Use of or59a in regulating olfactory behavior of sexually mature female b. cucurbitae
By downregulating the expression of the female melon fly Or59a gene and using dsRNA interference technology to regulate its olfactory behavior, the problem of poor control effect of chemical pesticides was solved, and an environmentally friendly pest control effect was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTH CHINA AGRICULTURAL UNIVERSITY
- Filing Date
- 2025-07-10
- Publication Date
- 2026-07-21
AI Technical Summary
Existing technologies using chemical pesticides to control melon flies are ineffective and cause environmental problems. There is a need to find new environmentally friendly control methods, study the co-evolutionary relationship between insects and plants, and clarify the mechanism of action of plant volatile secondary metabolites on insect physiology in order to regulate insect behavior.
By downregulating the expression of the Or59a gene in female melon flies, olfactory behavior was regulated using dsRNA interference technology, reducing their preference for bitter melon volatiles and interfering with the olfactory localization of their host plants.
It significantly reduces the oviposition damage of sexually mature female melon flies on bitter gourds, achieving the goal of pest control, reducing the use of chemical pesticides, and protecting the environment.
Smart Images
Figure CN121046394B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and specifically relates to the application of Or59a in regulating the olfactory behavior of sexually mature female melon flies. Background Technology
[0002] The melon fly (Zeugodacus cucurbitae (Coquillett)) belongs to the order Diptera and family Tephritidae. It is a global agricultural pest and a quarantine pest for imported plants in my country, widely distributed in tropical, subtropical, and temperate regions (Deng Jinqi et al., 2021). The melon fly has up to 130 host plant species. Adults lay eggs, and larvae bore into the fruit, primarily damaging plants in the Cucurbitaceae and Solanaceae families, such as cucumber, pumpkin, melon, watermelon, bitter melon, tomato, and eggplant (Koyama J et al. 2004). The melon fly is characterized by its strong invasiveness, short generation cycle, wide adaptability, and high reproductive rate. Female adults use their ovipositor to pierce the epidermis of young melons to lay eggs. After hatching, the larvae burrow into the melon to feed, severely impacting the quality and yield of the fruit. According to reports, the melon fly causes severe economic losses to agricultural production, typically ranging from 20% to 50%, and in severe cases up to 90% (Xiao Fulian and Hu Cheng, 2021). Therefore, many countries and regions around the world have listed the melon fly as an important quarantine target.
[0003] Currently, chemical control remains the primary method for controlling melon flies in the field, with high-efficiency cypermethrin, abamectin, and neonicotinoid pesticides being commonly used. However, as melon flies gradually develop resistance to pesticides in the field, control efficacy is unsatisfactory, and the extensive use of chemical pesticides has also brought about a series of environmental problems (Zhang Suyun, 2021). Therefore, exploring new pesticide targets and developing novel environmentally friendly insecticides is urgently needed (Su Zhirong et al., 2024). Studying the co-evolutionary relationship between insects and plants and clarifying the mechanism of action of plant volatile secondary metabolites on insect physiology can provide a new ecological management method and approach for integrated pest management.
[0004] Insect host selection behavior is an important aspect of insect behavioral ecology research (Cunningham, 2012). Insects locate host plants over long distances primarily through the volatile substances of the host plant (Zhang, 2017), especially during host migration (Dweck KH et al. 2018). This process includes a host-finding stage, an attraction stage (where the host plant's volatile secondary metabolites attract insects to the plant via olfactory receptors), and a perception stage (where insects, after contact with the plant, perceive the proportions of plant nutrients, feeding stimuli, or inhibitory factors through gustatory receptors) (Vetl, 1992). Generally, for herbivorous insects, the species and complexity of the host plant influence their oviposition behavior (Peng et al., 2013). Over a long evolutionary process, herbivorous insects have developed a series of unique behaviors and mechanisms for recognizing host plants and selecting different host plants (Dong, 2017). The selective adaptation of herbivorous insects to host plants is a core aspect of research on the co-evolutionary relationship between insects and plants (Li et al., 2022). Assessing the fitness of host plants to herbivorous insect populations requires a comprehensive analysis of the insects' feeding fitness and oviposition selectivity (Liu et al., 2014). Host species, surface structure, and volatiles all influence the oviposition behavior of fruit flies (Xu et al., 2018). Many fruit fly pests release host-marking pheromones after oviposition to indicate that the host fruit has been occupied, thereby regulating their oviposition selection behavior on the host fruit (Chen et al., 2018).
[0005] The melon fly has a high reproductive capacity, and its damage mainly occurs through females locating host plants to lay eggs and larvae feeding on them. This study investigates the effects of the main volatiles from host plants on the melon fly's host location, as well as the olfactory responses and mechanisms of the fly during this process. The results can provide new ideas and methods for the effective control of the melon fly. Summary of the Invention
[0006] The purpose of this invention is to provide the application of Or59a in regulating the olfactory behavior of sexually mature female melon flies.
[0007] The olfactory receptor Or59a, which regulates the behavioral selection of female melon fly, as shown in this invention, has the nucleotide sequence shown in SEQ ID NO.1, and the synthesized dsRNA sequence is shown in gray.
[0008] 5’——ATGTCACCATCACCATTATCGTTACCGCCACCGCCACCGCCGTTAGCGGCAGTTGATACCCGCTCATTTTTTAAACTTCATTGGACGTGCTTCAGAGTGCTCGGTATTAACGCGCCCTCGTCTAACACCTACTACTCGGTGCTGCTGCAAGTACTCGTCACCCTCTGCTATCCATTTCATCTCGCCTTGGCGCTCTTCAGCAGCCCTGATGCCTCGATCAATATTCAGAATCTCACCGTGTGTGTCACCTGTGTGGCCTGCAGCATGAAATTTGTCTTCTACGCCACGAGATTGTCGCGCATACGTGAGCTGGAGTCCATCATTGCCGCATTGGATGCACGTGCCCGGAGTCTGTGTGAGCGTCGTTACTTCGTACAGTTACGTAAGGAATTGCGTCGCATTACCATCTGCTTTCTCTGTATTTATACCGTTGTGGGCGTGACGGCGGAGCTGATGTTTATTTTTCATAATGAGCGTAATTTGTTGTATCCGGCTTGGTTTCCGTTCGATTGGCGTGCCAGCAATTTGAAGTTCTATGCAGCGCATTCTTATCAAATCGTCGGCATCTCCTACCAATTGCTGCAGAATTTCGTTAACGATTGCTTTCCGACTATGGCTTTGGCGCTGTTGTCGGCGCACATCAAATTGCT GGGTATTAGAGTTTCGCAAATTGGCCACGAGACGGCGAGTCTCGGGGCGAATGAGGCGGAGTTGTTGCATTGCATCAAAGATCAAGAACAGCTCTACAACGTGCTCAACATCATTCAAAATATCATCTCGCTGCCGATGTTTCTGCAATTCACCGTTACTGCTATCAACTTATGTCTAGGAATGGCCGCATTACTATACTTTGTGGATGCACCTTTCGATCGCTTGTACTATTTGGCATATTTGCTGGCGTTGCCGTTGCAAATCTTTCC CATCTGTTACTATGGCACAACATTTCAATTACTTTTCGATAAGCTGCACGTCGAGATGTTCGCCAGCAACTGGGTGGAGCAGACACACAAATTTCGCAAGCATATGATACTCTTTTGCGAACGCTCGTTGATGAGTCAAACAGCCATGGCCGGCGGTATTGTACGCATTCACTTGGATACTTTCATTTCGACCTGCAAAGCAGCTTACTC TCTGTTGGCTGTCATAATGAAGATGAATGAATGA - 3' (SEQ ID NO. 1).
[0009] Therefore, this invention provides the application of the Or59a gene in regulating the olfactory behavior of sexually mature female melon fly, and the nucleotide sequence of the Or59a gene is shown in SEQ ID NO.1.
[0010] Preferably, downregulating the expression of the Or59a gene affects the olfactory localization of sexually mature female melon fly host plants.
[0011] Preferably, the downregulation of Or59a gene expression is achieved by interfering with dsRNA.
[0012] Preferably, the primers for the synthesis of the dsRNA are: F: 5'-CGTCGGCATCTCCTACCAAT-3' and R: 5'-CGAGCGTTCGCAAAAGAGTA-3'.
[0013] The present invention also provides a method for controlling melon fly, which involves downregulating the expression of the Or59a gene in female melon fly, thereby affecting the olfactory localization of the host plant of sexually mature female melon fly. The nucleotide sequence of the Or59a gene is shown in SEQ ID NO.1.
[0014] Preferably, the downregulation of Or59a gene expression is achieved by interfering with dsRNA.
[0015] Preferably, the primers for the synthesis of the dsRNA are: F: 5'-CGTCGGCATCTCCTACCAAT-3' and R: 5'-CGAGCGTTCGCAAAAGAGTA-3'.
[0016] This invention has the following advantages and effects compared to all other technologies:
[0017] This invention identifies an olfactory receptor that regulates the preference of female melon fly for bitter melon volatiles. After downregulating the expression of Or59a, the preference of female melon fly for bitter melon volatiles decreased significantly after 20 days of emergence, making it impossible for them to accurately locate bitter melon for oviposition and damage, thereby achieving the purpose of pest control. Attached Figure Description
[0018] Figure 1 This is a graph showing the expression levels of Or59a in the antennae of female melon fly at two different ages: 3 days after emergence (initial emergence) and 20 days after emergence (sexual maturity).
[0019] Figure 2 This is a selection statistics chart of bitter melon volatiles by female melon fly with gene silencing Or59a 48 hours after emergence 20 days ago. Detailed Implementation
[0020] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0021] Example 1
[0022] 1. The insects used were collected from the wild and then reared in a laboratory environment for an extended period. The temperature was set at 26 ± 2 degrees Celsius, the indoor humidity was controlled at around 65%, and the photoperiod L:D = 14:10 to ensure that the melon fly was in an optimal growth environment and to accelerate its growth and reproduction. The larvae were reared in zucchini or bitter melon of suitable age, and the adults were fed an artificial diet consisting of 4 g of OXOID yeast extract and 12 g of anhydrous glucose, with a water supply provided.
[0023] 2. Selection of antennal samples: Antennae of 100 female and 100 male melon fly adults at 3 and 20 days of emergence were randomly selected from the population rearing cages, with three replicates for each group. The antennae were ground in liquid nitrogen and total RNA was extracted using the TRIzol method.
[0024] 3. The extracted total RNA was sent to the company for transcriptome sequencing. The sequencing results showed that the olfactory receptor Or59a is a female adult-specific gene, and the expression level of Or59a in female adults 20 days after emergence was significantly higher than that in female adults 3 days after emergence.
[0025] 4. RT-qPCR verification of sequencing results: Antennae of 60 female and 60 male melon fly adults at 3 days and 20 days of emergence were collected in three replicates. The antennae were ground in liquid nitrogen and total RNA was extracted using the TRIzol method.
[0026] 5. Synthesis of cDNA first strand: The first strand template for quantitative PCR was reverse transcribed using a reverse transcription kit (PrimeScript™ RT reagent Kit), and 1 μg of total RNA was reverse transcribed into cDNA.
[0027] 6. Quantitative PCR detection: qPCR detection was performed using the KAPA SYBR FAST Universal qPCR Kit. The amplification primers for Or59a and the internal reference gene RPS3 are as follows:
[0028] Or59a F: 5’-ATCAAATCGTCGGCATCTCC-3’ R: 5’-GCGAAACTCTAATACCCAGCAA-3’ RPS3 F: 5’- TAAGTTGACCGGAGGTTTGG-3’ R: 5’- TGGATCACCAGAGTGGATCA-3’
[0029] 7. RT-qPCR results further validated the sequencing results, indicating that the olfactory receptor Or59a is a female-specific expression gene, and the expression level of Or59a in female adults 20 days after emergence was significantly higher than that in female adults 3 days after emergence. Figure 1 ).
[0030] Example 2
[0031] (1) Download the Or59a gene sequence of the melon fly (GenBank accession number: LOC105216084), select the target gene sequence (490 bp) in the conserved region and main functional region of the sequence, and design and synthesize the dsRNA (dsOr59a) primers of the gene; design the dsRNA (dsGFP) primers of the GFP gene based on the sequence of the green fluorescent protein GFP gene (GenBank accession number: AF324407.1).
[0032] DsOr59a F: 5’-CGTCGGCATCTCCTACCAAT-3’ R: 5’-CGAGCGTTCGCAAAAGAGTA-3’ dsGFP F: 5’-CACTGGAGTTGTCCCAATTC-3’ R: 5’-TCCCAGCAGCTGTTACAAAC-3’
[0033] (2) Using the cDNA from Example 1 as a template, the target fragment was amplified and constructed into a T vector. Subsequently, after transformation, spot picking and culture were performed. Positive clones were selected and sent to the company for sequencing. The correctly sequenced clones were stored for later use.
[0034] (3) The preserved bacterial culture was activated by shaking, and the plasmid was extracted. The plasmid was used as a template for subsequent steps.
[0035] (4) Using plasmid as a template, the target gene is amplified by PCR with forward and reverse primers connected to the T7 promoter at the 5' end, and the target gene fragment with the T7 promoter sequence connected at both ends is obtained, which is used as a template for dsRNA synthesis.
[0036] (5) Synthesize double-stranded RNA according to the instructions of the Promege T7 Transcription Kit (T7 RiboMAX™ Express RNAi System).
[0037] (6) 100 female melon fly larvae that had emerged 20 days prior were randomly selected from the population cages. After being stunned with CO2, they were placed in agar plates for injection. The dsRNA concentration was diluted to 5 μg / μL, and 0.2 μL was injected into each larva. The injected melon fly larvae were then reared in population cages (30cm × 30cm) with a diet of moistened cotton balls and yeast extract: glucose in a 1:3 ratio. The feed was changed every 2 days. At the same time, 100 female melon fly larvae that had emerged 20 days prior and injected with dsGFP were set up as a control.
[0038] (7) 60 heads were randomly selected for Y-tube double selection experiment 48 h after dsRNA injection. The two arms of the Y-tube were connected to the host plant odor and clean air, respectively.
[0039] (8) The host plant odor source was a number of fresh, whole bitter melons purchased from the supermarket. After being crushed into a paste by a juicer, the paste was placed in a custom-made odor source bottle. The experimental materials for the odor selection device mainly included a ground glass Y-tube (outer diameter 3cm, arm length 24cm); a ground glass stopper; silicone tubes (inner diameter 6mm and inner diameter 10mm); a custom-made wash bottle (outer diameter 14cm); activated carbon; an air pump; a gas flow meter; and a three-way glass tube.
[0040] (9) Y-tube double-selection experiment method: After the test insects are introduced into the odor selectivity measuring device, their behavior is observed for 5 minutes. If the test insects remain in the release area after 5 minutes, the observation of their behavior is terminated. If the test insects linger for more than 10 seconds near the odor source bottle on a certain arm, it is determined that the odor source bottle corresponding to that arm has successfully attracted the test insects. At the beginning of the experiment, one arm of the Y-tube is randomly selected for treatment, and the other arm is a blank control without any substance. After ventilating for 10 minutes, test insects are randomly selected from the insect rearing cage and introduced into the end of the air outlet of the Y-tube, allowing them to move freely. The gas flow rate was set to 400 mL / min during the measurement. After each treatment, the positions of the two arms of the Y-tube were interchanged to avoid interference from different spatial positions on the test insects. Each test insect was used only once. After testing 3 adult insects, the experimental equipment was disinfected, cleaned and dried with anhydrous ethanol to ensure that there was no special odor produced by the test insects in the tube arms, thereby reducing errors. The experiment ended after testing 60 test insects, and the number of insects that stayed at 1 / 3 of the two tube arms for more than 10 seconds was recorded.
[0041] (10) such as Figure 2As shown, the results of a double selection of 60 test insects in each of the Or59a treatment group and the GFP control group showed that, compared with dsGFP, sexually mature female melon flies were significantly biased towards the blank control in both arms of the Y-shaped tube, further indicating that interference with Or59a would affect the olfactory localization of sexually mature female melon flies in their host plants.
[0042] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention are all equivalent substitutions and are included within the protection scope of the present invention.
Claims
1. Application of the Or59a gene in regulating the olfactory behavior of sexually mature female melon fly, wherein the nucleotide sequence of the Or59a gene is shown in SEQ ID NO.1, and the application is to downregulate the expression of the Or59a gene to affect the olfactory localization of the host plant of sexually mature female melon fly, thereby controlling the melon fly, wherein the host plant is bitter melon.
2. The application according to claim 1, characterized in that, The downregulation of Or59a gene expression is achieved by interfering with dsRNA.
3. The application according to claim 2, characterized in that, The dsRNA described above uses the following primers for synthesis: F: 5'-CGTCGGCATCTCCTACCAAT-3' and R: 5'-CGAGCGTTCGCAAAAGAGTA-3'.
4. A method for controlling melon fruit flies, characterized in that, The method involves downregulating the expression of the Or59a gene in female melon fly, thereby affecting the olfactory localization of the host plant by sexually mature female melon fly and controlling melon fly. The nucleotide sequence of the Or59a gene is shown in SEQ ID NO.1, and the host plant is bitter melon.
5. The method according to claim 4, characterized in that, The downregulation of Or59a gene expression is achieved by interfering with dsRNA.
6. The method according to claim 5, characterized in that, The dsRNA described above uses the following primers for synthesis: F: 5'-CGTCGGCATCTCCTACCAAT-3' and R: 5'-CGAGCGTTCGCAAAAGAGTA-3'.