A dCAPS marker for detecting oil content of soybean germplasm and a detection method
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JILIN ACAD OF AGRI SCI
- Filing Date
- 2025-09-12
- Publication Date
- 2026-07-21
Smart Images

Figure CN121046569B_ABST
Abstract
Description
Technical Field
[0001] This invention provides a dCAPS marker and detection method for detecting the oil content of soybean germplasm, which relates to a molecular marker and identification method for detecting whether soybean breeding materials contain high or low oil content, and belongs to the field of crop molecular marker detection technology. Background Technology
[0002] Soybeans Glycine max Soybean is an important oilseed crop in global agriculture. As an important quantitative trait in soybean breeding, oil content is regulated by multiple genes. At the same time, the level of oil content is also affected by climatic factors such as light and humidity. Improving soybean oil content is one of the main goals of current soybean breeding.
[0003] Currently, various molecular biology techniques have been used to locate and discover multiple sites and genes related to oil content in soybeans. WRINKLED1 (WRI1) encodes a transcription factor of the APETALA2 / ethylene response element binding protein (AP2 / EREBP) family, which plays an important role in the accumulation of plant seed oil. GmWRI1a It can positively regulate oil accumulation in soybean seeds (Chen et al., 2018; Wang et al., 2022). Multilocus genome-wide association analysis identified candidate genes located within the quantitative trait nucleotide (QTN) region of soybean seed oil / protein content. Glyma.18G027100 (Zhang et al., 2018). GmST1 This relates to the relationship between seed morphology and oil content (Li et al., 2022). GmSWEET39 Natural variations may lead to differences in oil content among different soybean varieties, which may be a regulatory factor in the soybean oil synthesis pathway (Miao et al., 2020). GmMFT In soybeans, the synthesis of oil and protein in the seeds is affected by regulating related metabolic processes (Duan et al., 2022). FA9 It participates in regulating the biosynthetic pathway of soybean, affecting the synthesis and accumulation of fatty acids and proteins (Qi et al., 2024). GmFATA1B It is a QTL gene that regulates the oil content and composition of soybean seeds as well as seed size (Cai et al., 2023). POWR1 A major protein and lipid QTL were formed at Chr.20. The loss of TE in the conserved CCT domain resulted in a decrease in lipid content (Goettel et al., 2022).
[0004] Soybeans, generally referring to yellow soybeans, typically have an oil content, or crude fat content, ranging from 16% to 24%. Soybeans with a crude fat content exceeding 22% are classified as high-oil soybeans in variety approval. There are many methods for detecting oil content, such as Soxhlet extraction using organic solvents (Chen et al., 2024), which is a complex process. Rapid identification of oil content can be achieved using near-infrared spectroscopy (Chen Yue, 2018), which requires specialized instruments and equipment and is therefore costly. Summary of the Invention
[0005] This invention provides a dCAPS marker and detection method for detecting the oil content of soybean germplasm. The dCAPS marker and detection method dCAPS13-1, derived from SNP1, is used to detect whether soybean germplasm contains high or low oil content, and realizes rapid detection of soybean varieties and germplasm resources containing soybean oil-related genes.
[0006] This invention provides a dCAPS marker and detection method for detecting the oil content of soybean germplasm. The solution is as follows: Extracting genomic DNA from soybeans: The partial flanking sequence corresponding to SNP1 is as follows: High-oil varieties: CGCATGGTTTCCTTCAACTGAATGATAACCCGTATGTTGCAAATACTAGCGTTTTGTGAGC; Low-oil varieties: CGCATGGTTTCCTTCAACTGAATGATAACTCGTATGTTGCAAATACTAGCGTTTTGTGAGC; Detection of the soybean genome using dCAPS markers: A pair of primers was designed to amplify SNP1 using flanking sequences, resulting in the marker dCAPS13-1. The primer sequences for PCR amplification using dCAPS13-1 are as follows: Upstream primer sequence: 5'-TGATGTAAACTAATCCAGAGTTGTCCCTCC-3'; Downstream primer sequence: 5'-GCTCACAAACGCTAGTATTTGCAACATTCG-3'; (3) The length of the amplified PCR product is consistent in both high-oil and low-oil soybean materials. The PCR product is digested with restriction endonuclease, and the digested product is subjected to agarose gel electrophoresis. The different lengths of the bands are used to accurately distinguish whether the material is high-oil or low-oil. The characteristics of the corresponding PCR amplification primer size, the corresponding restriction endonuclease, and the size of the digested fragment are as follows: The PCR amplification product corresponding to dCAPS13-1 labeled with dCAPS was 286 bp. The PCR product was processed using restriction endonucleases. Taq I. Enzyme digestion: The enzyme digestion fragment of soybean germplasm containing the high-oil gene was 286 bp in length, while the enzyme digestion fragment of soybean germplasm without the high-oil gene was 257 bp and 29 bp in length, respectively.
[0007] This invention provides a method for detecting dCAPS markers in soybean germplasm oil content, specifically comprising the following steps: (1) Genomic DNA was extracted from soybean tissue using the CTAB method and used as a template for PCR amplification. (2) PCR amplification was performed using the following system: 12.5 μL of 2×Es Taq Master mix, 1 μL each of the upstream and downstream primers, 1 μL of soybean DNA, and 9.5 μL of ddH2O. The PCR reaction program was: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles; followed by a 72℃ extension for 2 min. The PCR products were detected by 1% agarose gel electrophoresis, and the band size was recorded. This PCR product was used as a template for enzyme digestion. (3) Perform enzyme digestion on the PCR product; The enzyme digestion system corresponding to dCAPS-labeled Caps13-1 was as follows: 1 μL of... Taq Ⅰ; Add 1 μL of 10 times the amount Taq I. Buffer, 1 μL of 0.1% BSA (bovine serum albumin, BSA) solution, 3.5 μL of PCR product, and 4 μL of ddH2O water. The enzyme digestion reaction program was 65℃ for 60 min. (4) The enzyme digestion products were detected by 2% agarose gel electrophoresis, and the band size was imaged and recorded. The oil content of soybean materials was accurately distinguished by obtaining bands of different numbers and lengths.
[0008] The positive effects of this invention are as follows:
[0009] This invention provides the Caps13-1 molecular marker, derived from SNP1 and derived from dCAPS, enabling immediate extraction of soybean tissue DNA for detection. This avoids the need for traditional methods, which require field planting, harvesting a certain amount of seeds at maturity, and using costly biochemical methods to determine high-oil content over a full growth cycle. This invention can also be used to assist in the molecular marker-assisted breeding of superior varieties or offspring of high-oil genes, shortening the breeding time for high-oil materials and accelerating the selection of high-oil soybean varieties. The detection is rapid and time-efficient; from soybean tissue DNA extraction to enzyme digestion and electrophoresis, it can be completed within one working day. Because the enzyme digestion bands are clearly distinguishable, they can be observed and identified under UV or blue light using agarose gel electrophoresis, resulting in accurate and reliable results. The instruments and reagents used are readily available in conventional molecular biology laboratories. The detection process is simple and can be performed by ordinary laboratory technicians. Attached Figure Description
[0010] Figure 1 This is an agarose gel electrophoresis image of single-plant DNA from eight soybean genotypes used to detect oil content using dCAPS13-1 labeling in Example 1 of this invention (M: 100bp ladder, 1-8 are JLCMS299B, JLCMS322B, JLCMS295B, JLR97, Suzumaru, JLCMS118B, JLR148, JLR370, respectively). a is an electrophoresis image of the PCR product of dCAPS13-1; b is an electrophoresis image of the PCR product of dCAPS13-1. Taq (I) Enzyme digestion electrophoresis diagram); Figure 2 This is an agarose gel electrophoresis image of single-plant DNA from 23 introduced germplasm resources used to detect oil content using dCAPS13-1 labeling in Example 2 of this invention (M: 20bp ladder, 1-23 are the soybean materials corresponding to lanes 1-23 in Table 1 of the specification, a is the electrophoresis image of dCAPS13-1 PCR product; b is the electrophoresis image of dCAPS13-1 PCR product). Taq (I) Enzyme digestion electrophoresis diagram. Detailed Implementation
[0011] The present invention is further illustrated by the following embodiments, which are not intended to limit the invention in any way. Any modifications or alterations made to the present invention that are easily implemented by those skilled in the art without departing from the technical solutions of the present invention shall fall within the scope of the claims of the present invention. Example 1
[0012] I. Molecular Marker Development Based on a combined analysis of oil content measurements and high-throughput sequencing results from multiple soybean samples over several years, a SNP locus closely related to oil content was identified, located at locus 32521024 (Wm82.v6) on soybean chromosome 13 (https: / / www.soybase.org), specifically SNP1: The partial flanking sequence corresponding to SNP1 is as follows: High-oil varieties: CGCATGGTTTCCTTCAACTGAATGATAACCCGTATGTTGCAAATACTAGCGTTTTGTGAGC; Low-oil varieties: CGCATGGTTTCCTTCAACTGAATGATAACTCGTATGTTGCAAATACTAGCGTTTTGTGAGC; II. Molecular Marker Development The dCAPS marker dCAPS13-1 was designed based on SNP1; the PCR primer sequences involved are as follows: Upstream primer sequence: 5'-TGATGTAAACTAATCCAGAGTTGTCCCTCC-3'; Downstream primer sequence: 5'-GCTCACAAACGCTAGTATTTGCAACATTCG-3'; The expected PCR product size is 286 bp. The restriction enzymes involved in digestion are: Taq I. The length of the enzyme digestion fragment is 286 bp in the high-oil-content strain and 257 bp and 29 bp in the non-high-oil-content material; III. Molecular Marker Validation 1. Extract genomic DNA from soybean plants DNA was extracted from soybean leaves or seeds using the CTAB method. The detailed steps are as follows: 1) Take about 100 mg of soybean tissue, put it into a centrifuge tube, add liquid nitrogen and grind it thoroughly; 2) Add 600 µl of CTAB extraction buffer and 3 µl of RNase A solution (10 mg / ml) to the centrifuge tube containing the collected powder, incubate at 65°C for 60 min, shaking 3-5 times at intervals to ensure complete lysis; 3) Add an equal volume of chloroform / isoamyl alcohol and mix for 10 min; 4) Centrifuge at 12,000 rpm (~13,400×g) for 10 min, and transfer the supernatant to a new centrifuge tube; 5) Add an equal volume of anhydrous ethanol to the supernatant, mix thoroughly, and let stand for 20 minutes; 6) Centrifuge at 12000 rpm (~13,400×g) for 10 min, and discard the supernatant; 7) Wash the precipitate with 70% ethanol, repeat once; 8) Dry the DNA precipitate and then dissolve it in TE buffer. After detection by 1% agarose gel electrophoresis, store the DNA at -20℃. 2. Amplification, enzyme digestion, and electrophoretic detection of dCAPS molecular markers 1) A PCR system with a total volume of 25 µl was prepared, including 12.5 μL of 2×Es Taq Master mix, 1 μL each of the upstream and downstream primers, 1 μL of soybean DNA, and 9.5 μL of ddH2O. The PCR reaction program was as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles; followed by a 72℃ extension for 2 min. The PCR products were detected by 1% agarose gel electrophoresis, and the band sizes were imaged and recorded. 2) Digest the PCR product with enzymes. The total digestion volume is 10 μL, with 0.5 μL of [unspecified ingredient] added. Taq Ⅰ; Add 1 μL of 10 times the amount Taq I. Buffer, 1 μL of 0.1% BSA, 3.5 μL of PCR product, and 4 μL of ddH2O water were added. The enzyme digestion reaction was incubated at 65℃ for 60 min, and then the enzyme digestion products were detected by 2% agarose gel electrophoresis, and the band sizes were recorded. 3. Results Analysis The dCAPS molecular marker was detected in the DNA of four high-oil and four low-oil soybean monoplants. The electrophoresis results are as follows: Figure 1 As shown: M: 100bp ladder, where 1-8 are soybean materials JLCMS299B, JLCMS322B, JLCMS295B, JLR97, Suzumaru, JLCMS118B, JLR148, and JLR370. Figure 1 a ( Figure 1 a) is an electrophoresis image of the PCR products of dCAPS13-1. Figure 1 b ( Figure 1 b) is an electrophoresis diagram of the PCR product of dCAPS13-1 after enzyme digestion.
[0013] Among them, the soybean PCR amplification products detected by dCAPS13-1 labeling showed a single band pattern in 2% agarose gel electrophoresis, namely a 286bp band: Figure 1a: 1-8 are JLCMS299B, JLCMS322B, JLCMS295B, JLR97, Suzumaru, JLCMS118B, JLR148, JLR370.
[0014] High-oil soybean PCR amplification products were subjected to Taq I. After enzyme digestion, electrophoresis showed one band pattern, namely a 286bp band: Figure 1 In b, 1-4 are high-oil genotypes with an oil content higher than 22.5%: JLCMS299B, JLCMS322B, JLCMS295B, and JLR97. Low-oil soybean PCR amplification products were subjected to Taq I. After enzyme digestion, two band patterns were observed in electrophoresis: 257bp and 29bp. Figure 1 In b, 5-8 are low-oil genotypes with an oil content of less than 20%, namely Suzumaru, JLCMS118B, JLR148, and JLR370.
[0015] Conclusion: The dCAPS13-1 marker detection derived from SNP1 can accurately distinguish between high-oil and low-oil soybean materials, enabling rapid detection of soybean varieties and germplasm resources containing soybean oil-related genes. It allows for the extraction of soybean tissue DNA for detection at any time, avoiding the need for traditional methods that require field planting, harvesting a certain amount of seeds at maturity, and using traditional, costly biochemical methods to determine whether a line is high-oil, which takes one growth cycle. This invention can also be used to assist in the molecular marker-assisted breeding of superior varieties or germplasm resources with introduced high-oil genes, shortening the breeding time of high-oil materials and accelerating the breeding of high-oil soybean varieties. Example 2
[0016] I. DNA Extraction from Introduced Varieties and Germplasm Resources Using 23 introduced varieties and germplasm resources as materials (see Table 1), total genomic DNA of soybean was extracted using the CTAB method. The specific extraction steps were the same as in Example 1. Table 1: 23 soybean germplasm resources
[0017] Amplification, enzyme digestion, and electrophoresis of SNP1-derived dCAPS molecular markers 1. A PCR system with a total volume of 25 µl was prepared, containing 12.5 µL of 2×Es Taq Master mix, 1 µL each of the upstream and downstream primers, 1 µL of soybean DNA, and 9.5 µL of ddH2O. The PCR reaction program was as follows: 94 °C pre-denaturation for 2 min; 94 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 30 s, for a total of 35 cycles; followed by a final extension at 72 °C for 2 min. The PCR products were detected by 1% agarose gel electrophoresis, and the band sizes were recorded. 2. Digest the PCR product with enzymes. The total digestion volume is 10 μL, with 0.5 μL of [unspecified ingredient] added. Taq Ⅰ; Add 1 μL of 10 times the amount Taq I buffer, 1 μL of 0.1% BSA buffer, 3.5 μL of PCR product, and 4 μL of ddH2O water were added. The enzyme digestion reaction program was to incubate at 65℃ for 60 min, and then the enzyme digestion products were detected by 2% agarose gel electrophoresis, and the band size was recorded. 3. Detection of materials containing high oil content The PCR products amplified by dCAPS13-1 labeling were all 286 bp in size; Figure 2 a ( Figure 2 a) is an electrophoresis diagram of the PCR product of dCAPS13-1, M: 20bp ladder, 1-23 are the PCR amplification products of different soybean plants, and their order corresponds to lane codes 1-23 in Table 1. Figure 2 b ( Figure 2 b) is an electrophoresis diagram of the PCR product of dCAPS13-1 after enzyme digestion. M: 20bp ladder, 1-23 are PCR products of different single strains after enzyme digestion. Taq I. Enzyme digestion, the order of which corresponds to lane codes 1-23 in Table 1: The PCR primer sequences involved in dCAPS13-1 are as follows: Upstream primer sequence: 5'-TGATGTAAACTAATCCAGAGTTGTCCCTCC-3'; Downstream primer sequence: 5'-GCTCACAAACGCTAGTATTTGCAACATTCG-3'; Electrophoresis images of the enzyme digestion products show: Figure 2 b is the electrophoresis diagram of the PCR product of dCAPS13-1 after enzyme digestion. M: 20bp ladder. 1-23 are the PCR products of different single strains after enzyme digestion and electrophoresis. TaqI. Enzyme digestion, with the sequence corresponding to lanes 1-23 in Table 1. Five materials, JLCMS330B, JLCMS34B, JLR470, JLR491, and JLCMS363B, showed a 286 bp electrophoretic band, confirming them as high-oil materials through molecular marker verification. The other 18 materials showed two electrophoretic bands, 257 bp and 29 bp, respectively, confirming them as low-oil materials through molecular marker verification.
[0018] 4. Screening and verification of high-oil germplasm materials Based on the detection of the dCAPS13-1 marker, soybean germplasms JLCMS330B, JLCMS34B, JLR470, JLR491, and JLCMS363B in Table 1 are high-oil materials. The seed oil content of these five lines was determined to be above 23% by a near-infrared spectrometer (DA7200 manufactured by Perten), and they belong to high-oil lines. The seed oil content of the other 18 germplasms was determined to be below 21% by a near-infrared spectrometer (DA7200 manufactured by Perten), and they belong to low-oil lines.
[0019] Conclusion: The dCAPS13-1 marker described in this invention can accurately distinguish whether a soybean germplasm material is a high-oil material.
Claims
1. The application of a dCAPS molecular marker in the detection of oil content in soybean germplasm, comprising the following steps: (1) Genomic DNA was extracted from soybean tissue and used as a template for PCR amplification; (2) Perform PCR amplification in the following system: 12.5 μL of 2×Es Taq Master mix; the primer sequences for PCR amplification of the dCAPS molecular marker are as follows: Upstream primer sequence: 5'-TGATGTAAACTAATCCAGAGTTGTCCCTCC-3', Downstream primer sequence: 5'-GCTCACAAACGCTAGTATTTGCAACATTCG-3'; Add 1 μL each of the upstream and downstream primers, 1 μL of soybean DNA, and 9.5 μL of ddH2O. The PCR reaction program is as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; then extend at 72℃ for 2 min. Detect the PCR product by 1% agarose gel electrophoresis, image and record the band size. This PCR product is used as a template for enzyme digestion. (3) Perform enzyme digestion of PCR products: The enzyme digestion system is as follows: add 1 μL of Taq I; add 1 μL of 10-fold Taq I buffer, 1 μL of 0.1% BSA solution, 3.5 μL of PCR product, and add 4 μL of ddH2O water; the enzyme digestion reaction program is to incubate at 65℃ for 60 min. (4) The enzyme digestion products were detected by 2% agarose gel electrophoresis, and the band number and size were imaged and recorded; the different number and length of the bands were obtained to accurately distinguish the high and low oil content of soybean materials; the endonuclease involved in the enzyme digestion was Taq I, and the length of the enzyme digestion fragment was 286 bp in the high oil-containing lines and 257 bp and 29 bp in the materials without high oil.