Prom1 gene knockout-based human recessive retinal degenerative disease organoid model

CN121046351BActive Publication Date: 2026-09-25SHANGHAI LANGSHENG BIOTECHNOLOGY CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410700896.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-31
Publication Date
2026-09-25
Estimated Expiration
2044-05-31

AI Technical Summary

Technical Problem

[0005]尽管已在Prom1基因敲除小鼠中证明了PROM1在光感受器外节(OS)形态发生中的结构作用,但啮齿类动物的视网膜在解剖结构和分子表达上存在差异,导致基因缺陷在小鼠模型上的致病性与临床患者不一致

Benefits of technology

[0075]本发明的主要优点包括:

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004870993660000011
    Figure HDA0004870993660000011
  • Figure HDA0004870993660000021
    Figure HDA0004870993660000021
  • Figure HDA0004870993660000022
    Figure HDA0004870993660000022
Patent Text Reader

Abstract

The application provides a human recessive retinal degenerative disease organoid model based on Prom1 gene knockout. Specifically, the application provides specific gRNAs targeting exon 9 of the Prom1 gene, which can perform high-efficiency knockout of the Prom1 gene on human embryonic stem cells. The application also provides a Prom1 gene knockout stem cell line derived from human embryonic pluripotent stem cells H9 and a retinal organoid disease model. The retinal organoid of the application can provide a research model for clinical treatment drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology. Specifically, this invention relates to human-based... Prom1 Establishment of organoid models for gene knockout-induced latent retinal degenerative diseases. Background Technology

[0002] Degenerative retinal diseases, such as retinitis pigmentosa (RP), macular dystrophy (MD), and rod-cone dystrophy, are associated with progressive photoreceptor death and are usually caused by genetic mutations that lead to retinal degeneration after full development.

[0003] Prominin-1 Gene (Prom1) ) is one of the pathogenic genes for RP and MD, and its gene mutation has been considered to be the main genetic factor causing RP and MD. Prom1 The gene-encoded membrane protrusion protein is a five-transmembrane glycoprotein, also known as CD133 or AC133, which is mainly associated with the morphogenesis of the photoreceptor optic disc.

[0004] The prior art discloses the use of oligonucleotide Morpholinos to... Prom1 The protocol involves conditional knockdown of exon 4 of a gene, but the research focuses on... Prom1 The RNA undergoes alternative splicing rather than whole-gene expression; theoretically, knocking down other RNAs could lead to... Prom1 The expression of isoform is unaffected. In fact, it is known that... Prom1 Transcripts with a 27bp deletion of the natural exon 4 can still maintain normal function (Y Yu et al. J Biol Chem (2002)), therefore this technique is difficult to study. Prom1 The full-length gene's function in retinal development is investigated. Morpholino oligonucleotide knockdown technology is typically applied to the embryonic stem cell stage of zebrafish, knocking down the entire zebrafish early in development. However, its efficiency in knocking down only specific cells within retinal organoids may be less than ideal. Furthermore, PROM1 is expressed throughout all stages of retinal development (from the early progenitor cell stage to the formation of mature retinal structures), suggesting its important role at each stage. Current techniques utilize Morpholinos for a one-month knockdown period during the relatively mature stage of retinal organoids, which cannot comprehensively assess the role of PROM1. Prom1Its role in retinal development. More importantly, while oligonucleotides like Morpholinos affect RNA splicing, they also have the potential to introduce unknown exons. This can sometimes increase the difficulty of analyzing the mechanisms of pathogenic genes.

[0005] Although already Prom1 The structural role of PROM1 in the morphogenesis of the outer segment (OS) of photoreceptors has been demonstrated in gene knockout mice. However, differences in anatomical structure and molecular expression in the rodent retina lead to inconsistencies in the pathogenicity of the gene defect in mouse models compared to clinical patients. This has not yet been confirmed in human models. Prom1 The mechanisms of gene knockout effects. Furthermore, drugs designed for human patients may elicit different responses in mouse models, often leading to drugs evaluated as effective in mouse models failing to achieve the expected results in clinical trials. Retinal organoids derived from human stem cells in vitro not only carry human genetic information, but these organoids also mimic the formation of the human retina by forming organized, layered retinal structures that display markers of typical retinal cell types. Therefore, retinal organoids mimicking patient gene defects can reproduce the patient's disease phenotype in the laboratory.

[0006] In addition, compared to the long cycle and high cost of animal experiments, human stem cells cultured in vitro can be expanded in large quantities in vitro, and stem cell-derived organoids have the potential for mass production. The experimental cycle is relatively short, and the cost of organoid culture is constantly decreasing as the supply chain matures. Therefore, it can be more flexibly applied to many scenarios in pharmaceutical research and development (including molecular mechanism research, disease phenotype confirmation, drug screening and in vitro pharmacodynamics and toxicology).

[0007] Therefore, there is a need in this field to develop a Prom1 Human retinal organoid model with gene knockout. Summary of the Invention

[0008] The purpose of this invention is to provide a Prom1 Human retinal organoid model with gene knockout.

[0009] In a first aspect of the invention, a reagent is provided, comprising: (a) A gene-editing protein or its expression vector, wherein the gene-editing protein is a Cas protein; and (b) gRNA or its expression vector, wherein the gRNA guides the specific binding of the gene-editing protein. Prom1 The gene sequence of exon 9 of the gene.

[0010] In another preferred embodiment, the target sequence for gRNA binding is located at... Prom1The gene segment selected from exon 9 is from the following groups: position 10-40, position 40-70, position 185-215, or a combination thereof.

[0011] In another preferred embodiment, the described Prom1 The wild-type sequence of exon 9 is shown in SEQ ID NO: 4.

[0012] In another preferred embodiment, the gRNA-guided gene editing protein excision Prom1 The gene fragment of exon 9 of the transcript.

[0013] In another preferred embodiment, the resection is performed in Prom1 A frameshift mutation induced in exon 9 of the transcript produces the stop codon TGA.

[0014] In another preferred embodiment, the gRNA binds to a target sequence selected from the group consisting of: (i) A polynucleotide having any one or more of the nucleotide sequences shown in SEQ ID NO: 5-7; (ii) Polynucleotides with ≥95%, preferably ≥98%, and more preferably ≥99% homology to any one or more of SEQ ID NO: 5-7; (iii) Polynucleotides complementary to (i) or (ii) above.

[0015] In another preferred embodiment, the coding sequence of the gRNA is selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or a combination thereof.

[0016] In another preferred embodiment, the gRNA includes unmodified and modified gRNA.

[0017] In another preferred embodiment, the modified gRNA includes chemical modifications of the bases.

[0018] In another preferred embodiment, the chemical modification includes methylation, methoxylation, fluorination, or thiolation.

[0019] In another preferred embodiment, the Cas protein is selected from the group consisting of Cas9, Cas12a, Cas12f (Cas14), Cas13, or combinations thereof.

[0020] In another preferred embodiment, the Cas protein is the Cas9 protein.

[0021] In a second aspect of the invention, an isolated cell is provided, wherein the cell... Prom1The gene segment in exon 9 of the gene transcript is mutated, and the expression of the PROM1 protein in the cell is reduced or inactivated.

[0022] In another preferred embodiment, the cells are treated with reagents as described in the first aspect of the invention.

[0023] In another preferred embodiment, the excision induces a frameshift mutation in the exon 9 region to produce the stop codon TGA.

[0024] In another preferred embodiment, the reduction or inactivation of PROM1 protein expression means that the ratio (E1 / E0) of the PROM1 protein expression level or activity (E1) of the treated cells to the PROM1 protein expression level or activity (E0) of the untreated homologous cells is ≤70%, preferably ≤40%, and more preferably ≤20%.

[0025] In another preferred embodiment, the cells are derived from human or non-human mammals.

[0026] In another preferred embodiment, the cells are selected from the group consisting of somatic cells and stem cells.

[0027] In another preferred embodiment, the cells are retinal stem cells, tumor cells, or hematopoietic stem cells.

[0028] In another preferred embodiment, the cell is a human stem cell H9.

[0029] In a third aspect of the invention, an organoid model is provided, characterized in that the organoid is derived from cell culture as described in the second aspect of the invention.

[0030] In another preferred embodiment, the organoids are selected from the group consisting of retinal organoids or tumor organoids.

[0031] In another preferred embodiment, the retinal organoid model has one or more characteristics selected from the group consisting of: a) Decreased expression of the photoreceptor cell-specific protein rhodopsin (Rho); b) Decreased density of photoreceptor outer segments (OS); c) Shortened length of photoreceptor outer segment (OS).

[0032] In another preferred embodiment, the retinal organoid model exhibits a latent retinal degenerative disease phenotype.

[0033] In another preferred embodiment, the latent retinal degenerative disease is selected from the group consisting of retinitis pigmentosa, macular degeneration, cone-and-bar dystrophy, or a combination thereof.

[0034] In a fourth aspect of the invention, a method for culturing an organoid model as described in the third aspect of the invention is provided, characterized by comprising the steps of: Isolated cells as described in the second aspect of the invention are provided and cultured under conditions suitable for organoid differentiation to obtain an organoid model as described in the third aspect of the invention.

[0035] In a fifth aspect of the invention, a method is provided for screening or identifying therapeutic agents for treating or alleviating latent retinal degenerative diseases, comprising the steps of: (a) In the test group, the test drug was administered to a model of latent retinal degeneration, and the severity of latent retinal degeneration in the model in the test group was measured Q1; in the control group, the control compound (including the solvent) was administered to a model of latent retinal degeneration, and the severity of latent retinal degeneration in the model in the control group was measured Q2. (b) Compare the severity Q1 and severity Q2 detected in the previous step to determine whether the test compound is a potential therapeutic agent for treating or alleviating latent retinal degenerative diseases; If severity Q1 is significantly lower than severity Q2, it indicates that the test drug is a potential therapeutic agent for treating or alleviating latent retinal degenerative diseases. The model for latent retinal degenerative disease is the organoid model described above.

[0036] In another preferred embodiment, the drug is selected from the group consisting of small molecule compounds, macromolecules, peptides, cell preparations, gene therapy preparations, or combinations thereof.

[0037] In another preferred embodiment, the latent retinal degenerative disease is selected from the group consisting of retinitis pigmentosa, macular degeneration, cone-and-bar dystrophy, or a combination thereof.

[0038] In another preferred embodiment, the detection of the severity of latent retinal degenerative disease includes detecting the expression levels of proteins selected from the group consisting of: retinal photoreceptor-specific protein Rhodopsin (Rho), retinal photoreceptor opsin Opsin, retinal photoreceptor outer segment assembly protein PCDH21, or combinations thereof.

[0039] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0040] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0041] The following figures are used to illustrate specific embodiments of the present invention and are not intended to limit the scope of the invention as defined by the claims.

[0042] Figure 1 Cells transfected with Cas9 / sgRNA1, sgRNA2, and sgRNA3 are shown. Prom1 Knockout efficiency. (A) Agarose gel electrophoresis results of HEK-293T cell DNA. (B) Gene knockout efficiency of sgRNA1, sgRNA2, and sgRNA3 in HEK-293T cells. (C) Agarose gel electrophoresis results of H9 cell DNA. (D) Gene knockout efficiency of sgRNA1 and sgRNA3 in H9 cells.

[0043] Figure 2 Three types of cells obtained by knocking out H9 cells using sgRNA3 were shown. Prom1 Genome knockout types of single-cell clones with homozygous gene knockout.

[0044] Figure 3 The results of PROM1 protein level detection in H9 monoclonal cells after knockout are shown.

[0045] Figure 4 Showing Prom1 Morphological and protein knockout detection of gene knockout retinal organoids. (A) Prom1 Gene knockout did not affect retinal development. (B) Prom1 PROM1 expression was not observed in gene knockout organoids.

[0046] Figure 5 Showing Prom1 Phenotypic analysis of gene knockout retinal organoids. (A) Prom1 Gene knockout organoids show a reduction in the outer segments of photoreceptor cells; (B) Prom1 The gene knockout of organoid photoreceptor-specific protein Rhodopsin is reduced.

[0047] Figure 6 A schematic diagram of the structure of the PROM1 protein is shown.

[0048] Figure 7 The changes in the expression of Rhodopsin (Rho), a retinal photoreceptor-specific protein, before and after gene therapy were shown.

[0049] Figure 8 shows the changes in the expression distribution of Opsin, a visual protein in the retinal photoreceptor layer, before and after gene therapy.

[0050] Figure 9 The changes in expression of PCDH21, an assembly protein of the outer segment of the retinal photoreceptor layer, before and after gene therapy were shown. Detailed Implementation

[0051] Through extensive and in-depth research, the inventors have developed for the first time a method based on Prom1 A gene knockout human organoid model for latent retinal degenerative diseases. Specifically, this invention utilizes CRISPR-Cas9 technology to design targeted... Prom1 Specific gRNA from exon 9 of the gene, targeting human H9 embryonic stem cells Prom1 Gene knockout, screening Prom1 Stem cell lines with completely knocked-out genes redifferentiated into mature retinal organoids. The gRNA gene knockout designed in this invention has high efficiency, with PROM1 completely knocked out at the protein level. Furthermore, this invention is the first to utilize 3D organoid culture technology to... Prom1 A disease model of retinal organoids differentiated from gene knockout stem cells was obtained, in which all cells within the organoids failed to express their function throughout retinal development. Prom1 The genes exhibit a trend consistent with currently known mouse models or reported disease phenotypes. This invention further... Prom1 In gene knockout retinal organoid disease models, supplementing the PROM1 protein with a therapeutic agent significantly improved the damage severity of existing retinal disease models, consistent with the phenotype of normal retinal organoid models. In summary, this invention completes a [further details needed for a complete translation]. Prom1 Analysis, validation, and successful establishment of the phenotype of a gene knockout human retinal organoid disease model.

[0052] The humanized retinal model of this invention provides an excellent research model for clinical therapeutic drugs and holds promise as a valuable alternative to current animal models. This invention also provides a method for constructing a human embryonic pluripotent stem cell model in H9 based on CRISPR / Cas9 gene knockout technology. Prom1 Gene knockout stem cell lines can be established to provide applications for the subsequent differentiation of other organoids.

[0053] the term To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing the invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can vary. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be restrictive; the scope of the invention will be limited only by the appended claims.

[0054] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0055] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.

[0056] Degenerative retinal disease Hereditary retinal diseases (IRDs) are a group of blinding eye diseases caused by mutations in pathogenic genes. Currently, more than 200 pathogenic mutations have been identified as being associated with dozens of IRDs, including congenital amaurosis and retinitis pigmentosa. Prom1 Gene mutations can lead to retinal degenerative diseases such as retinitis pigmentosa, macular degeneration, and cone-and-bar dystrophy. Prom1 The pathogenic mutations are mainly inherited recessively, and compared to dominant inheritance, Prom1 Recessive inheritance leads to more serious consequences. Patients develop the disease in their youth and quickly become blind, severely affecting their quality of life. Recessive mutations are mostly caused by decreased or absent gene expression and loss of function (JAMA Network Open. 2019;2(6):e195752).

[0057] This invention establishes a human retina for the first time. Prom1 Gene knockout model, achieved Prom1 The functional defect of the gene mimics the disease group type caused by recessive mutations. This invention establishes a human retina... Prom1 Gene knockout models can provide a deeper understanding Prom1 The pathogenic mechanism of mutations provides a research basis and an ideal testing model for preclinical gene complementation therapy.

[0058] Prom1 Prom1 The genome sequence of the gene is available at NCBI Reference Sequence: NG_011696.2; the amino acid sequence is available at https: / / www.uniprot.org / uniprotkb / O43490 / entry. Prom1 It contains 28 exons, with effective encoding from Exon2 to Exon27, and a total length of 865aa. The corresponding structure of PROM1 is as follows: Figure 6As shown, PROM1 has five transmembrane domains, each containing 21 amino acids, and also includes two extracellular loop structures (ECL1: Exon 6-12; ECL2: Exon 15-24). The extracellular loops (ECLs) have many glycosylation sites, which are closely related to the transmembrane activity of the protein.

[0059] Clinically, Prom1 The pathogenic mutations are diverse and scattered, making it difficult to identify clinically prevalent hotspot mutations for laboratory testing. Prom1 Reference for the knockout site. Therefore, the inventors use... Prom1 Starting with the structure and function of genes. Prom1 Pathogenic mutations in the extracellular circular structure of genes are relatively concentrated, presumably because... Prom1 The main functional structure of genes.

[0060] This invention selects exon 9 as the target region for sgRNAs. Prom1 The amino acid sequence corresponding to exon 9 is located in the first extracellular loop (ECL1), which is one of the regions with a high incidence of mutation sites in clinical patients. The wild-type exon 9 sequence is shown in SEQ ID NO: 4.

[0061] Gene inactivation Many methods can be used to study genes with unknown functions. For example, the gene to be studied can be inactivated, and the phenotypic changes resulting from the genetic modifications can be analyzed to obtain functional information about the gene. Another advantage of this research method is that it can link gene function with disease, thus obtaining information about the disease that the gene could treat as a potential drug or drug target, as well as animal models of the disease, while simultaneously obtaining information about the gene's function. Gene inactivation can be achieved through gene knockout, gene interruption, or gene insertion. Among these, gene knockout technology is a very powerful tool for studying the function of human genes in the whole organism.

[0062] As used in this article, the terms “gene inactivation,” “gene knockout,” and “gene defect” are used interchangeably, referring to the process of interrupting or knocking out a target gene through genetic operations, thereby causing a significant decrease or even complete loss of the expression and / or activity of that target gene.

[0063] Gene editor In this invention, the gene editor includes a DNA gene editor and an RNA gene editor. In a preferred embodiment, the gene editor of this invention includes a gene-editing protein and gRNA (or sgRNA).

[0064] Gene editing protein In this invention, the nucleotides of the gene-editing protein can be obtained through genetic engineering techniques, such as genome sequencing and polymerase chain reaction (PCR), and its amino acid sequence can be deduced from the nucleotide sequence. In a preferred embodiment of this invention, the gene-editing protein includes, but is not limited to, Cas13 (such as CasRx), Cpf1, SaCas9, Cas13a, Cas13b, and Cas13c.

[0065] CRISPR / Cas system The CRISPR / Cas system (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-Associated Protein) is an acquired immune defense mechanism in prokaryotes against the invasion of foreign genes. It evolved from bacteria and archaea in their struggle against viral and bacteriophage invasions. This system integrates exogenous DNA fragments into CRISPR sites, whereby corresponding CRISPR RNAs (crRNAs) guide Cas endonucleases to cleave the exogenous DNA sequence, thus resisting viral or bacteriophage invasion. The CRISPR / Cas gene cluster consists of genes encoding a series of Cas proteins (Cas1, Cas2, Cas4, and effector proteins such as Cas9 and Cpf1) and a CRISPR sequence. A CRISPR sequence consists of a leader sequence, numerous short, conserved repeat regions, and a spacer. The repeat regions contain palindromic sequences that can form hairpin structures. The spacer is the foreign DNA sequence captured by the host. These captured foreign DNA sequences are like a "blacklist" of the immune system. When this foreign genetic material invades the host again, bacteria begin to transcribe CRISPR, forming the primary transcript pre-crRNA. This pre-crRNA is then cleaved at the repeat sites by ribonucleases or Cas proteins to form mature crRNA. This crRNA then forms a ribonucleoprotein complex with specific CRISPR effector proteins, which recognize and cleave foreign DNA that is complementary to the crRNA, causing double-strand breaks and triggering the host cell's self-repair.

[0066] Based on the composition of the Cas gene and the number of effector proteins, CRISPR is divided into 2 classes and 5 types, totaling 16 subtypes. Class 1 consists of CRISPR / Cas systems that use multiple effector protein complexes to interfere with the target gene, including types I, III, and IV; Class 2 consists of CRISPR / Cas systems that use a single effector protein to interfere with the target gene, including types II and V. Currently, the most widely studied and utilized system is type II, namely the CRISPR / Cas9 system. This system successfully achieved gene editing in mammalian cells in 2013. The type II system can use a single Cas9 nuclease to precisely and fully cleave the DNA target site under the guidance of crRNA. This system is simple to operate, has a short experimental cycle, is highly efficient, and is widely applicable to multiple species. This system requires the design of a special guide RNA, namely sgRNA (single guide RNA), which is a nucleotide sequence of about 20 nt in the PAM (NGG) region of the genome sequence. Guided by sgRNA, the Cas9 protein can perform site-specific cleavage of the genome, causing DNA double-strand breaks and activating two repair mechanisms in the cell: non-homologous end joining (NHEJ) or homologous recombination (HR). This allows for gene knockout, random fragment deletion or insertion, or repair using a specific template, thereby achieving permanent modification of the genome.

[0067] In one embodiment of the present invention, a gene knockout technology based on CRISPR / Cas9 gene knockout is constructed. Prom1 Gene knockout sgRNA. The sgRNA used in this invention may be selected from sgRNA1, sgRNA2 and sgRNA3, wherein the nucleic acid sequence of the target site of sgRNA1 is shown in SEQ ID NO:5, the nucleic acid sequence of the target site of sgRNA2 is shown in SEQ ID NO:6 and the nucleic acid sequence of the target site of sgRNA3 is shown in SEQ ID NO:7.

[0068] Gene knockout cells and organoids As used in this invention, the term " Prom1 "Knockout cells" refers to the cells provided in the second aspect of this invention that have undergone gene editing to reduce or inactivate the expression of PROM1 protein.

[0069] Prom1 In knockout cells, located Prom1 The Exon9 gene in the first extracellular loop is knocked out, resulting in a frameshift mutation that forms a premature termination codon. This leads to the destruction of the structure of both extracellular loops of PROM1, causing PROM1 to lose its function.

[0070] In one embodiment, the present invention Prom1 Knockout cells can be derived from human cells or non-human cells, with human cells being preferred.

[0071] The present invention Prom1 Knockout cells can be derived from progenitor cells (such as stem cells) of any tissue. Progenitor cells are preferably selected from the group consisting of: totipotent stem cells, pluripotent stem cells, multipotent stem cells, mesenchymal stem cells, neural stem cells, hematopoietic stem cells, pancreatic stem cells, cardiac stem cells, neural stem cells (especially optic nerve stem cells), kidney stem cells, liver stem cells, lung stem cells, angiogenic cells, and endothelial progenitor cells. The pluripotent cells or progenitor cells used in this invention can be derived from dedifferentiated neural cells, chondrogenic cells, myogenic cells, osteoblasts, tendinogenic cells, ligament-forming cells, adipocytes, or dermal cells. In one embodiment, the present invention… Prom1 The knockout cells were derived from human H9 embryonic stem cells.

[0072] This invention provides the invention Prom1 Organoid models obtained by knockout cell culture. The organoid models of this invention can be retinal organoid models, suitable for research... Prom1 The role of genes in retinal development.

[0073] Besides retinal organoid models, due to Prom1 High expression in important tissues and cells such as tumors and hematopoietic stem cells. Prom1 Knockout tumor organoids can serve as a wide range of laboratory models for research. Prom1 Functions in tumors and the hematopoietic system. Therefore, the human-derived [material] provided by this invention... Prom1 Gene knockout stem cells can also provide early applications for differentiating other organoids.

[0074] The organoids of this invention can be obtained by culturing pluripotent stem cells, progenitor cells, or single cells. In a preferred embodiment, the 3D tissue-cultured organoids or cells have the same genetic lineage, for example, derived from the same single cell. In principle, cells can also be totipotent if ethically permissible. “Totipotent” cells can differentiate into any cell type in vivo, including germline cells stimulated as typically occurs during development. Therefore, a totipotent cell can be defined as a cell capable of growing (i.e., developing) into an entire organism.

[0075] The main advantages of this invention include: 1) This invention selects exon 9 of the PROM1 protein as the knockout target, and induces a frameshift mutation in exon 9 to form a premature termination codon, thereby causing premature termination of PROM1 protein translation and resulting in loss of PROM1 function.

[0076] 2) This invention knocks out Cas9 protein and RNA at the stem cell genome level using Cas9 protein and RNA co-transfection technology. Prom1 The gene, specifically the sgRNA provided in this invention, has high knockout efficiency and can achieve complete knockout, thereby ensuring that all cells of the organoid are missing throughout the entire developmental process. Prom1 The expression of PROM1 allows for a more comprehensive assessment of its role in retinal development.

[0077] 3) This study is the first to establish Prom1 A gene knockout human retinal model. Knockout in the organoid model of this invention. Prom1 The resulting phenotype of loss of function caused by genes is strongly associated with clinical patients.

[0078] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0079] Experimental materials (1) The Cas9 high-fidelity protein (A50576) used for electroporation was purchased from ThermoFisher and targeted... Prom1 The gene's sgRNA mRNA was synthesized by GenScript. It is used for targeted therapy. Prom1 The sgRNA DNA sequence of the gene was synthesized by Shanghai Platinum Biotech and is used to express Cas9 and target [the target gene]. Prom1 The expression vector for the gene's sgRNA was constructed by Shanghai Langsheng Biotechnology Co., Ltd.

[0080] (2) The KOD-PLUS high-fidelity PCR enzyme (KOD201), KOD-PLUS enzyme 10X buffer, 2mM dNTPs, and 25mM MgSO4 required for genome knockout detection were purchased from TOYOBO. The DNA electrophoresis marker and 10x loading buffer were purchased from Takara. The blood / cell / tissue genomic DNA extraction kit (DP304-02) was purchased from Tiangen. The T7E1 restriction endonuclease and buffer were purchased from NEB.

[0081] (3) RIPA lysis buffer (P0013B) for protein detection was purchased from Beyotime, protease inhibitor mixture 100X (P1005) was purchased from Beyotime, 10-well gel pre-prepared for electrophoresis (SB-TG1001015) and protein electrophoresis buffer were purchased from Shanghai Shenger Biotechnology, and protein loading standard marker (26616) was purchased from Thermo Fisher Scientific Shanghai Biotechnology Co., Ltd. The PROM1 protein immunoblotting antibody CD133 monoclonal antibody was purchased from Proteintech.

[0082] (4) Gentle Cell Dissociation Reagent (100-0485) used in human organoid differentiation was purchased from STEMCELL, Matrigel (354277) was purchased from CORNING, BMP4 (314-BPE-050) was purchased from R&D Systems, N2 supplement (17502-048) was purchased from Gibco, DMEM / F12 with GlutaMax (10565018) was purchased from Gibco, MEMNEAA (11140-050) was purchased from Gibco, B27 Supplement (12587-010) was purchased from Gibco, and FBS (F8687) was purchased from Sigma.

[0083] (5) The nuclear dye 4',6-diamidinyl-2-phenylindole (DAPI, 40728ES03) for immunofluorescence staining was purchased from Yisheng Biotechnology; the antifluorescence quencher (0100-01) was purchased from Parker Biotechnology; 0.1% Triton X-100 nonionic surfactant (T878) was purchased from SIGMA; 1X phosphate-buffered saline PBS (B320KJ) was purchased from Shanghai Yuanpei Biotechnology; the immunohistochemistry pen (BC004) was purchased from Baisha Biotechnology; and the PROM1 immunofluorescence detection antibody was purchased from Abcam. Bovine serum albumin (BSA) (9048-46-8) was purchased from Beyotime; the rhodopsin immunofluorescence antibody was purchased from Abcam; the Opsin immunofluorescence antibody was purchased from Merck; and the PCDH21 immunofluorescence antibody was purchased from Thermofisher.

[0084] Experimental methods 1. In vitro screening of sgRNAs Existing technologies have been reported Prom1 Gene mutation sites are mostly clustered in the two extracellular segments (ECLs) of the transmembrane domain, so this study selected this region.

[0085] Based on the PROM1 domain, one of the extracellular loops with concentrated mutation sites was selected. Taking the extracellular loop containing Exon9 as an example, three candidate sgRNAs were designed according to the sgRNA design principle (20bp-5'NGG), including: sgRNA1: Gcatgttctccaacgcctctt (SEQ ID NO: 1), sgRNA2: Gttgttggtgcaagctcttca (SEQ ID NO: 2), sgRNA3: Gttcagggttgctattcagc (SEQ ID NO: 3).

[0086] The wild-type Exon9 sequence is shown below, where the underlined segments represent the three target regions of the sgRNA.

[0087] cgatcaaggagacca aagaggcgttggagaacatg aacagcacct tgaagagcttgcaccaacaa agtacacagcttagcagcagtctgaccagcgtgaaaactagcctgcggtcatctctcaatgaccctctgtgcttggtgcatccatcaagtgaaacctgcaacagcatcagattgtctctaagcca gctgaatagcaaccctgaac tgaggcag (SEQ ID NO: 4).

[0088] sgRNA1 targeting fragment: aagaggcgttggagaacatg (SEQ ID NO: 5); sgRNA2 targeting fragment: tgaagagcttgcaccaacaa (SEQ ID NO: 6); sgRNA3 targeting fragment: gctgaatagcaaccctgaac (SEQ ID NO: 7).

[0089] The three sgRNAs were cloned into an expression vector, and then co-transfected with the Cas9 expression plasmid into the human embryonic kidney-derived cell line HEK293T cells. Untransfected HEK293T cells were designated as mock cells. Cells were harvested 72 hours after transfection, and the genome was extracted to assess the sgRNA editing efficiency.

[0090] 2. Detection of sgRNA editing efficiency at the genomic level Three days after electroporation, a portion of cells can be harvested for genome editing efficiency testing. Genomic DNA was extracted from cells using a blood / cell / tissue genomic DNA extraction kit. After determining the extraction concentration, PCR was performed. The upstream primer sequence for PCR was TAGTTGGAGCAGCTGTTAGAGCA (SEQ ID NO: 8), and the downstream primer sequence was ATGGTGATCAAATGACTCAAGAAG (SEQ ID NO: 9). The amplified band size was 562 bp.

[0091] After confirming the correct amplified band size by DNA agarose gel electrophoresis, 5 μL of PCR product was selected. Then, 9 μL of PCR product was added, along with 1 μL of 10×T7E1 NEB Buffer. The mixture was then re-annealed at 95°C for 5 min, with a cycle time of 95-85°C -2°C / sec and 85-25°C -0.1°C / sec. 0.25 μL of T7E1 enzyme was added to the annealed product, and the mixture was incubated at 37°C for 30 min. The final product was then analyzed by DNA agarose gel electrophoresis to calculate the gene editing efficiency.

[0092] 3. Electroporation of Cas9 protein and sgRNA 1 / 3 Based on a cell number of 1 x 10 6 H9 cells were prepared into a suspension, and then 5 μg of Cas9 protein and 100 pmol of sgRNA1 / sgRNA3 were electroporated (520 V, Celestix #EX+) into the cell suspension and placed in a cell culture incubator at 37 °C, during which the cell status was continuously observed.

[0093] After 5 days of culture, genomes were extracted from unelectroplated Mock-H9 cells, as well as from electroporated Cas9 / sgRNA1-H9 and sgRNA3-H9 cells for genome-level editing detection, using the methods described above.

[0094] 4. Single-cell clonal culture The electroporated cells were dissociated into single-cell suspensions and flow-sorted into 96-well plates, one cell per well. Once the single cells had grown into cell clones, each clone was passaged, and a subset of cells was taken for genotyping.

[0095] 5. Protein level detection after PROM1 protein knockout Hybrid and knockout genotype-neutral monoclonal cells were expanded and a portion of the cells were used for Western blotting (WB) verification. RIPA lysis buffer containing a 1X protease inhibitor was added to wild-type H9 cells (WT-H9) and... Prom1In homozygous knockout H9 cells (KO-H9), 30 μL was added to each well, lysed on ice for 30 min, and centrifuged at 4 °C (13000 rpm for 10 min). The supernatant was collected after centrifugation for PROM1 protein expression detection.

[0096] 6. Differentiation of human retinal organoids wild-type H9 cells and Prom1 Homozygous knockout H9 cells (KO-H9) were used for retinal organoid differentiation. The differentiation steps are as follows: 6.1. (D0) Human embryonic stem cell line H9 cells were added to Gentle Cell Dissociation Reagent, digested at 37°C for 6-8 min, and embryoid bodies (EB) were established in ultra-low adsorption 6-well plates.

[0097] 6.2. (D1-D5) Change the medium every 2 days, 5 ml of NIM medium (DMEM / F12 + 1xN2+MEM-NEAA+Heparin) per well.

[0098] 6.3. (D7~) Transfer EBs from the low-adsorption plate to the Matrigel Coat 6-well plate using a Pasteur pipette. Perform NIM half-change on D9, D12, and D15 respectively. From D16 to D25, change the medium every 2 days with 3:1 Medium (DMEM / F12 + 1x B27 + MEM-NEAA).

[0099] 6.4. Organoid isolation. Discard the old culture medium, add 3D-RDM (DMEM / F12 + 10% FBS + MEM-NEAA + 1x B + 100uM Taurine), scrape off the cells using the cross-pipette method, and transfer them to low-absorption 6-well plates using a Pasteur pipette; at D30~D40, select well-defined organoids under a stereomicroscope for long-term culture.

[0100] 7. Immunofluorescence detection of human retinal organoids 7.1. Prepare working solutions: Dilute BSA with PBS to a working concentration of 5%; dilute DAPI with PBS (dilution ratio 1:2000); dilute Triton X-100 with PBS (1:100).

[0101] 7.2. Prepare primary antibody working solution: dilute PROM1 antibody (1:500) with BSA, dilute Rhodopsin antibody (1:500) with BSA, and dilute PCDH21 antibody (1:500) with BSA.

[0102] 7.3. Prepare the working solution for the secondary antibody: Dilute the corresponding secondary antibody with PBS (1:500).

[0103] 7.4. Soak tissues in PBS at 58°C for 30 min, then wash with PBS for 5 min, for a total of 3 times.

[0104] 7.5. Circle the tissue with an immunohistochemical pen, drop 200 μl of 0.2% Triton X-100 onto each tissue, and incubate in a humidified chamber.

[0105] 7.6. Wash with PBS for 5 min, for a total of 3 times. Block with BSA for 30 min, then incubate in a humidified chamber.

[0106] 7.7. Add primary antibody and incubate overnight in a humidified chamber.

[0107] 7.8. Wash with PBS for 5 min, repeat 3 times, add secondary antibody, and incubate in a humidified chamber for 1 h.

[0108] 7.9. Wash with PBS for 5 min, repeat 3 times, then add DAPI dye and let stand for 5 min.

[0109] 7.10. Wash with PBS for 5 min, three times in total, and mount with an anti-fluorescence quencher. Store at 4°C protected from light.

[0110] 8. Human retinal organoid virus infection and detection Retinal organoids differentiated on day 100 were transferred to ultra-low adsorption 96-well plates, one organoid per well. This experiment included five groups: a positive control (WT), a non-virus-injected group (KO), and a virus-injected group (rAAV&RK1-Prom1 (patent pending)). Each group contained six organoids.

[0111] Virus mixtures were prepared for infection of the KO group, with a total viral load of 1E10 vg per well. The WT and KO groups served as positive and negative control groups, respectively. Two days after infection, the culture medium infected with rAAV virus was discarded and replaced with fresh medium, and thereafter the medium was changed every 2–3 days. Six weeks after infection, organoids were selected from each group for immunofluorescence detection of frozen sections.

[0112] Example 1: In vitro screening and construction of sgRNAs Prom1 Gene knockout cell lines After transfection with Cas9 / sgRNA1, two mutant bands of 224bp and 338bp were observed in HEK-293T cells, with an editing efficiency of 44.76%; after transfection with Cas9 / sgRNA2, two mutant bands of 254bp and 309bp were observed in cells, with an editing efficiency of 25.48%; and after transfection with Cas9 / sgRNA3, two mutant bands of 400bp and 165bp were observed in cells, with an editing efficiency of 48.7%. Figure 1 A. Figure 1B showed that Cas9 / sgRNA3 editing efficiency was the highest. Further validation of sgRNA1 / 3 editing efficiency was performed in H9 cells. Results are as follows... Figure 1 As shown in Figure C, genome-level analysis revealed distinct mutant bands (~400 bp and ~200 bp) in H9 cells electroporated with Cas9 / sgRNA1 / 3. The editing efficiency of sgRNA1 was 22.2%, while that of sgRNA3 was 35.5%. Figure 1 D).

[0113] The results indicated that sgRNA3 had better editing efficiency in H9 cells, therefore, subsequent experiments were all based on sgRNA3.

[0114] Example 2 H9 cells Prom1 Gene knockout testing.

[0115] 2.1 Genome-level detection Prom1 Knockout After electroporated sgRNA3-H9 mixed cell lines were cultured as single cells, the genome was subjected to PCR and sequencing. Figure 2 The display shows that three types were obtained after filtering. Prom1 The single-cell clones with homozygous gene knockout exhibited the following genome knockout types: one clone with an 8bp deletion (TGAATAGC), and two clones with a 1bp deletion. All three clones produced a TGA stop codon after a frameshift mutation, indicating that transcription terminated after the target region of Exon 9.

[0116] Clone 1: The Exon9 sequence after deleting 8bp (deleting TGATAGC), with the underlined TGA being the stop codon formed due to frameshift. CGATCAAGGAGACCAAAGAGGCGTTGGAGAACATGAACAGCACCTTGAAGAGCTTGCACCAACAAAGTACACAGCTTAGCAGCAGTCTGACCAGCGTGAAAACTAGCCTGCGGTCATCTCTCAATGACCCTCTGTGCTTGGTGCATCCATCAAGTGAAACCTGCAACAGCATCAGATTGTCTCTAAGCCAGCAACCC TGA ACTGAGGCAG (SEQ ID NO:10) Clone 2: The sequence of Exon9 after deleting 1 bp (deleting T), with the underlined TGA being the stop codon formed due to frameshift: CGATCAAGGAGACCAAAGAGGCGTTGGAGAACATGAACAGCACCTTGAAGAGCTTGCACCAACAAAGTACACAGCTTAGCAGCAGTCTGACCAGCGTGAAAACTAGCCTGCGGTCATCTCTCAATGACCCTCTGTGCTTGGTGCATCCATCAAGTGAAACCTGCAACAGCATCAGATTGTCTCTAAGCCAGCGAATAGCAACCCTGAAC TGA GGCAG (SEQ ID NO: 11) Clone 3: Exon9 sequence after deleting 1 bp (G deletion), the underlined TGA is the stop codon formed due to frameshift: CGATCAAGGAGACCAAAGAGGCGTTGGAGAACATGAACAGCACCTTGAAGAGCTTGCACCAACAAAGTACACAGCTTAGCAGCAGTCTGACCAGCGTGAAAACTAGCCTGCGGTCATCTCTCAATGACCCTCTGTGCTTGGTGCATCCATCAAGTGAAACCTGCAACAGCATCAGATTGTCTCTAAGCCAGCTAATAGCAACCC TGA ACTGAGGCAG (SEQ ID NO: 12) 2.2 Protein level detection of PROM1 knockout Protein level test results are shown below Figure 3 The results showed that the PROM1 protein was completely knocked out in KO-H9 monoclonal cells, consistent with expectations.

[0117] Example 3 Prom1 Morphology and protein knockout detection of gene knockout retinal organoids.

[0118] Relative to wild-type retinal organoids (WT) Prom1 Gene knockout did not affect retinal development. Figure 4 A). Immunofluorescence assay confirmed Prom1 No PROM1 expression was observed in gene knockout organoids (KO). Figure 4 B), confirm Prom1 The gene was knocked out.

[0119] Example 4 Prom1 Phenotypic analysis of gene knockout retinal organoids Relative to wild-type organoids (WT) Prom1In gene knockout organoids (KO), the fluorescence intensity of the photoreceptor-specific protein Rhodopsin (Rho) was significantly reduced. Figure 5 B), in which Rho-labeled photoreceptor outer segments (OS) (the green fluorescent structures above the dashed line) were significantly reduced, with lower density and shorter length. Figure 5 A), Hint Prom1 Gene knockout affects the formation of the outer segment of the photoreceptor layer. This result is consistent with the disease phenotype in the mouse model, confirming that... Prom1 Human retinal organoids with gene knockout have been successfully constructed. The absence of the outer segment of the photoreceptor severely impairs the light-sensing function of the retina, leading to disease phenotypes such as retinitis pigmentosa and macular degeneration.

[0120] Example 5 Prom1 Validation of gene knockout retinal organoid models 5.1 Detection of changes in the expression of Rhodopsin (Rho), a protein specific to retinal photoreceptors like Figure 7 As shown, after infection with the virus rAAV&RK1-Prom1 (RK1 promoter-wild-type Prom1 coding sequence), PROM1 (shown as red fluorescence) is expressed in the photoreceptor layer of the Prom1 KO RO organoid, and its PROM1 expression distribution trend is consistent with that of the wild-type organoid (WT RO); at the PROM1 expression site, the number and fluorescence intensity of Rho-labeled photoreceptor outer segments (OS) (green fluorescent structures above the dashed line) are significantly increased. Figure 7 The above results indicate that, Prom1 PROM1 reinjection in gene-knockout human retinal organoids helps improve the differentiation damage of the outer segment Rho structure of photoreceptors, compared with existing technologies. Prom1 In KO mice, the expression intensity and number of Rho cells increased consistently after PROM1 reinjection. DAPI (blue fluorescence) represents the nuclear layer of photoreceptor cells.

[0121] 5.2 Detection of changes in the expression and distribution of opsin in the retinal photoreceptor layer Immunofluorescence assay results showed that, compared to WT RO, Prom1 In KORO, the fluorescence intensity and number of Opsin (shown as red fluorescence), a marker molecule for cone cells in the photoreceptor layer, were significantly reduced at the OS. Figure 8 The majority of these structures are photosensitive structures located at the ONL region that are not yet fully differentiated or are in the early stages of differentiation, suggesting... Prom1Gene knockout affects the formation and distribution of Opsin protein in the photoreceptor layer; after infection with the rAAV&RK1-Prom1 virus, a large amount of Opsin was observed at the OS of the Prom1 KORO photoreceptor layer, and the expression fluorescence intensity and number (shown by red fluorescence) were significantly increased, significantly higher than those in the uninjected Prom1 KORO group. Figure 8 The above results indicate that, Prom1 In the KORO disease model, PROM1 reinjection helps improve the degree of impairment in Opsin protein formation and distribution at the OS of photoreceptors. DAPI (blue fluorescence) represents the nuclear layer of photoreceptor cells.

[0122] 5.3 Detection of changes in the expression of PCDH21, an assembly protein of the outer segment of the retinal photoreceptor layer. The PCDH21 protein is located at the base of the photoreceptor layer of the retina and is an important protein involved in the assembly of the outer segments of the photoreceptor layer. It is also one of the important proteins reported to interact with PROM1. Compared to wild-type organoids (WT RO). Prom1 Gene knockout organoids ( Prom1 The fluorescence intensity of PCDH21 expression in the photosensitive layer of the KO RO layer was significantly reduced. However, after infection with the virus rAAV&RK1-Prom1, Prom1 PROM1 expression was observed in the photosensitive layer of KO RO (shown as green fluorescence), and the fluorescence intensity of PCDH21 expression was significantly increased (shown as red fluorescence) at the PROM1 expression site, which was significantly higher than that of the uninjected virus. Prom1 KO RO group ( Figure 9 The above results indicate that, Prom1 Replenishment in the KO RO disease model Prom1 It helps to enhance the expression of PCDH21, a molecule that assembles the photoreceptor layer. DAPI (blue fluorescence) represents the photoreceptor nuclear layer.

[0123] The above results collectively demonstrate that the invention constructs... Prom1 Human retinal organoid models with gene knockout can not only reflect the phenotypic trends of diseases associated with the Prom1 molecule, but also conduct molecular mechanism studies, efficacy evaluations, and drug screenings, including but not limited to those described in this invention, providing more reference bases for further exploring treatment strategies for diseases caused by this mutated gene.

[0124] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. An organoid model, characterized in that, The organoids are derived from cell culture, and the cells contain... Prom1 The gene segment in exon 9 of the gene transcript is mutated, and the expression of PROM1 protein in the cell is reduced or inactivated. The cells were H9 cells; The organoids mentioned are retinal organoids.

2. The organoid model as described in claim 1, characterized in that, The retinal organoid model described above has one or more characteristics selected from the group consisting of: a) Decreased expression of the photoreceptor cell-specific protein rhodopsin (Rho); b) Decreased density of the outer segment (OS) of photoreceptor cells; and c) Shortened length of photoreceptor outer segment (OS).

3. The organoid model as described in claim 1, characterized in that, The retinal organoid model described above exhibits a latent retinal degenerative disease phenotype.

4. The organoid model as described in claim 3, characterized in that, The latent retinal degenerative diseases mentioned are selected from the following group: retinitis pigmentosa, macular degeneration, cone-and-bar dystrophy, or a combination thereof.

5. A method for culturing an organoid model as described in claim 1, characterized in that, Including the following steps: Isolated cells are provided and cultured under conditions suitable for organoid differentiation to obtain the organoid model as described in claim 1; Among them, the cells Prom1 The gene segment in exon 9 of the gene transcript is mutated, and the expression of PROM1 protein in the cell is reduced or inactivated. The cells in question are H9 cells.

6. A method for screening or identifying therapeutic agents for treating or alleviating latent retinal degenerative diseases, comprising the steps of: (a) In the test group, the test drug was administered to a model of latent retinal degeneration, and the severity of latent retinal degeneration in the model in the test group was measured Q1; in the control group, the control compound was administered to a model of latent retinal degeneration, and the severity of latent retinal degeneration in the model in the control group was measured Q2. (b) Compare the severity Q1 and severity Q2 detected in the previous step to determine whether the test compound is a potential therapeutic agent for treating or alleviating latent retinal degenerative diseases; in, If severity Q1 is significantly lower than severity Q2, it indicates that the test drug is a potential treatment for or relief of latent retinal degenerative diseases. The latent retinal degenerative disease model is the organoid model as described in claim 1.

7. The method as described in claim 6, characterized in that, The severity of latent retinal degenerative diseases being detected includes detecting the expression levels of proteins selected from the group consisting of: retinal photoreceptor-specific protein Rhodopsin (Rho), retinal photoreceptor opsin Opsin, retinal photoreceptor outer segment assembly protein PCDH21, or combinations thereof.

Citation Information

Patent Citations

  • Novel therapeutic drug for treating Prom1-related retinal diseases

    CN121046460A

  • Retinal organoid model systems

    US20230151327A1

  • Novel therapeutic drug for treating PROM1-associated retinal disease

    WO2025247393A1