An siRNA targeting asgr1, delivery system and use thereof

Abstract

The application discloses an siRNA targeting ASGR1, a delivery system and application thereof. The siRNA is designed and screened specifically for an ASGR1 target, and can efficiently silence ASGR1 gene expression. Meanwhile, the application constructs a corresponding lipid nanoparticle (LNP) for siRNA delivery, which innovatively uses a bile acid part to replace a cholesterol component in a conventional LNP. Compared with a conventional LNP, the modification significantly improves the delivery efficiency of the siRNA, and obviously enhances the uptake capacity of hepatocytes for the nanoparticles, and finally can effectively improve liver lipid deposition.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an siRNA targeting ASGR1, its delivery system, and its applications. Background Technology

[0002] Metabolic fatty liver disease (MAFLD) has become the leading chronic liver disease globally, with a prevalence exceeding 25%. It significantly increases the risk of cardiovascular events and metabolic complications, resulting in a heavy socioeconomic burden. International guidelines recommend lifestyle interventions (dietary control and exercise) as the foundation of treatment, but patient adherence is less than 30%, thus pharmacological intervention remains a necessary means of MAFLD treatment. In the current landscape of MAFLD clinical drug development, small molecule compounds still dominate. Currently, only Resmetirom, targeting thyroid hormone receptor β (THR-β), was approved by the FDA in 2024 for the treatment of MASH patients with liver fibrosis. However, the traditional small molecule drug development model faces inherent limitations such as the undrugability of targets, insufficient affinity, short duration of action, poor targeting, and low biocompatibility. Small interfering RNA (siRNA) nucleic acid drugs can specifically silence disease-causing genes through RNA interference (RNAi) mechanisms. They offer advantages such as targeting "undruggable" targets, long-lasting effects, short development cycles, high targeting specificity, and broad therapeutic applications. Representing the third generation of revolutionary therapies after small molecule drugs and antibody drugs, siRNAs have played a crucial role in research on a range of diseases, including genetic diseases, cancer immunotherapy, and cardiovascular diseases. As early as 2018, LNP-mediated siRNA therapy received clinical approval for the treatment of transthyretin-mediated amyloidosis.

[0003] Lipid nanoparticle-based delivery systems have made breakthroughs in overcoming bottlenecks such as enzymatic degradation and renal clearance of siRNA. Furthermore, the surface of the LNP delivery system can adsorb and form an ApoE protein crown, giving it a high degree of targeting to liver tissue and enabling specific delivery of nucleic acid drugs to the liver. Therefore, LNP delivery systems have a natural advantage for the treatment of MAFLD. However, further application of LNP delivery systems in MAFLD also faces some challenges. Although the liver is considered a relatively accessible organ for LNPs in healthy patients, studies have reported that in the pathological state of MAFLD & MASH, metabolic dysfunction leads to steatosis and excessive extracellular matrix (ECM) production. The resulting liver fibrosis often manifests as capillary vascularization and door closure, forming a physical barrier that restricts drug delivery to the liver. Therefore, developing new siRNA delivery systems that can efficiently target the liver to replace traditional LNPs is crucial for the treatment of liver diseases. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes a siRNA that inhibits ASGR1 gene expression.

[0005] The present invention also proposes an siRNA delivery system.

[0006] The present invention also proposes a composition.

[0007] The present invention also proposes a drug or reagent kit.

[0008] The present invention also proposes the use of the above-described siRNA, the above-described delivery system, the above-described drug or kit, or the above-described composition in the treatment of metabolic fatty liver disease.

[0009] According to a first aspect of the present invention, a siRNA for inhibiting ASGR1 gene expression is provided, said siRNA being any one of the following A1)-A3):

[0010] A1) A siRNA consisting of the sense strand RNA shown in SEQ ID NO:1 and the antisense strand RNA shown in SEQ ID NO:2;

[0011] A2) A siRNA consisting of the sense strand RNA shown in SEQ ID NO:3 and the antisense strand RNA shown in SEQ ID NO:4;

[0012] A3) siRNA consisting of the sense strand RNA shown in SEQ ID NO:7 and the antisense strand RNA shown in SEQ ID NO:8.

[0013] In some embodiments of the present invention, the 3' end of the positive strand RNA sequence also contains two dTs.

[0014] In some embodiments of the present invention, the 3' end of the antisense RNA sequence further contains two dTs.

[0015] In some embodiments of the present invention, the siRNA further includes modified siRNA obtained by modifying the siRNA backbone, glycan rings and / or bases.

[0016] In some embodiments of the present invention, the backbone modification includes, but is not limited to, thio-modification and / or amino-modification of the phosphate backbone of the sense and antisense strands of siRNA.

[0017] In some embodiments of the present invention, the sugar ring modification includes, but is not limited to: replacing the 2″-OH in the nucleotide with methoxy, methylethoxy and / or fluorine, or deoxygenating the 2′-OH in the nucleotide; or modifying the nucleotide in the siRNA to a peptide nucleic acid type, a locked nucleic acid type or an unlocked nucleic acid type.

[0018] In some embodiments of the present invention, the base modification includes, but is not limited to, base modification or substitution of 5-methylcytosine, 6-methyladenine, ribavirin, pseudouracil and / or inosine of nucleoside bases.

[0019] In some embodiments of the present invention, the siRNA is conjugated with cholesterol at its 3' end.

[0020] According to a second aspect of the present invention, an siRNA delivery system is provided, the delivery system comprising the self-assembly of an organic phase and an aqueous phase of the aforementioned siRNA into lipid nanoparticles via microfluidic processing; the organic phase comprising bile acids (BAs). Since bile acids and cholesterol share steroidal ring backbone homology, similar chemical structures, and similar physicochemical properties, the addition of bile acids to the organic phase can maintain the stability of LNPs and their siRNA loading capacity; bile acids possess liver-specific receptors, which can enhance hepatocyte uptake by activating farnesol X receptor 9 (FXR) and G protein-coupled bile acid receptor 5 (TGR5, also known as GPBAR1). FXR is mainly activated by primary bile acids and is highly expressed in the liver; while TGR5 is mainly activated by secondary bile acids and is expressed in Kupffer cells and endothelial cells in liver tissue. In some embodiments of the present invention, the delivery system further includes fluorescent labeling.

[0021] In some embodiments of the present invention, the fluorescent marker includes a Cy5 fluorescent marker.

[0022] In some embodiments of the present invention, the bile acid includes one of primary bile acids, secondary bile acids, and semi-synthetic bile acids.

[0023] In some embodiments of the present invention, the primary bile acids include cholic acid and chenodeoxycholic acid.

[0024] In some embodiments of the present invention, the secondary bile acids include lithocholic acid, ursodeoxycholic acid, deoxycholic acid, porcine deoxycholic acid, and tauroursodeoxycholic acid.

[0025] In some embodiments of the present invention, the semi-synthetic bile acid includes obeticholic acid.

[0026] In some embodiments of the present invention, the organic phase further includes ionizable lipids, cholesterol, cofactor phospholipids, and polyethylene glycol lipid molecules.

[0027] In some embodiments of the present invention, the ionizable lipid contains one or more ionizable sites, including but not limited to primary amines, secondary amines, tertiary amines, and quaternary amines.

[0028] In some embodiments of the present invention, the ionizable lipids include one or more of DLin-MC3-DMA, 5A2-SC8, SM-102, C12-200, ALC-0315, DODAP, and DODMA.

[0029] In some embodiments of the present invention, the polyethylene glycol lipid molecules include, but are not limited to: ALC-0159, DSPE-PEG2000, and DMG-PEG2000.

[0030] In some embodiments of the present invention, the auxiliary phospholipids include neutral auxiliary phospholipids.

[0031] In some embodiments of the present invention, the neutral auxiliary phospholipids include, but are not limited to, 1,2-distearyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-palmitoyl-sn-glycerol-3-phosphate ethanolamine (DPPE), 1,2-dimyristoyl-sn-glycerol-3-phosphate ethanolamine (DMPE), 2-dioleoyl-sn-glycerol-3-phosphate-(1'-rac-glycerol) (DOPG), oleoylphosphatidylcholine (POPC), and 1-palmitoyl-2-oleoylphosphatidylethanolamine (POPE).

[0032] In some embodiments of the present invention, the molar ratio of the mixture of ionizable lipids, cholesterol and bile acids, auxiliary phospholipids and polyethylene glycol lipid molecules added in the organic phase is (48-52):(35-40):(8-12):(0.5-3).

[0033] In some embodiments of the present invention, the molar ratio of the addition of ionizable lipids, a mixture of cholesterol and bile acids, auxiliary phospholipids, and polyethylene glycol lipid molecules in the organic phase is (49-51):(36-40):(9-11):(1-2).

[0034] In some embodiments of the present invention, the molar ratio of the mixture of ionizable lipids, cholesterol and bile acids, auxiliary phospholipids and polyethylene glycol lipid molecules added in the organic phase is 50:38.5:10:1.5.

[0035] In some embodiments of the present invention, the bile acid has a molar percentage of 0-50% in the mixture of cholesterol and bile acids.

[0036] In some embodiments of the present invention, the bile acid comprises 25-50% of the mixture of cholesterol and bile acids.

[0037] In some embodiments of the present invention, the molar percentage of bile acids in the mixture of cholesterol and bile acids is 25-35%; specifically, it can be 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35%.

[0038] In some embodiments of the present invention, the volume ratio of the organic phase to the aqueous phase is 1:(2-4).

[0039] In some embodiments of the present invention, the aqueous phase comprises a citrate buffer.

[0040] In some embodiments of the present invention, the nitrogen-to-phosphorus ratio of N in the ionizable lipids in the organic phase to P in the siRNA in the aqueous phase is (5-7):1.

[0041] In some embodiments of the present invention, the nitrogen-to-phosphorus ratio of N in the ionizable lipids in the organic phase to P in the siRNA in the aqueous phase is (5-6):1.

[0042] In some embodiments of the present invention, the nitrogen-to-phosphorus ratio of N in the ionizable lipids in the organic phase to P in the siRNA in the aqueous phase is 5.67:1.

[0043] According to a third aspect of the invention, a composition is provided comprising the above-described siRNA or delivery system.

[0044] According to a fourth aspect of the invention, a medicament or kit is provided, the medicament or kit comprising the above-described siRNA, the above-described delivery system, or the above-described composition.

[0045] In some embodiments of the present invention, the drug is a nucleic acid drug.

[0046] In some embodiments of the present invention, the medicament further includes pharmaceutically acceptable excipients.

[0047] In some embodiments of the present invention, the pharmaceutically acceptable excipients include, but are not limited to, carriers, diluents, binders, lubricants, wetting agents, etc.

[0048] In some embodiments of the present invention, the administration methods of the drug include, but are not limited to, oral administration, enteral administration, subcutaneous injection, intramuscular injection, intravenous injection, nasal administration, transdermal administration, subconjunctival administration, intraocular administration, orbital administration, retroocular administration, retinal administration, choroidal administration, intrathecal injection, etc.

[0049] In some embodiments of the present invention, the dosage forms of the drug include, but are not limited to, tablets, capsules, pills, injections, inhalers, lozenges, suppositories, emulsions, microemulsions, submicroemulsions, nanoparticles, gels, powders, suspensions, creams, gels, sprays, etc. The various dosage forms of the drug can be prepared according to conventional pharmaceutical manufacturing methods.

[0050] In some embodiments of the present invention, the mass content of the siRNA, delivery system or composition in the drug can be 1%-100%, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, 99.5, 100%.

[0051] According to a fourth aspect of the present invention, the use of the above-described siRNA, the above-described delivery system, the above-described pharmaceutical or reagent kit, or the above-described composition in any of the following is proposed:

[0052] B1) Prepare drugs for the prevention and / or treatment of diseases related to ASGR1 gene expression;

[0053] B2) Regulates the activity or expression level of the ASGR1 target.

[0054] In some embodiments of the present invention, regulating ASGR1 expression levels includes inhibiting ASGR1 gene expression.

[0055] In some embodiments of the present invention, the drug is used as follows: by using the above-described siRNA, the above-described delivery system, the above-described drug or kit, or the above-described composition to inhibit the ASGR1 target activity or reduce the ASGR1 expression level in the subject. Overactivation of the target ASGR1 drives a key pathological process in metabolic fatty liver disease. By inhibiting ASGR1 target activity, the pathological process of metabolic fatty liver disease can be intervened, thereby achieving the purpose of treating metabolic fatty liver disease.

[0056] In some embodiments of the present invention, the dosage of the drug is a dose that achieves a therapeutically effective amount.

[0057] In some embodiments of the present invention, the diseases associated with ASGR1 gene expression include metabolic dysfunction-associated fatty liver disease (MAFLD).

[0058] In some embodiments of the present invention, the metabolic-related fatty liver disease includes fatty liver disease associated with obesity-related fatty liver, fatty liver disease associated with hyperlipidemia-related fatty liver, fatty liver disease associated with diabetes-related fatty liver, fatty liver disease associated with atherosclerosis-related fatty liver, fatty liver disease associated with nutritional imbalance, and fatty liver disease associated with drug-induced fatty liver.

[0059] In some embodiments of the present invention, the drug for preventing and / or treating diseases related to ASGR1 gene expression has at least one of the following functions:

[0060] C1) Prevention and / or treatment of hepatic steatosis;

[0061] C2) Prevention of liver fibrosis and cirrhosis;

[0062] C3) Improves liver pathological condition;

[0063] C4) inhibits lipid deposition in the liver;

[0064] C5) Improves liver function;

[0065] C6) Reduces the burden of blood lipids.

[0066] According to some embodiments of the present invention, at least the following beneficial effects are achieved: The siRNA provided by the present invention, after specific design and screening targeting ASGR1, can efficiently silence ASGR1 gene expression. Simultaneously, the present invention also designs corresponding lipid nanoparticles (LNPs) for siRNA delivery, which innovatively use bile acids to partially replace the cholesterol component in traditional LNPs. Compared to conventional LNPs, this modification significantly improves the delivery efficiency of siRNA and markedly enhances the uptake capacity of nanoparticles by hepatocytes, ultimately effectively improving hepatic lipid deposition. Attached Figure Description

[0067] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0068] Figure 1 The figure shows the target knockdown efficiency detection results of different siRNA sequences in the embodiments of the present invention, where "*" means P < 0.05 and "**" means P < 0.01 (compared with the normal control group);

[0069] Figure 2 The figures shown are the particle size and encapsulation efficiency detection results of BA-LNPs with different proportions of bile acid doping in the embodiments of the present invention. In the figure, A is the LNP preparation process flow chart, B is the particle size detection result chart, C is the PDI detection result chart, D is the potential detection result chart, and E is the encapsulation efficiency detection result chart.

[0070] Figure 3 The above diagram shows the detection results of the uptake effect of HepG2 cells on BA-LNP with different proportions of bile acid in the embodiments of the present invention. In this diagram, A is the uptake flow cytometry detection result diagram and B is the quantitative flow cytometry uptake detection result diagram.

[0071] Figure 4 The figure shows the detection results of the knockdown effect of BA-LNP with different proportions of bile acid doping on ASGR1, the target of the HepG2 high-fat model, in the embodiments of the present invention. In the figure, "*" means P < 0.05 (compared with the traditional LNP group).

[0072] Figure 5 This is a graph showing the distribution detection results of the delivery system in the liver of C57 mice in an embodiment of the present invention;

[0073] Figure 6 The figures show the detection results of the role of ASGR1 target overactivation in the progression of metabolic fatty liver disease (MAFLD) and the role of ASGR1 target knockout in inhibiting the progression of MAFLD in embodiments of the present invention. A represents representative images of ASGR1 immunostaining in liver sections of CD (normal diet, C57 mice) and HFD (high-fat diet, i.e., MAFLD model) mice; B represents the detection results of the relative mRNA level of ASGR1 in the liver of the mice shown, determined by qPCR, where "**" indicates P < 0.01 (compared to CD group mice); C represents representative images of ASGR1 immunostaining in liver sections of normal and MAFLD patients. Representative images; D is a graph showing the FPKM values ​​of ASGR1 in the livers of normal and MAFLD patients using the GSE160016 data table; E is a graph showing the representative Western blot analysis results of ASGR1 in the livers of wild-type (WT) and ASGR1 knockout (ASGR1- / -) mice; FH is a graph showing the analysis of body weight (F), liver weight (G), and liver TG content (H) of WT or ASGR1- / - mice fed CD or HFD for 3 months, where "*" indicates P < 0.05 and "**" indicates P < 0.01 (compared to wild-type mice); I is a representative image of a specified mouse liver section stained with H&E or Oil Red O.

[0074] Figure 7The figures show the therapeutic effects of siASGR1@BA-LNP and siASGR1@LNP on a high-fat diet-induced mouse MAFLD model in this embodiment of the invention. In the figures, A is the animal experimental protocol, B is the mouse body weight change, C is the liver morphology, D is the liver mass change, E is the liver H&E pathological staining, F is the liver Oil Red staining, and G is the detection result of the relative area of ​​lipid deposition. In the figures, "**" means P < 0.01 and "****" means P < 0.0001 (compared to the model group).

[0075] Figure 8 The effects of siASGR1@BA-LNP and siASGR1@LNP on the expression of ASGR1 in the liver of a mouse MAFLD model induced by a high-fat diet are shown in the embodiments of the present invention, where "**" means P < 0.01 (compared with the model group).

[0076] Figure 9 This is a graph showing the biosafety test results of siASGR1@BA-LNP and siASGR1@LNP treatments in the embodiments of the present invention. Detailed Implementation

[0077] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0078] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0079] In the description of this invention, the use of terms such as first, second, third, etc., is only for the purpose of distinguishing technical features and should not be construed as indicating or implying relative importance, or implicitly indicating the number of technical features indicated, or implicitly indicating the order of the technical features indicated.

[0080] "And / or" is used to indicate that one or both of the described situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0081] All statistical analyses in the examples were performed in Graphpad Prism 7. Unless otherwise stated, all data are reported as ± standard deviation and performed in triplicate. For in vivo studies, there are at least three mice per group unless otherwise stated. Comparisons between two groups were performed using Student's t-test, with two-tailed criteria and significance determined when P < 0.05. For comparisons among multiple groups, significance was determined by one-way analysis of variance with post-hoc test.

[0082] Example 1 An siRNA targeting ASGR1

[0083] This example provides an siRNA targeting asialoglycoprotein receptor 1 (ASGR1), and the specific sequence design and verification process are as follows:

[0084] 1. Sequence design

[0085] The full-length ASGR1 sequence (Gene ID: 11889, Mus musculus (house mouse); Gene ID: 432, Homo sapiens (human)) and cDNA sequence were obtained from the NCBI gene database. Based on a method comprising a machine learning algorithm and a siRNA genome-wide biological reagent library, siRNA sequences that may have an inhibitory effect on ASGR1 expression were predicted. 1000 sequences meeting the requirements of matching degree and stability were obtained, and 4 siRNA sequences with the highest scores were screened through scoring for experimental verification. The specific sequences are shown in Table 1.

[0086] Table 1 Screening of siASGR1 sequences

[0087]

[0088] 2. Experimental verification

[0089] The cells at a density of 5×10 5HepG2 cell suspensions were seeded in 12-well plates and allowed to adhere overnight. The original culture medium was then discarded, and 100 nM of medium containing different siRNA sequences was added, along with the commercially available in vitro transfection reagent jetPrime. The cells were incubated for 24 hours. HepG2 cells with only the transfection reagent and no siRNA were used as a normal control group. After 24 hours of incubation, the culture medium was discarded, and the cells were washed twice with PBS. RNA was extracted using TRIZOL, and the RNA was reverse transcribed into cDNA (specific methods refer to the HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme) kit instructions). qPCR was then used for detection, and the primer sequences are shown in Table 2. The mRNA level at the ASGR1 site was measured, with GAPDH used as an internal reference gene.

[0090] The results are as follows Figure 1 As shown in the figure, siRNA1 has the best silencing effect. Therefore, siRNA1 was selected for subsequent experiments.

[0091] Table 2

[0092] ASGR1-F TGAGCACCCAGGGAAGTAGT(SEQ ID NO:9) ASGR1-R CCATTGCCCCGAAATGCAG(SEQ ID NO:10) GAPDH-F AGGTCGGTGTGAACGGATTTG(SEQ ID NO:11) GAPDH-R TGTAGACCATGTAGTTGAGGTCA(SEQ ID NO:12)

[0093] Example 2: A type of lipid nanoparticle for delivering siRNA

[0094] This embodiment provides a lipid nanoparticle (BA-LNP) for delivering siRNA. The preparation process is as follows: Figure 2 As shown in Figure A, the details are as follows:

[0095] 1. Synthesis method

[0096] 1) Material Library Design: To develop BA-LNPs containing bile acids, bile acids spanning three subclasses were screened: ① primary bile acids (synthesized by the liver, such as cholic acid and chenodeoxycholic acid) ② secondary bile acids (generated from primary bile acids in the intestine through bacterial enzyme modification, such as lithocholic acid, ursodeoxycholic acid, deoxycholic acid, porcine deoxycholic acid, and tauroursodeoxycholic acid) ③ semi-synthetic bile acids (obeticholic acid). BA-LNPs were prepared by replacing cholesterol with different subclasses of bile acids at molar ratios of 0%, 25%, 35%, 50%, 75%, and 100% of the bile acids. The 0% doped LNPs were the traditional LNPs. Porcine deoxycholic acid was obtained through screening and used for doping to prepare BA-LNPs.

[0097] 2) The ratio of each lipid is maintained as MC3:(cholesterol + bile acid):DSPC:polyethylene glycol phospholipids (DMG-PEG2000) = 50:38.5:10:1.5.

[0098] 3) Working solutions of MC3 cationic lipids, DSPC, cholesterol, bile acids, and polyethylene glycol phospholipids were dissolved in anhydrous ethanol and thoroughly mixed to form the organic phase. siRNA1 powder was dissolved in sodium citrate buffer (pH = 4, 0.05 M) to form the aqueous phase. The N:P ratio of the ionizable lipids in the organic phase to the phosphorus in the aqueous phase was 5.67:1. Subsequently, the two solutions (aqueous phase:organic phase v / v = 3:1) were mixed using a microfluidic device and dialyzed against 1×PBS buffer at pH 7.4 for 6 h. Afterward, the solutions were filtered through a 0.22 μm biofilter to prepare siASGR1@BA-LNP with different bile acid doping ratios, and stored at 4 °C.

[0099] 4) Synthesis of fluorescent nucleic acid drugs: Nanolipid nanoparticles loaded with cy5 fluorescently labeled siRNA (abbreviated as sicy5@LNP or sicy5@BA-LNP) were prepared using the same method as above, and bile acid-doped sicy5@BA-LNPs with different proportions were obtained.

[0100] 2. Characterization

[0101] 1) The size, zeta potential, and polydispersity index of hydrodynamic nanoparticles were measured by DLS using a Zetasizer Pro ZS (Malvern Panalytical).

[0102] 2) The encapsulation efficiency (EE%) of siRNA was assessed using the Quant-iT RiboGreen RNA Detection (Invitrogen) kit.

[0103] The results are as follows Figure 2 As shown in the figure, it can be seen that, compared with traditional LNP nanoparticles, BA-LNPs doped with different proportions of bile acids have a slightly smaller particle size when the proportion of HDCA replacing cholesterol is less than 100%. Figure 2 B), PDI and potential showed essentially no significant changes. Figure 2 CD), encapsulation efficiency had no significant impact. Figure 2 E) When bile acids completely replace cholesterol, the encapsulation efficiency decreases significantly and the PDI increases. This ratio is not suitable as a nucleic acid carrier.

[0104] Example 3: HepG2 cell uptake of BA-LNP with different proportions of bile acid doping

[0105] This embodiment verifies the effect of HepG2 cells on the uptake of BA-LNP with different proportions of bile acid doping.

[0106] Detection method: Sicy5@BA-LNPs doped with different proportions of bile acids (0%, 25%, 35%, 50%, 75%, and 100% porcine deoxycholic acid) prepared in Example 2 were used, with Sicy5 as the loading material. A density of 5 × 10⁻⁶ was used. 5 HepG2 cell suspensions were seeded into 12-well plates and allowed to adhere overnight. The original culture medium was then discarded, and 1 mL of BA-LNP (100 nM) with different proportions of bile acids was added to each well. The cells were incubated for 4 hours. After incubation, the culture medium containing lipid nanoparticles was discarded, and the cell suspension was collected by trypsin digestion. The cells were washed twice with PBS before being analyzed.

[0107] The results are as follows Figure 3 As shown in the figure, compared with ordinary LNP, the uptake of lipid nanoparticles by HepG2 liver cells increases significantly with the increase of bile acid doping ratio.

[0108] Example 4: Effect of different proportions of bile acid-doped BA-LNP on the knockdown effect of ASGR1, the target of the HepG2 high-fat model.

[0109] This embodiment verifies the effect of BA-LNPs with different proportions of bile acid doping on the knockdown effect of ASGR1, the target of the HepG2 high-fat model.

[0110] Experimental Methods: SiASGR1@BA-LNPs with different bile acid doping ratios, prepared in Example 2, were used, with the encapsulated payload being siRNA targeting ASGR1. A density of 5 × 10⁻⁶ was used. 5 HepG2 cell suspensions were seeded in 12-well plates and allowed to adhere overnight. The original culture medium was then discarded. For the high-fat group, induction medium containing 1 mM free fatty acids (FFA) was added, along with 1 mL of BA-LNP (50 nM) doped with different proportions of bile acids in each well. The cells were incubated for 24 hours. Cells without FFA in the medium served as the normal control group. After incubation, the culture medium was discarded, and the cells were washed twice with PBS. RNA was extracted using TRIZOL and qPCR was performed.

[0111] Test results as follows Figure 4 As shown in the figure, BA-LNPs doped with 35% HDCA exhibited the highest cell knockdown efficiency, superior to existing LNPs without bile acid doping, and could effectively synergistically silence ASGR1 with siRNA. Therefore, a 35% doping ratio was selected as the final formulation for in vivo therapy.

[0112] Example 5: Biodistribution of BA-LNP and LNP in mouse live / ex vivo organs

[0113] This embodiment verifies the biodistribution of BA-LNP and LNP in live / ex vivo mouse organs.

[0114] Experimental Methods and Grouping: The siCy5@BA-LNP prepared in Example 2 was used, with siCy5 as the loading vector. Male C57BL / 6J mice aged 6-8 weeks and weighing 18-22g were selected and acclimatized for one week under a 12h light / 12h dark cycle, with free access to food and water. Mice were randomly divided into three groups: the siCy5@BA-LNP group, the siCy5@LNP group, and the blank control group, with four mice in each group. siCy5@BA-LNP and siCy5@LNP were injected intravenously into the mice via the tail vein (0.5 mg / kg siRNA, 100 μL). Two and six hours after injection, the mice were anesthetized with isoflurane and placed in the imaging chamber of an in vivo fluorescence imaging system (IVIS) for whole-body fluorescence imaging (Ex 650 nm, Em 670 nm). The distribution and intensity changes of fluorescence signals in the mice at different time points were recorded. Specifically, in the 6-hour group, major organs such as the heart, liver, spleen, lungs, and kidneys were quickly removed, rinsed thoroughly with physiological saline to remove surface blood and impurities. The organs were then placed in an IVIS imaging system for further ex vivo organ fluorescence imaging, and the fluorescence intensity of each organ was detected and analyzed.

[0115] The results are as follows Figure 5 As shown, the BA-LNP delivery system exhibits superior distribution in the livers of normal mice compared to existing LNPs. Furthermore, by comparing fluorescence signal changes in different groups of mice, the results indicate that BA-LNP accumulates more strongly in the livers of normal mice than traditional LNPs, suggesting that bile acid-modified LNPs have a stronger targeting ability for liver tissue.

[0116] Example 6: Effects of ASGR1 upregulation and knockdown on MAFLD disease improvement

[0117] This embodiment verifies the effect of ASGR1 upregulation and knockout on the reversal of MAFLD disease in MAFLD mice and patients.

[0118] Experimental Methods and Analysis: Liver tissues from high-fat diet-induced MAFLD mice and C57 mice were collected for immunofluorescence staining and qPCR to detect ASGR1 mRNA expression levels. Simultaneously, liver tissue samples from normal individuals and MAFLD patients were collected for immunohistochemical staining to detect ASGR1 expression. The FPKM values ​​of ASGR1 in the livers of normal individuals and MAFLD patients were mined from the public database GSE160016. Wild-type (WT) and ASGR1 knockout (ASGR1- / -) mice were bred, and liver tissues were collected for Western blotting analysis of ASGR1 protein expression levels. Mouse body weight, liver weight, and liver TG content were recorded. Additionally, mouse liver sections were stained with H&E or Oil Red O. Results are as follows: Figure 6 As shown.

[0119] Results and Analysis: Figure 6 As shown in Figure A, ASGR1 is highly expressed in the cell membrane and elevated in the liver of HFD-fed mice, which was further confirmed by qPCR. Figure 6 B). Consistent with findings in mouse models, ASGR1 protein levels were also elevated in liver samples from MAFLD patients compared to normal controls. Figure 6 C), which was further confirmed in the GSE160016 data table, showed that the ASGR1 mRNA level in the liver of patients with non-alcoholic fatty liver disease was significantly elevated. Figure 6 D). To further investigate the role of ASGR1 targets in MAFLD, ASGR1 knockout mice were bred ( Figure 6 E), and feed CD or HFD for 12 weeks. ASGR1 gene deletion can significantly reverse the weight gain caused by HFD ( Figure 6 F) and liver weight ( Figure 6 Increase in G). Furthermore, enzyme-linked immunosorbent assay (ELISA) showed that triglycerides (TG) are one of the most important indicators of obesity or non-alcoholic fatty liver disease, and the triglyceride levels in the livers of ASGR1 KO mice fed HFD were lower than those in WT mice fed HFD. Figure 6 H), which is consistent with the finding that lipid accumulation in the liver of ASGR1 KO mice fed HFD was alleviated ( Figure 6 I).

[0120] Example 7: The therapeutic effects of siASGR1@BA-LNP and siASGR1@LNP on a high-fat diet-induced mouse MAFLD model.

[0121] Model establishment: Six-week-old healthy male C57BL / 6 mice were randomly divided into a normal control group, a MAFLD model group, a siASGR1@BA-LNP treatment group prepared in Example 2, and a siASGR1@LNP group. Except for the normal control group, the other groups of mice were fed a high-fat diet for 12 weeks to establish the MAFLD model (n=10).

[0122] Treatment intervention: The treatment group received intravenous injections of the corresponding preparation (1 mg / kg siASGR1, prepared in Example 2) twice a week for 8 weeks. During treatment, body weight and food intake were recorded weekly, and fur, movement, and mental status were observed daily. After treatment, mouse livers were rapidly removed for analysis of morphological and qualitative changes, and the livers underwent H&E pathological staining and Oil Red staining. The animal experimental protocol is as follows: Figure 7 As shown in Figure A.

[0123] Experimental Results and Analysis:

[0124] Changes in mouse body weight during the experiment are as follows Figure 7 As shown in Figure B, treatment with siASGR1 significantly reduced the body weight of mice.

[0125] Changes in liver morphology and liver mass, such as Figure 7 As shown in Figures C and D, the livers of mice fed a high-fat diet were significantly swollen and whitish compared to normal mice. In the siASGR1 treatment group, liver enlargement was reduced and liver blood color was restored compared to the model group. Quantitative analysis indicated a significant decrease in liver quality after siASGR1 treatment.

[0126] Liver H&E pathological staining: Mouse livers were fixed in 4% formaldehyde, then embedded in paraffin, sectioned, and stained with H&E. Results are as follows... Figure 7 Figure E in the study showed that the liver structure of the normal group mice was normal, the liver plate structure was orderly, and there were no fat vacuoles; the liver of the model group mice had a large number of white fat vacuoles, the cells were swollen and deformed, and the cell nuclei were squeezed to one side; after siASGR1 treatment, the fat vacuoles in the liver of mice were significantly reduced and the liver plate structure was restored. In particular, the liver pathological structure improvement of siASGR1@BA-LNP was better than that of siASGR1@LNP.

[0127] Oil Red O staining of liver: Mouse livers were fixed in 4% formaldehyde, then embedded in OCT, frozen sections, and stained with Oil Red O. Results are as follows: Figure 7 As shown in Figure F, large areas of orange-red lipid droplets were visible in the livers of the model group mice. After siASGR1 treatment, the lipid droplets were significantly reduced preferentially around the portal area. In particular, the improvement in liver pathological structure of siASGR1@BA-LNP was better than that of siASGR1@LNP. Simultaneously, quantitative analysis of the relative area of ​​lipid deposition yielded similar conclusions. Figure 6 G.

[0128] Example 8: Effects of siASGR1@BA-LNP and siASGR1@LNP on ASGR1 expression in the liver of a high-fat diet-induced mouse MAFLD model.

[0129] Experimental methods: RNA was extracted from the livers of mice in the siASGR1@BA-LNP treatment group and the siASGR1@LNP group after 8 weeks of treatment in Example 6, and the changes in the mRNA level of the ASGR1 index were verified by qPCR.

[0130] The results show that... Figure 8 As shown in the figure, the expression level of ASGR1 in liver tissue was significantly reduced after siASGR1 treatment, and the reduction in ASGR1 level in the siASGR1@BA-LNP treatment group was higher than that in the siASGR1@LNP treatment group.

[0131] Example 9: Biocompatibility of siASGR1@BA-LNP and siASGR1@LNP Treatment

[0132] Experimental methods: The heart, spleen, lungs, and kidneys of mice treated for 8 weeks in the normal control group, MAFLD model group, siASGR1@BA-LNP treatment group, and siASGR1@LNP group of Example 6 were fixed in 4% formaldehyde and H&E staining was performed to observe the pathological structure of the major organs.

[0133] The results show that... Figure 9 As shown in the figure, there were no significant changes in the pathological structures of major organs such as the heart, spleen, lungs, and kidneys in the treatment group compared with the normal group, suggesting the biocompatibility of nucleic acid therapy using the BA-LNP delivery system targeting ASGR1.

[0134] Bile acids are metabolites of cholesterol and share a steroidal ring skeleton with cholesterol, exhibiting similar chemical structures and physicochemical properties. They can maintain the stability of LNPs and their ability to carry siRNA. Furthermore, bile acids possess liver-specific receptors, enhancing hepatocyte uptake by activating the FXR / TGR5 receptor. In addition, the biocompatibility and anti-inflammatory properties of natural bile acids can help mitigate the risk of inflammatory responses induced by cationic lipids. Therefore, constructing novel BA-LNP delivery systems using bile acids instead of cholesterol may be a feasible approach to improve the efficiency of nucleic acid drug delivery in MAFLD (Multiple Angiotensin-Conducting Failure).

[0135] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. The application of an siRNA delivery system in the preparation of drugs for treating diseases related to ASGR1 gene expression, characterized in that, The delivery system comprises lipid nanoparticles containing siRNA encapsulated in an aqueous phase via an organic phase; the organic phase comprises bile acids, specifically porcine deoxycholic acid; and further comprises ionizable lipids, cholesterol, cofactor phospholipids, and polyethylene glycol lipid molecules; the molar ratio of the mixture of ionizable lipids, cholesterol, and bile acids, cofactor phospholipids, and polyethylene glycol lipid molecules in the organic phase is (49-51):(36-40):(9-11):(1-2); and the molar percentage of bile acids in the mixture of cholesterol and bile acids is 25%. 35%; the siRNA is composed of the sense strand RNA shown in SEQ ID NO:1 and the antisense strand RNA shown in SEQ ID NO:2; the disease associated with ASGR1 gene expression is metabolic-associated fatty liver disease; the ionizable lipid is DLin-MC3-DMA; the polyethylene glycol lipid molecule is DMG-PEG2000; the cofactor phospholipid is 1,2-distearate-sn-glycerol-3-phosphocholine.

2. The application according to claim 1, characterized in that, The 3' end of the positive strand RNA sequence also contains two dTs; And / or, the 3' end of the sequence of the antisense RNA also contains 2 dTs.

3. A composition, characterized in that, The composition contains the delivery system as described in any one of claims 1-2.

4. A drug or reagent kit, characterized in that, The drug or kit comprises the delivery system as described in any one of claims 1-2 or the composition as described in claim 3.

5. The use of the composition of claim 3 or the drug or kit of claim 4 in the preparation of a drug for treating diseases related to ASGR1 gene expression; wherein the disease related to ASGR1 gene expression is metabolic-associated fatty liver disease.

Images