A rice heterozygous male sterility locus HMS10 RS Cloning and Application

By cloning the HMS10RS locus from Yannong S and applying transgenic technology to cultivate heterozygous male-sterile rice, the problem of high risk in two-line hybrid rice seed production has been solved, achieving stable fertility and abundant sterile resources, thus improving the safety and efficiency of rice breeding.

CN121046406BActive Publication Date: 2026-07-31RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI +1
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Filing Date
2025-09-23
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

The existing two-line hybrid rice has high seed production risks, a narrow breeding area for sterile lines, and a relatively limited range of practical sterile resources. In addition, seed production failures occur frequently, affecting rice yield and food security.

Method used

The heterozygous male sterility locus HMS10RS was isolated and cloned from the antithermally sensitive male sterile line Yannong S. The heterozygous male sterility locus was verified by transgenic genetic complementation. Heterozygous male sterile lines were bred using the HMS10RS locus, and molecular breeding strategies were combined to enrich the types of sterile resources.

Benefits of technology

This has enabled the development of heterozygous male-sterile lines with stable fertility and free pairing, reducing seed production risks, enriching the types of sterile resources, and improving the seed production safety and breeding efficiency of two-line hybrid rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121046406B_ABST
    Figure CN121046406B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant genetic engineering technology and relates to a rice heterozygous male sterility locus HMS10. RS Cloning and Application. This invention employs map-based cloning to isolate and clone the locus HMS10, which controls heterozygous male sterility in rice, within a ~51 kb physical region on chromosome 10 of the thermosensitive male sterile line Yannong S. RS This was verified through transgenic genetic complementation experiments. Using molecular breeding strategies, HMS10... RS The application of this site to the breeding of heterozygous male-sterile rice lines is of great significance for solving the risks of two-line hybrid rice seed production and enriching the types of practical male-sterile resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a heterozygous male-sterile rice variety HMS10. RS Cloning and application of loci. Background Technology

[0002] The invention and widespread application of two-line hybrid rice technology, based on photoperiod- and temperature-sensitive male sterility (i.e., two-line sterile resources) gene resources, has made significant contributions to ensuring increased rice production and food security in my country. However, the promotion of two-line hybrid rice also faces numerous challenges, including high seed production risks, narrow breeding areas for sterile lines, and a relatively limited range of practical sterile resource types. In recent years, the complex and volatile global climate has led to persistently high risks in two-line hybrid rice seed production, with frequent seed production failures. Seed production safety has become a major obstacle to the healthy and sustainable development of two-line hybrid rice. Therefore, there is an urgent need in production for a new male sterile resource with a broad restoration spectrum, sterility unaffected by the environment, and reproductive capability to overcome the technical challenges of potential seed production risks in two-line hybrid rice.

[0003] Heterozygous male sterility (HMS) in rice possesses significant advantages such as stable fertility and relatively free mating. The breeding utilization of this trait holds promise for solving the aforementioned technical challenges. Therefore, heterozygous male sterile lines have broad breeding application prospects. Ni Jinlong et al. from the Rice Research Institute of the Anhui Academy of Agricultural Sciences developed a series of design breeding techniques (ZL201911258959.4, ZL202211640849.6, and ZL202310044830.3) for different types of materials, creating heterozygous male sterile lines such as 1829HS and Yannong HS, whose fertility is unaffected by the environment and who have relatively free mating. Ni Jinlong et al. utilized rtms10... RS (From Yannong S) Thermostable male sterile line and the rtms10 carrier HB (rtms10) RS In a cross between fertile materials (alleles from 1892F), the F1 generation exhibited HMS. Since the rtms10 gene was not cloned, it remains to be seen whether HMS is caused by rtms10. RS With rtms10 HB The direct genetic interaction is the cause, but further verification is needed. Therefore, it is necessary to conduct in-depth genetic analysis of HMS, isolate and clone the genetic loci controlling HMS, and verify through transgenic genetic complementation, so as to provide reliable technical support and theoretical basis for molecular breeding of heterozygous male sterile lines. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention isolates and clones the rice heterozygous male sterility locus HMS10 from the antithermally sensitive male sterile line Yannong S. RS The aim is to solve some of the problems in existing hybridization breeding technology or at least alleviate some of the problems in existing technology.

[0005] In one aspect, the present invention relates to a DNA molecule having the nucleotide sequence shown in SEQ ID NO: 1, wherein the DNA molecule is the HMS10 site controlling heterozygous male sterility in rice. RS .

[0006] The DNA molecule of the present invention is characterized in that it contains two transcripts, wherein transcript 1 (or ORF1) RS ) and transcript 2 (or ORF2) RS The DNA molecules of the ORF1 have the nucleotide sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3 in the sequence listing, respectively; RS and ORF2 RS The coding region DNA molecules have the nucleotide sequences shown in SEQ ID NO: 4 and NO: 5, respectively; the ORF1 RS and ORF2 RS Each protein encodes two proteins, which have the amino acid sequences shown in SEQ ID NO: 6 and NO: 7 of the sequence listing, respectively.

[0007] The present invention also relates to recombinant vectors containing the above-mentioned DNA molecules and transgenic cell lines or host bacteria containing the recombinant vectors, such as Agrobacterium.

[0008] In one aspect, the present invention relates to a method for cultivating heterozygous male-sterile rice, comprising: taking the above-mentioned HMS10... RS The site or a recombinant vector containing the site is introduced into a vector carrying HMS10. HB The steps involved in creating heterozygous male-sterile maintainer lines (HB resources, including but not limited to thermosensitive male-sterile lines such as 1892S, Y58S, P88S, and Quan211S, as well as fertile resources such as 1892F and similar materials derived therefrom) are as follows. Specifically, in the process of creating heterozygous male-sterile rice, the amino acid sequence shown in SEQ ID NO:6 and SEQ ID NO:7 at the HMS10 site, which controls the heterozygous male-sterile trait in rice, must be intact, and no substitution, deletion, or addition of one or more amino acid residues is permitted.

[0009] The present invention also relates to the use of the above-mentioned DNA molecule, the above-mentioned recombinant vector, the above-mentioned Agrobacterium, or the above-mentioned protein in the creation of heterozygous male sterile rice.

[0010] In one aspect, the present invention discloses a site HMS10 for controlling heterozygous male sterility in rice. RS The HMS10 RS The nucleotide sequence of the DNA molecule is shown in SEQ ID NO: 1. SEQ ID NO: 1 contains two transcript sequences, namely ORF1... RS and ORF2 RS Its nucleotide sequence is shown in SEQ ID NO: 2 and SEQ ID NO: 3. The ORF1 RS and ORF2 RS The DNA molecular sequences of the coding regions are shown in SEQ ID NO: 4 and NO: 5, respectively. The ORF1... RS and ORF2 RS They encode two proteins, the amino acid sequences of which are shown in SEQ ID NO: 6 and NO: 7.

[0011] In one aspect, the present invention discloses a recombinant vector comprising HMS10. RS The DNA molecule, or the vector comprising nucleotide sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 3, or the vector comprising nucleotide sequences as shown in SEQ ID NO: 4 and NO: 5.

[0012] In one aspect, the present invention discloses an Agrobacterium carrying the aforementioned recombinant vector.

[0013] In one aspect, this invention discloses a method for creating heterozygous male-sterile rice, the method comprising introducing the aforementioned DNA molecule of this invention into any other rice genetic material carrying HMS10 through marker-assisted selection, transgenic methods, or gene editing. RS Genotype strains, and directly related to those carrying HMS10. HB Steps for creating heterozygous male-sterile lines through sexual hybridization of HB resources, a heterozygous male-sterile maintainer line.

[0014] In one aspect, the present invention discloses a method for creating heterozygous male-sterile rice, the method comprising introducing the aforementioned DNA molecule or the aforementioned recombinant vector carrying HMS10 HB Steps in the genotypic heterozygous male sterile maintainer line HB resource.

[0015] In one aspect, the present invention discloses a method for creating heterozygous male-sterile rice, the method comprising carrying HMS10 HBPlant cells or tissues of the genotype-specific heterozygous male-sterile maintainer line HB are contacted with the aforementioned Agrobacterium, thereby transmitting the HMS10 heterozygous male-sterile trait in rice. RS The steps involved in transferring a polynucleotide sequence from a site into a plant cell and integrating it into the plant cell's chromosome.

[0016] In this invention, the heterozygous male sterile maintainer line HB resources include, but are not limited to, thermosensitive male sterile lines such as 1892S, Y58S, P88S and Quan211S, as well as fertile resources such as 1892F and similar materials derived therefrom.

[0017] This invention isolates and clones the genetic locus HMS10, which controls the HMS trait. RS This was verified through transgenic genetic complementation experiments. Using molecular breeding strategies, HMS10... RS The locus was applied to the breeding of heterozygous male-sterile rice lines, providing a gene resource reserve to solve the problem of the scarcity of practical male-sterile gene resources in two-line hybrid rice in my country. It is of great significance for solving the risks of two-line hybrid rice seed production and enriching the types of practical male-sterile resources. Beneficial effects

[0018] In summary, the advantages and positive effects of this invention are as follows: This invention organically combines molecular marker technology from modern molecular biology with various selection techniques in traditional crop genetics and breeding, such as hybridization, backcrossing, and testcrossing, providing a fast, accurate, and predictable practical method for breeding new crop varieties and creating new materials. This invention uses markers carrying HMS10... RS The temperature-sensitive male sterile line resource Yannong S (YnS) and the HMS10 carrier HB Normal fertile material YnHB (Yenong HB) was hybridized and backcrossed. Individual plants exhibiting extreme male sterility at both high and low temperatures in a large backcross population of high generations were isolated from the ~51 kb physical region of rice chromosome 10 and cloned to the HMS10 locus, which controls heterozygous male sterility in rice derived from YnS. RS Through molecular breeding strategies, HMS10 RS The application of this site in the breeding of hybrid male-sterile rice lines is of great significance for solving the risks of two-line hybrid rice seed production and enriching the types of practical male-sterile resources. Attached Figure Description

[0019] Figure 1 Heterozygous male sterility locus HMS10 RS Fine-grained localization regions and candidate gene prediction.

[0020] Figure 2 ORF1 RS and ORF2RS Expression of YnS and YnHS materials at different pollen development stages.

[0021] Figure 3 HMS10 RS ORF1 contained in the site RS and ORF2 RS Gene structure. Black squares represent exons, lines between black squares represent introns, gray squares represent untranslated regions (UTRs), and gray arrows represent the direction of gene transcription.

[0022] Figure 4 ORF1 RS The full-length complementary vector map of the genome (LWP002).

[0023] Figure 5 ORF2 RS The full-length complementary vector map of the genome (LWP048).

[0024] Figure 6 ORF1 RS Fusion ORF2 RS (ORF1 RS +ORF2 RS The full-length complementary vector map of the genome (LWP049).

[0025] Figure 7 YnS, YnHB, and ORF1 were measured under the following conditions: short-day low temperature in Lingshui (sampling time: March 18, 2025, with an average daily temperature of approximately 23°C during the sensitive period) and long-day high temperature in Hefei (sampling time: August 10, 2024, with an average daily temperature of approximately 31°C during the sensitive period). RS ORF2 RS With ORF1 RS +ORF2 RS Pollen fertility expression of transgenic plants with full-length genome complementation. ORF1 RS -YnHB indicates ORF1 RS Transformed into YnHB, ORF2 RS -YnHB indicates that ORF2 will be used. RS Transformed into YnHB, ORF1 RS +ORF2 RS -YnHB indicates that ORF1 will be used. RS +ORF2 RS Transformed into YnHB, Bars=100 μm. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0027] This invention isolated and cloned a complete coding DNA fragment of a site controlling heterozygous male sterility in rice from the thermosensitive male sterile line YnS, and named this site HMS10. RS The results were verified through transgenic genetic complementation. The nucleotide sequence constituting the site controlling heterozygous male sterility in rice involved in this invention has the base sequence shown in SEQ ID NO: 1 of the sequence listing. This site contains two transcripts. The nucleotide sequences of the DNA molecules of transcript 1 and transcript 2 have the nucleotide sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3 of the sequence listing, respectively. The DNA molecule sequences of the coding regions of transcript 1 and transcript 2 have the nucleotide sequences shown in SEQ ID NO: 4 and NO: 5, respectively. The DNA molecules encode two proteins, and the two proteins have the amino acid sequences shown in SEQ ID NO: 6 and NO: 7 of the sequence listing, respectively. This invention discloses the isolation, cloning, and application of the rice heterozygous male sterility site HMS10, as shown in the following embodiments.

[0028] Example 1 Heterozygous male sterility locus HMS10 RS Fine mapping and candidate gene prediction To identify the locus controlling heterozygous male sterility in rice, the inventors' team used a BC1F1 population constructed from YnS and YnHB (backcross paternal parent) to identify a major locus controlling the HMS trait, HMS10, on chromosome 10. This locus is located within a ~51 kb physical region between markers Y13196 (primer sequences shown in Table 1) and Y13247 (primer sequences shown in Table 1). Transcriptome sequencing results showed that the HMS10 haplotype derived from YnS is HMS10. RS It contains two transcripts expressed at different stages of pollen development (S6-S10) in both YnS and the heterozygous male-sterile line YnHS (F1 of the cross between YnS and YnHB), namely ORF1. RS and ORF2 RS These two transcripts are closely adjacent in physical location in the genome. Figure 1 and Figure 2 ORF1 RS It has 7 exons and 6 introns, encoding an unknown expressed protein consisting of 395 amino acids; ORF1 RSIt has 5 exons and 4 introns, encoding an unknown expressed protein consisting of 145 amino acids. Figure 3 ).

[0029] Table 1. Primer sequences for HMS10 fine mapping

[0030] Example 2: Functional complementation experiment and application of the heterozygous male sterility locus HMS10 To verify ORF1 RS and ORF2 RS Biological functions, respectively constructing ORF1 RS ORF2 RS and ORF1 RS Fusion ORF2 RS (i.e., ORF1) RS +ORF2 RS Transgenic genetic complementation was verified using a full-length genome complementation vector of YnS. Using YnS genomic DNA as a template, ORF1 was amplified using primer pairs LW023 and LW002, LW081 and LW078, and LW112 and LW113, respectively. RS (6.4 kb), ORF2 RS (5.9 kb) and ORF1 RS +ORF2 RS The full-length genome sequence (11.6 kb) was ligated into the pCAMBIA1300 vector, which was double-digested with Xba I and Sal I, using the Gibson Assembly method. After transformation into DH5α competent cells, positive clones were selected for sequencing. Once the sequence was verified, the ORF1 assay was completed. RS (Plasmid ID LWP002), ORF2 RS (Plasmid ID LWP048) and ORF1 RS +ORF2 RS Construction of the full-length genome complementation vector (plasmid number LWP049). Primers used for vector construction in this invention are shown in Table 2. In this invention, ORF1... RS ORF2 RS and ORF1 RS +ORF2 RS The full-length genome complementation vector maps are as follows: Figure 4 , Figure 5 and Figure 6 As shown.

[0031] Table 2 ORF1 RS ORF2 RS and ORF1 RS +ORF2 RSPrimers for constructing full-length genome vectors LW023 <![CDATA[ggagcatctggatcc tctaga GTAGTCAATAGCCCGCAACATAC]]> <![CDATA[For ORF1 RS Construction of full-length genomic vector]]> SEQ ID NO:12 LW002 acgacggccagtgccaagcttGGCAAACGAATGGGATGATA <![CDATA[For ORF1 RS Full-length genomic vector construction]]> SEQ ID NO:13 LW081 ggagcatctggatcctctagaAAGCACGCGGGAGAAGCTAGCTCCCATTG <![CDATA[For ORF2 RS Full-length genomic vector construction]]> SEQ ID NO:14 LW078 acgacggccagtgccaagcttCTATATGCATTTAGTTGACAAAAGAAATC <![CDATA[For ORF2 RS Construction of full-length genomic vector]]> SEQ ID NO:15 LW112 ggagcatctggatcctctagaGTAGTCAATAGCCCGCAACATACCCGCATG <![CDATA[For ORF1 RS + ORF2 RS Full-length genomic vector construction]]> SEQ ID NO:16 LW113 cttgtaatctcccatgtcgacAAGCACGCGGGAGAAGCTAGCTCCCATTG <![CDATA[For ORF1 RS +ORF2 RS Full-length genomic vector construction]]> SEQ ID NO:17 Plasmids with correct sequencing were selected and transformed into Agrobacterium EHA105 strain to infect YnHB callus tissue, obtaining transgenic positive single plants. Under short-day low-temperature conditions in Lingshui, Hainan (sampling time March 18, 2025, average daily temperature during the sensitive period around 23°C), YnS pollen was irregularly shaped and could not be stained with iodine, indicating male sterility, while YnHB pollen was regularly round and stained black with iodine, indicating male fertility; the ORF1 in the YnHB background... RS Transgenic positive lines (i.e., ORF1) RS -YnHB) and ORF2 RS Transgenic positive lines (i.e., ORF2) RS -YnHB) pollen is unstainable, exhibiting a sterile phenotype. Figure 7 ). ORF1 with YnHB background RS Fusion ORF2 RS Transgenic positive lines (i.e., ORF1) RS +ORF2 RS -YnHB) Pollen abortion, pollen is irregular in shape, cannot be stained with iodine, and manifests as male sterility. Figure 7 Under the long-day high-temperature conditions in Hefei (sampling time August 10, 2024, with an average daily temperature of around 31°C during the sensitive period), the pollen of YnS and YnHB flowers stained black with iodine, indicating male fertility. (ORF1) RS -YnHB strain and ORF2 RS -YnHB all showed male fertility, while ORF1 RS +ORF2 RS The YnHB strain exhibits pollen abortion, with irregularly shaped pollen that fails to stain with iodine, demonstrating male sterility. Figure 7 ).

[0032] Based on the above results, the transgenic genetic complementation experiment shows that ORF1 RS and ORF2 RS When co-introduced into a YnHB background, positive plants exhibited a phenotype of sterility at both high and low temperatures, i.e., a heterozygous male sterility phenotype; indicating that ORF1 RS and ORF2 RS Together they participate in regulating the heterozygous male sterility trait. HMS10 RS The site was directly transferred into a transgenic site carrying HMS10 through genetic engineering techniques. HB Heterozygous male sterile line materials can be obtained from genotype-specific heterozygous male sterile line resources (including but not limited to thermosensitive male sterile lines such as 1892S, Y58S, P88S and Quan 211S, as well as fertile resources such as 1892F and Nipponbare and similar materials derived therefrom).

[0033] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. A DNA molecule, HMS10, controlling hybrid male sterility in rice RS characterized in that, The DNA molecule HMS10 RS ORF1 as shown in nucleotide sequence SEQ ID NO: 2 RS and ORF2 as shown in nucleotide sequence SEQ ID NO: 3 RS consisting of.

2. The DNA molecule HMS10 for controlling hybrid male sterility of rice according to claim 1 RS characterized in that, The nucleotide sequence of the coding region of ORF1 RS and ORF2 RS are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

3. The DNA molecule HMS10 for hybrid male sterility in rice as claimed in claim 2 RS characterized in that, The ORF1 RS The amino acid sequence of the encoded protein is set forth in SEQ ID NO: 6, the ORF2 RS The amino acid sequence of the encoded protein is set forth in SEQ ID NO:

7.

4. A recombinant vector, characterized in that, The vector comprises the DNA molecule HMS10 according to any one of claims 1 to 2 RS .

5. An Agrobacterium characterized in that, The Agrobacterium carries the recombinant vector of claim 4.

6. A method of creating a hybrid male sterile rice, characterized by, The method includes using transgenic or gene-editing methods to introduce the DNA molecule HMS10 according to any one of claims 1-2. RS Introduced into rice to obtain HMS10 carrying the DNA molecule. RS The rice strain, and the HMS10 carrying the DNA molecule. RS Rice varieties directly related to those carrying HMS10 HB Steps for creating heterozygous male-sterile lines through sexual hybridization of the HB rice cultivar, a heterozygous male-sterile maintainer line.

7. A method of creating a hybrid male sterile rice, characterized by, The method comprises introducing the DNA molecule HMS10 according to claims 1-2 RS or the recombinant vector according to claim 4 into a hybrid male sterile maintainer line HB rice line carrying the HMS10 HB gene.

8. A method of creating a hybrid male sterile rice, characterized by, The method includes carrying HMS10 HB The step of contacting plant cells or plant tissues of the HB rice variety, a heterozygous male-sterile maintainer line, with the Agrobacterium described in claim 5.

9. The DNA molecule HMS10 for controlling hybrid male sterility of rice according to any one of claims 1 to 3 RS , the use of the recombinant vector according to claim 4 or the agrobacterium according to claim 5 for creating hybrid male sterile rice.