp using SNP molecular markers, which can efficiently screen the gonadal development of allotetraploid crucian carp.
[0007] This invention is achieved through the following technical solution: A molecular marker associated with testicular traits in allotetraploid crucian carp, the molecular marker being located in the ZSWIM7 gene, the sequence of the molecular marker being shown in SEQ ID NO:1, the 23rd nucleotide of the sequence being an SNP site.
[0008] This invention provides a primer pair for amplifying molecular markers associated with the testicular traits of allotetraploid crucian carp, as described above. The sequences of the primer pair are as follows: L1-F: 5'-ATGGGCTCATCTCTGCTTTCT-3'; L1-R: 5'-CTGAGAGAATGTGGGTCATCTGC-3'.
[0009] The present invention provides a kit for detecting molecular markers associated with the testicular traits of allotetraploid crucian carp as described above, the kit comprising the primer pairs described above.
[0010] A method for detecting molecular markers associated with testicular traits of allotetraploid crucian carp as described above, the method comprising: extracting genomic DNA from the allotetraploid crucian carp to be tested; using the genomic DNA as a template, performing PCR amplification on it using the primer pairs described above to obtain PCR products; sequencing the obtained PCR products; and determining the genotype based on the sequencing peak diagram.
[0011] Furthermore, the PCR amplification reaction system is as follows: 10 μL of Taq premix, 1 μL each of 10 μM forward and reverse primers, 1 μL of 115 ng / μL DNA template, and 7 μL of ddH2O, with a final volume of 20 μL.
[0012] Furthermore, the PCR amplification reaction conditions are as follows: pre-denaturation at 94℃ for 5 min, followed by 35 cycles, including: denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 2 min, and finally extension at 72℃ for 10 min.
[0013] Furthermore, if a single peak appears in the peak diagram, it indicates a homozygous genotype; if two peaks appear, it indicates a heterozygous genotype.
[0014] Furthermore, the homozygous genotype is TT, and the heterozygous genotype is TC.
[0015] Furthermore, the three gonadal development indicators of the allotetraploid crucian carp individuals with the TC genotype—gona weight, body weight, and gonadal index—were significantly higher than those with the TT genotype.
[0016] Application of a molecular marker primer pair or kit as described above in screening allotetraploid crucian carp with strong reproductive capacity.
[0017] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows: 1. This invention identifies the SNPs in the ZSWIM7 gene of allotetraploid crucian carp using PCR amplification and Sanger sequencing. Based on the association between different SNP types and testicular traits in allotetraploid crucian carp, efficient screening of gonadal development is conducted during breeding. This invention will provide important evidence for developing new SNP markers, promoting the continuation of germplasm resources for this fish species, and facilitating breeding efforts.
[0018] 2. This invention uses SNPs as molecular markers for screening gonadal development in allotetraploid crucian carp and common carp, offering advantages such as high genetic stability, simple operation, convenient detection, easy automation, and low detection cost. The primers designed in this invention possess high specificity and sensitivity, enabling rapid and accurate sample amplification.
[0019] 3. In the actual breeding of allotetraploid crucian carp, the method of this invention and the designed specific primers can be used to screen allotetraploid crucian carp with strong reproductive capacity. No live cells or dissection of live fish are required. Only a small amount of tail fin tissue of the fish is needed to carry out the experiment. The experimental operation is simple and causes minimal damage to the fish, does not affect its normal growth, can well protect the experimental materials, and improve the utilization rate of the experimental materials. Attached Figure Description
[0020] Figure 1 The image shows the chromatogram of the SNP sites in Example 1.
[0021] Figure 2 This is a graph showing the association between different SNP genotypes and gonadal development in Example 1.
[0022] Figure 3 This is a diagram of testicular morphology for different genotypes at SNP sites in Example 1.
[0023] Figure 4 This is a cell count diagram of sperm and spermatocytes in the testes of different genotype allotetraploid crucian carp in Example 1.
[0024] Figure 5 The graph shows the fertilization rate and hatching rate of artificial breeding of allotetraploid crucian carp with different genotypes in Example 1. Detailed Implementation
[0025] The present invention will be further described in detail below through embodiments. These embodiments are only used to illustrate the present invention and do not limit the scope of protection of the present invention.
[0026] Example 1: Screening of SNP molecular markers in the coding region of the ZSWIM7 gene of allotetraploid crucian carp and gonadal development (a) Obtaining template DNA Seventy allotetraploid crucian carp were randomly selected and anesthetized with MS-222. After partially removing the caudal fin, the abdominal cavity was opened using dissecting tools to fully expose the organs. Other internal organs were dissected with forceps, and the testis tissue was completely removed from the base. After washing with PBS, the tissue was stored in EP tubes. DNA was extracted from the caudal fins of the 70 fish using an animal genomic DNA rapid extraction kit. The quality of the genomic DNA samples was assessed by 1.2% agarose gel electrophoresis, and the concentration (ng / μL) and purity (A260 / A280) were determined using a microplate reader.
[0027] (II) PCR amplification and gel recovery PCR amplification of the coding region of the ZSWIM7 gene in the tested fish was performed using specific primers as shown in Table 1. The PCR amplification reaction system consisted of 10 μL Taq premix, 1 μL each of 10 μM forward and reverse primers, 1 μL 115 ng / μL DNA template, and 7 μL ddH2O, with a final reaction volume of 20 μL. The PCR amplification conditions were as follows: pre-denaturation at 94 °C for 5 min, followed by 35 cycles: denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, extension at 72 °C for 2 min, and a final extension at 72 °C for 10 min. The PCR amplification products were extracted using a DNA gel extraction kit to obtain the target band.
[0028]
[0029] Primer amplification sequences (5'-3') are shown in SEQ ID NO:1: ATGGGCTCATCTCTGCTTTCTGYTGCTGAGCAGCTCTTGAGAGACCTACAGAGAACGTACTCGGAGACAAAGCAGATACCAGATGACCTACTAATAGCATTGCGGTTTGTGTTCGGCCCATGTGCTCTTCAGGCATTGGACCTGGTGGACCAGCGCTCTGTCACATGTGTGTCCTCACCTAGCGGTCGAAATGCATTTCAGGTATTAGGAG GATCAGGGCGTCTGTACACATGCTTCACTTCCTGCCACTACTGTCCGTGCCCCGCATTCTCTTTCACTGTGCTCAGGAGGAACGAGAGTCTGATGTGTAAGCACCTCCTGGCCGCCTGCCTGAGTCAGGCCATGGGCTTGTGCCAGCAGGAACAGGTCTCAGATCAGCAGATGACCCACATTCTCTCAGGGCAAACTGAGGCCAGCACATAA Note: Nucleotide 23 is a SNP site. (iii) Sequencing (Sanger sequencing) Prepare a 1.2% (g / mL) agarose gel. Take 20 μL of PCR amplification product for electrophoresis at a constant current of 120 mA for 20 min. Observe the gel electrophoresis image of the obtained PCR amplification fragment under UV light. The target fragment (approximately 420 bp) is excised and recovered from the gel. Add 30 μL of deionized water to the center of the filter membrane of the preparation tube to dissolve the DNA. The product is sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The specific sequencing procedure is as follows: Single primer extension is performed using the BigDye Terminator v3.1 kit. The sequencing primers are ATGGGCTCATCTCTGCTTTCT (approximately 10 pmol / reaction). The product is precipitated with ethanol and then sequenced using an ABI 3730 / 3730xl capillary sequencer. The results are analyzed using Chromas and other software for peak quality control and base interpretation. Obtain the sequence and sequencing chromatogram, as shown below. Figure 1 As shown.
[0030] (iv) SNP analysis Based on the sequencing chromatogram, the SNP type at position 23 of the sequencing fragment was determined. In the chromatogram, a single peak indicates a homozygous genotype; a double peak indicates a heterozygous genotype. The association between different SNP genotypes and gonadal development was analyzed, such as... Figure 2 As shown. Figure 2 The symbols marked with "*" indicate that there are significant differences among different genotypes at that SNP locus. P <0.05). By Figure 2 It is evident that allotetraploid crucian carp individuals carrying the heterozygous TC genotype showed significantly higher scores than homozygous TT genotype individuals in three gonadal development indicators: gonadal weight, body weight, and gonadal index (GSI). P <0.05).
[0031] (V) Observation of testis morphology in allotetraploid crucian carp and common carp of different genotypes Morphological observations were conducted on the testes of allotetraploid crucian carp and common carp of different genotypes, such as... Figure 3 As shown. By Figure 3 It is evident that the testes of both genotypes are milky white in color, with intact tissue structure and a clear vascular network visible on the surface. The testes of the heterozygous TC genotype allotetraploid crucian carp are more morphologically complete than those of the homozygous TT genotype allotetraploid.
[0032] (vi) Observation of testis tissue sections from different genotypes of allotetraploid crucian carp and common carp Histological observation of testes from allotetraploid crucian carp and common carp of different genotypes, such as... Figure 4 As shown. Figure 4Figure A shows the HE staining of the testes of heterozygous TC allotetraploid crucian carp, and Figure B shows the HE staining of the testes of homozygous TT allotetraploid crucian carp. In Figures A and B, red arrows represent spermatogonia, blue and yellow arrows represent spermatocytes, and green arrows represent sperm. Figure C shows the sperm count in the testes of different genotypes of allotetraploid crucian carp, and Figure D shows the spermatocyte count in the testes of different genotypes of allotetraploid crucian carp. The symbol "***" indicates... P <0.001, indicating a significant difference.
[0033] Depend on Figure 4 As shown in Figures A and B, after HE staining, the germ cells of alloteric tetraploid crucian carp testes of different genotypes exhibit significant morphological differences at various developmental stages. Spermatogonia (marked with red arrows) are mostly isolated, significantly larger than other germ cells, with a high nucleoplasm-to-nucleolus ratio and a light blue-purple nucleolar region. Mature spermatids (marked with green arrows), as terminally differentiated cells, are the smallest in size and have the darkest nuclear staining. The specific number of spermatids and spermatocytes in each field of view was counted, as shown in Figures A and B. Figure 4 Figures C and D are shown. The results indicate that the number of sperm cells in the TC type allotetraploid crucian carp was significantly higher than that in the TT type. P <0.001), the number of spermatocytes in the TT type was significantly higher than the number of spermatocytes in the TC type ( P <0.001).
[0034] (vii) Using the method of the present invention, allotetraploid crucian carp tissue is used to screen for fish species with strong reproductive capacity. Fifty male allotetraploid crucian carp individuals were selected, and partial caudal fins were harvested. DNA was extracted and sequenced to obtain the ZSWIM7 genotype. Ten male allotetraploid crucian carp individuals of the identified ZSWIM7 genotype TC and TT were selected and artificially inseminated with 40 female individuals (female-to-male ratio 2:1) during the breeding season. After fertilization, the fertilized eggs were placed in culture dishes, and the fertilization rate was calculated under a stereomicroscope during mid-gastrulium. The formula for calculating the fertilization rate is: Fertilization rate = (Number of viable eggs in mid-gastrulium / Total number of eggs laid) × 100%. The hatching rate was calculated upon hatching. The formula for calculating the hatching rate is: Hatching rate = (Number of hatched fry / Number of fertilized eggs) × 100%. By comparing the fertilization and hatching rates of artificial reproduction using male sperm from allotetraploid crucian carp with different genotypes (TT / TC) and randomly selected female allotetraploid crucian carp eggs, male individuals with higher fertility were ultimately obtained. The results showed that the fertilization rates of the TC group and TT group were 91.22±3.38% and 82.67±6.84%, respectively; the hatching rates of the TC group and TT group were 87.00±5.79% and 77.89±5.79%, respectively. Both the fertilization and hatching rates of the TC group were significantly higher than those of the TT group. P <0.05)( Figure 5 ).
[0035] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A SNP molecular marker associated with the testis traits of the heterologous tetraploid crucian carp, characterized in that, The molecular marker is located in the ZSWIM7 gene. The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1, and the 23rd nucleotide of the sequence is a T / C SNP site. The genotype of this site is associated with the testis development trait of allotetraploid crucian carp.
2. A method for detecting the genotype of the SNP site of the heterologous tetraploid crucian carp ZSWIM7 gene, characterized in that, The SNP site is located at position 23 of the sequence shown in SEQ ID NO:
1. The method includes: extracting genomic DNA from the allotetraploid crucian carp to be tested, using the genomic DNA as a template, performing PCR amplification on it using primer pairs, sequencing the obtained PCR product, and determining the genotype of the nucleotide at position 23 based on the sequencing peak diagram. The sequences of the primer pairs are as follows: L1-F: 5'-ATGGGCTCATCTCTGCTTTCT-3'; L1-R: 5'-CTGAGAGAATGTGGGTCATCTGC-3'.
3. The method for detecting the SNP locus genotype of the ZSWIM7 gene in allotetraploid crucian carp according to claim 2, characterized in that, The PCR amplification reaction system consisted of 10 μL of Taq premix, 1 μL each of 10 μM forward and reverse primers, 1 μL of 115 ng / μL DNA template, and 7 μL of ddH2O, for a final volume of 20 μL.
4. The method for detecting the SNP locus genotype of the ZSWIM7 gene in allotetraploid crucian carp according to claim 2, characterized in that, The PCR amplification reaction conditions were as follows: pre-denaturation at 94℃ for 5 min, followed by 35 cycles, including: denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 2 min, and finally extension at 72℃ for 10 min.
5. The method for detecting the SNP locus genotype of the ZSWIM7 gene in allotetraploid crucian carp according to claim 2, characterized in that, If a single peak appears in the peak diagram, it indicates a homozygous genotype; if two peaks appear, it indicates a heterozygous genotype.
6. The method for detecting the SNP locus genotype of the ZSWIM7 gene in allotetraploid crucian carp according to claim 5, characterized in that, The homozygous genotype is TT, and the heterozygous genotype is TC.
7. The method for detecting the SNP locus genotype of the ZSWIM7 gene in allotetraploid crucian carp according to claim 6, characterized in that, The three gonadal development indicators of allotetraploid crucian carp individuals with genotype TC—gona weight, body weight, and gonadal index—were all higher than those of individuals with genotype TT.