Gene expression enhancer element capable of increasing gene transcription level and use thereof

Abstract

The application discloses a gene expression enhancer capable of improving gene transcription level and application thereof. The application finds that a delta satellite region from sweet potato leaf curl virus (SPLCV) SBG51 contains a new DNA sequence capable of significantly enhancing expression of a reporter gene, the gene expression enhancement effect of which does not change mRNA polyadenylation, is independent of a promoter and a terminator, and maintains spatial and temporal patterns of the promoter. The application further finds that an AT-rich sequence (such as ATAAA or TTAAA or a tandem repeat sequence containing several thereof) is a key element of the foregoing effect, even a 29bp synthetic AT-rich sequence (AT-rich-1 and AT-rich-2) is sufficient to increase expression of a reporter gene GFP by about 3 times, and the gene expression enhancement effect thereof is good in both plant and yeast cells. Therefore, the application can be applied to aspects of improving activity of a target gene at a required level, providing high level and persistent protein production and the like.

Description

Technical Field

[0001] This invention belongs to the field of biochemistry and molecular biology, specifically relating to a gene expression enhancement element that can improve gene transcription levels and its applications. Background technology:

[0002] Enhancing the expression level of target genes has always been an important aspect of modern molecular biotechnology and synthetic biology. A gene expression module typically consists of three essential elements: a promoter, a coding region, and a terminator, where both the promoter and terminator can regulate gene expression levels. In addition, the nuclear matrix binding region also participates in regulating gene expression.

[0003] Plant viruses are one of the main sources for mining regulatory elements of plant expression systems. For example, the most well-known 35S promoter and 35S terminator in plants are derived from Cauliflower Mosaic Virus (CaMV). Plant virus genomes are typically small, therefore their gene expression regulatory elements are generally very concise. Shorter regulatory elements facilitate the editing and design of gene expression modules. Thus, mining gene-enhancing elements from plant viruses has enormous development potential. Summary of the Invention:

[0004] Firstly, the object of the present invention is to provide a gene expression enhancement element capable of increasing the transcriptional level of a target gene.

[0005] The gene expression enhancing element is any of the following expression enhancing sequences:

[0006] (1)ATAAA;

[0007] (2)TTAAA;

[0008] (3) A cascaded sequence containing several sequences shown in (1) and / or (2);

[0009] (4) Sequences that have at least 80% sequence identity with the sequences shown in (1), (2), and (3), such as 8

[0010] Sequences with sequence identity of 5% or more, 90% or more, 95% or more, or 98% or more.

[0011] The number of items mentioned refers to two or more items, preferably three or more items, and more preferably five or more items, such as 5-50 items, 5-30 items, 5-20 items, 10-20 items, etc.

[0012] The cascade includes the cascade of ATAAA, or the cascade of TTAAA, or the cascade of ATAAA and TTAAA.

[0013] The series connection of the ATAAA includes two or more ATAAAs, preferably three ATAAAs, and more preferably five or more ATAAAs, such as five ATAAAs, seven ATAAAs, ten ATAAAs, twenty ATAAAs, etc.

[0014] The cascaded TTAAA includes two or more TTAAAs, preferably three TTAAAs, and more preferably five or more TTAAAs, such as five TTAAAs, seven TTAAAs, ten TTAAAs, twenty TTAAAs, etc.

[0015] The concatenation of ATAAA and TTAAA includes any number and order of combinations of one or more ATAAAs and one or more TTAAAs. For example, it includes concatenating one TTAAA with one ATAAA and repeating this combination (or concatenating one ATAAA with one TTAAA and repeating this combination); or, for example, concatenating one TTA AA with multiple ATAAAs, and then concatenating it with one or more TTAAAs. Optionally, it may continue to concatenate with one or more ATAAAs, and optionally repeat this sequence at intervals. Other examples include any combination of the above concatenation forms. It should be understood that in these concatenations, ATAAA and TTAAA can be arbitrarily replaced.

[0016] The series connection mentioned is a direct series connection.

[0017] The tandem connection refers to the tandem connection of any one or more bases separated by A / C / T / G.

[0018] The plurality of bases may include any combination of multiple A, or multiple C, or multiple T, or multiple G, or multiple A / C / T / G (two or more).

[0019] In this application, unless otherwise specified, "multiple" means two or more.

[0020] In this application, "gene expression enhancement" refers to the ability to increase the transcriptional, translational, or protein expression levels of a gene. This enhancement level can include 10% or more, 50% or more, 100% or more, or 2-fold or more, 3-fold or more, 5-fold or more, 8-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 25-fold or more, 30-fold or more, 40-fold or more, or 50-fold or more. The "gene expression enhancement element" refers to a DNA sequence that can increase the transcriptional or translational levels of a gene, or an RNA or protein sequence from which that DNA sequence can be obtained.

[0021] In some preferred embodiments, the gene expression enhancing element is a sequence containing two or more ATAAAs, preferably three or more ATAAAs, more preferably five or more ATAAAs, such as a sequence containing five ATAAAs (AT-rich-1), a sequence containing seven ATAAAs, a sequence containing ten ATAAAs, or a sequence containing twenty ATAAAs. These sequences containing two or more ATAAAs can be separated by any one or more bases from A, C, T, or G. It should be understood that any multiple bases from A, C, T, or G can be multiple bases of one type of base, such as multiple A, multiple C, multiple T, or multiple G. Of course, any multiple bases from A, C, T, or G can also be multiple bases of two or more types of bases.

[0022] In some preferred embodiments, the gene expression enhancing element is a sequence containing two or more TTAAAs, preferably three or more TTAAAs, more preferably five or more TTAAAs, such as a sequence containing five TTAAAs (AT-rich-2), a sequence containing seven TTAAAs, a sequence containing ten TTAAAs, or a sequence containing twenty TTAAAs. These sequences containing two or more TTAAAs can be separated by any one or more bases from A, C, T, or G. It should be understood that any multiple bases from A, C, T, or G can be multiple bases of one type of base, such as multiple A, multiple C, multiple T, or multiple G. Of course, any multiple bases from A, C, T, or G can also be multiple bases of two or more types of bases.

[0023] In some preferred embodiments, the gene expression enhancing element is a sequence containing two or more ATAAA and TTAAA sequences. For example, the tandem of ATAAA and TTAAA includes any number, order, or combination of one or more ATAAA and one or more TTAAA sequences. This includes, for example, a tandem of one TTAAA and one ATAAA and repeating one or more such combinations (e.g., a tandem of one TTAAA and one ATAAA like AT-rich-4, repeated five times). Another example is a tandem of one TTAAA and multiple ATAAA sequences, and optionally, a tandem of one or more TTAAA sequences (e.g., a tandem of one TTAAA and five ATAAA sequences like AT-rich-3 or 123bp, and then a tandem of one TTAAA sequence). Optionally, it continues to be tandem with one or more ATAAA sequences, and this process is optionally repeated in an interval-wise sequence (e.g., a tandem of one TTAAA and five ATAAA sequences like 364bp, and then a tandem of two TTAAA sequences, followed by a tandem of one ATAAA sequence, and then another tandem of one TTAAA sequence). Any combination of the above tandem sequences is also an example. It should be understood that ATAAA and TTAAA can be arbitrarily replaced in these tandem sequences. These sequences can be separated by any one or more bases from A / C / T / G. It should be understood that any number of bases from A / C / T / G can be multiple bases of one of the bases, such as multiple A, multiple C, multiple T, and multiple G. Of course, any number of bases from A / C / T / G can also be multiple bases of two or more bases.

[0024] Preferably, the gene expression enhancing element is one of the following nucleotide sequences:

[0025] 123bp:

[0026] TTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAA

[0027] AT-rich-1:ATAAACATAAACATAAACATAAACATAAA

[0028] AT-rich-2:TTAAACTTAAACTTAAACTTAAACTTAAA

[0029] AT-rich-3:TTAAACATAAACATAAACATAAACATAAACATAAACTTAAA

[0030] AT-rich-4:TTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAA;

[0031] 364bp:

[0032] TTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAATAGAAAATATAATTTCAAAATTCAAAAAAGTTACTGCAGTAAATATTTATTTACT TCAGTAAAAATAATCGGGTGAAATTTATTTCACTTGAGATGAATTGTCCACCAATGTCTCCAATTGAATCGGTGGACATTGGTGACATTAATTTTATGACGATAATACCCCTCATTTAAAACTAACAGGCGCGTCGCAGTGCGCTGATAAAGCTGTCGGAACTACTTTCCCAAATCTTAAAA;

[0033] A sequence that is consistent with ATAAA and TTAAA in the above sequence (for example, replacing all or part of the spacer base C in AT-rich-1, AT-rich-2, AT-rich-3, AT-rich-4 with any one or more of the spacer bases A, T, and G);

[0034] or

[0035] A sequence that has at least 80% sequence identity with the above sequence, such as 85% or more, 90% or more, 95% or more, or 98% or more sequence identity.

[0036] For example, in some preferred embodiments, the gene expression enhancing element may also be one of the following nucleotide sequences:

[0037] AT-rich-1-m:ATAAAGATAAAGATAAAGATAAAGATAAA

[0038] AT-rich-2-m:TTAAAGTTAAAGTTAAAGTTAAAGTTAAA

[0039] AT-rich-3-m:TTAAAGATAAAGATAAAGATAAAGATAAAGATAAAGTTAAA

[0040] AT-rich-4-m:TTAAAGATAAAGTTAAAGATAAAGTTAAAGATAAAGTTAAAGATAAAGTTAAAGATAAA.

[0041] Such sequences are obtained by replacing all the spacer bases C in AT-rich-1, AT-rich-2, AT-rich-3, and AT-rich-4 with spacer bases G.

[0042] Similarly, the spacer base C in AT-rich-1, AT-rich-2, AT-rich-3, and AT-rich-4 can be partially replaced with spacer base G; or all or part of the spacer base C in AT-rich-1, AT-rich-2, AT-rich-3, and AT-rich-4 can be replaced with A or T; or all or part of the spacer base C in AT-rich-1, AT-rich-2, AT-rich-3, and AT-rich-4 can be replaced with one or more of A, T, and G; all such sequences can serve as gene expression enhancing elements to exert gene enhancement effects.

[0043] It should be understood that, as can be seen from the embodiments of this application, the choice of tandem spacer bases for ATAAA and / or TTA AA, as well as the length of the bases, in the expression enhancement sequence will not have an adverse effect on its enhancement effect on gene expression.

[0044] It should be understood that, in this application, the gene expression enhancing element may include any other sequences upstream and downstream of the enhancing sequence, in addition to the enhancing sequence. As can be seen from the embodiments of this application, the length or base selection of any other sequences before and after the enhancing sequence will not adversely affect the gene expression enhancing effect of the gene expression enhancing element.

[0045] In some embodiments, the gene expression enhancing element includes the aforementioned enhancing sequence, as well as other sequences.

[0046] Preferably, the gene expression enhancing element is one of the following nucleotide sequences:

[0047] 262bp:

[0048] CTCGATGAACAGCGTAGGGGGTGGCCCGGAGGGGTTACGAAGCGTGTTCATTGACCGTGTTGTTGTCTCATAAGTCTTGAATAATTATTTTTAATAATTATTCATGTTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAGAAAATATAATTTCAAAATTCAAAAAA

[0049] The SBG51 sequence or a portion thereof, the SBG51 sequence being shown in SEQ ID NO.1;

[0050] Sequences that are consistent with ATAAA and TTAAA in the above sequences;

[0051] or

[0052] A sequence that has at least 80% sequence identity with the above sequence, such as 85% or more, 90% or more, 95% or more, or 98% or more sequence identity.

[0053] Preferably, the SBG51 portion includes:

[0054] Bits 383-642 of the SBG51 sequence (SCR region);

[0055] Or the 110th to 328th positions of the SBG51 sequence (A-Rich region).

[0056] In a second aspect, the present invention provides a gene expression module that enhances gene expression by inserting one or more expression-enhancing elements of the first aspect of the present application downstream of the terminator of the gene expression module to obtain the gene expression module that enhances gene expression.

[0057] The gene expression module includes one or more promoters, one or more coding sequences, and one or more terminators.

[0058] The gene expression module that enhances gene expression includes one or more promoters, one or more coding sequences, one or more terminators, and one or more expression enhancement elements of the first aspect of this application downstream of the terminators.

[0059] In this invention application, it has been demonstrated that expression-enhancing elements exert gene-enhancing effects independently of promoters and terminators. These elements can cooperate with various promoters, such as those from plants and viruses, to enhance gene expression. For example, this application has demonstrated good cooperation with the 35S promoter from the plant virus cauliflower mosaic virus (CaMV), the Arabidopsis UBQ10 promoter (ubiquitin 10 gene promoter), the Arabidopsis FLOWERING LOCUS T (FT) promoter, the Arabidopsis TOO MANY MOUTHS (TMM) promoter, and the yeast pHISmini promoter. In addition, other promoters, such as the constitutive actin promoter from plants, the simian virus 40 early (SV40) promoter from animals, and the cytomegalovirus (CMV) promoter, can also cooperate with the expression-enhancing elements in this application to exert their effects.

[0060] Similarly, the expression-enhancing element in this application can also cooperate with various terminators, such as those from plants and viruses, to enhance gene expression. For example, this application has demonstrated good cooperation with the most commonly used terminators, such as the NOS terminator for Agrobacterium tumefaciens carmine synthase gene, the OCS terminator for octopus carmine synthase gene, and the TminiHIS3 terminator for the HIS3 gene. In addition, other terminators, such as the Arabidopsis thaliana heat shock protein 18.2 (HSP) terminator and the tobacco elongation protein gene terminator, can also cooperate with the expression-enhancing element in this application to achieve the desired effect.

[0061] In this application, the gene expression module functions in eukaryotes, including plants and fungi. Preferably, the fungi are yeasts or Trichoderma, such as in Arabidopsis thaliana, tobacco, corn, rice, maize, petunia, rapeseed, lettuce, soybean, poplar leaves, tomato fruits, etc.

[0062] In this application, the gene expression module plays a gene expression enhancement role in gene expression in eukaryotic genomes.

[0063] In this application, the gene expression module enhances gene expression when integrated into the genome.

[0064] Thirdly, the present invention provides an expression vector comprising one or more of the above-mentioned gene expression modules.

[0065] The expression vector can be an expression vector that can be expressed in fungal, plant, or mammalian cells, and preferably the fungus is yeast or Trichoderma.

[0066] Fourthly, the present invention provides a method for enhancing gene expression, which involves inserting the aforementioned gene expression enhancing element downstream of the terminator of the expression cassette and transferring it into the host body.

[0067] The host can be various plant, animal, and microbial cells. The microorganism is preferably a fungus, and more preferably a yeast or Trichoderma. The animal is preferably a mammal. The plants include Arabidopsis thaliana, tobacco, corn, rice, maize, petunia, rapeseed, lettuce, soybean, poplar leaves, and tomato fruit.

[0068] Fifthly, the present invention provides the application of the above-mentioned gene expression enhancement element, gene expression module or expression vector in Agrobacterium-mediated transient expression of tobacco.

[0069] In a sixth aspect, the present invention provides the application of the above-mentioned gene expression enhancing element, gene expression module or expression vector in enhancing gene expression.

[0070] In a seventh aspect, the present invention provides the application of the above-mentioned gene expression enhancing element, gene expression module or expression vector in gene function research.

[0071] Eighthly, the present invention provides the application of the above-mentioned gene expression enhancing element, gene expression module or expression vector in species improvement.

[0072] In a ninth aspect, the present invention provides the application of the above-mentioned gene expression enhancing element, gene expression module or expression vector in the preparation of gene or protein drugs.

[0073] This invention discovers gene expression enhancing elements “ATAAA” and “TTAAA”. By inserting them in a certain number of tandem repeats downstream of the terminator of the gene expression module of a binary vector, an overexpression vector can be obtained, which significantly enhances gene expression.

[0074] The gene expression enhancement element provided in this application can achieve the following beneficial effects:

[0075] (1) Achieve sustained and long-lasting enhancement of gene expression;

[0076] (2) Gene enhancement is significant and efficient, with an expression increase of more than 3 times, or even 30 times.

[0077] (3) It also has a significant enhancing effect on genes or proteins with low expression levels;

[0078] (4) It has wide applicability. It can independently enhance gene expression with promoters and terminators, and can work in combination with a variety of promoters and terminators to achieve the desired effect.

[0079] (5) While achieving the effect of enhancing gene expression, it can also maintain the spatial and temporal patterns of the promoter.

[0080] The gene expression enhancement element provided in this application can be used for:

[0081] (1) Studying gene function: By increasing gene expression, we can conduct more in-depth research on the function of genes, especially low-expression genes. Due to their low expression level, the function of low-expression genes is often difficult to study. However, by enhancing their expression, especially in this application, the expression level can be enhanced by more than 30 times, which can enable the functional study of these low-expression genes.

[0082] (2) Application in recombinant protein production: By improving gene expression efficiency, the yield of recombinant proteins can be increased, thereby improving the production efficiency and quality of recombinant proteins and bringing significant economic and social benefits to industrial production. For example, in the food industry, cellulase obtained through gene recombination technology can be used in food processing. The gene expression enhancement element of this application can improve the yield and quality of cellulase, thus better breaking down cellulose in food and increasing the taste and nutritional value of the food. In the textile industry, recombinant proteins also play an important role, especially in dye production. Through gene expression enhancement elements, the performance of dyes can be optimized, improving the quality of textiles.

[0083] (3) Applications in biological therapy and pharmaceutical production of therapeutic proteins and vaccines: On the one hand, advances in gene expression regulation mechanisms in biological therapy and drug development have provided new avenues for disease treatment. By understanding and controlling gene expression processes and conducting in-depth research on gene expression and regulation mechanisms, scientists can develop more effective treatments. On the other hand, increasing gene expression levels and the synthesis of functional gene products can improve the production efficiency of therapeutic proteins and vaccines in the pharmaceutical field. For example, enhancing the expression of specific genes can increase the yield and quality of biological drugs such as therapeutic proteins and vaccines, which is crucial for the production of vaccines and other therapeutic proteins. This not only provides new avenues for disease treatment but also opens up new possibilities for future medical research and development.

[0084] (4) Improved breeding: Increase the expression level of target genes to varying degrees without significantly altering tissue and spatiotemporal specificity, thereby achieving the goal of molecular genetic improvement of crops.

[0085] (5) It can enhance gene expression, gene editing efficiency, gene transcription protein expression, improve the transcription effect of promoter or target sequence, and enhance gene silencing or knockout of target genes. It can achieve the goal of increasing the activity of target genes at the required level. It also provides a new way to optimize expression vectors and accurately control gene expression in synthetic biology, plant / medicine (e.g., research on anti-inflammatory, antibacterial, and anti-tumor drugs) / protein or enzyme research. Attached image description:

[0086] Figure 1 Gene expression enhancement effects of four gene expression enhancing elements

[0087] Figure 2 Enhanced gene expression at 123bp, 262bp, and 364bp in the SBG51 sequence.

[0088] Figure 3 Gene expression enhancement effect of SBG51 sequence

[0089] Figure 4 SBG51 full sequence

[0090] Figure 5 Gene expression enhancement effects of gene expression enhancing elements composed of certain parts of the SBG51 sequence (SCR region and A-rich region).

[0091] Figure 6 The gene expression enhancing element described in this application enhances the gene expression of the low-expressed protein AtPHOT1.

[0092] Figure 7 The SBG51 sequence maintains the spatiotemporal specificity of gene expression modules.

[0093] Figure 8 The gene expression enhancement effect of the gene expression enhancing element (SBG51) at different insertion sites in this application.

[0094] Figure 9 The gene expression enhancement effect of the gene expression enhancing element (123 bp) at different insertion sites in this application.

[0095] Figure 10 The gene expression enhancement effect of the gene expression enhancing element (AT-rich-4) in this application in various plants.

[0096] Figure 11 The gene expression enhancement effect of the gene expression enhancing element (AT-rich-4) in yeast as described in this application.

[0097] Figure 12 The gene expression enhancing element (AT-rich-4) of this application enhances gene expression in animal cells.

[0098] Figure 13 The gene expression enhancement effect of the gene expression enhancing elements (α-AT, β-AT-1 and β-AT-2) in tobacco as described in this application. Detailed implementation method:

[0099] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0100] Example 1: Gene expression enhancement effect of four gene expression enhancing elements

[0101] The 35S promoter (GenBank: MT611510.1), the GFP reporter gene (GenBank: E17099.1), and the octopine terminator (Ocs-T: Octs terminator, GenBank: V00088.1, 1439–1629) were combined to form the 35S-GFP-OcsT expression module (abbreviated as 35S-GFP).

[0102] Four gene expression enhancing elements (AT-rich h-1, AT-rich-2, AT-rich-3, and AT-rich-4) were obtained by tandem repeating different numbers of "ATAAA" or "TTAAA" elements, and these were inserted into the Hind III restriction site downstream of the 35S-GFP-OcsT expression module to obtain the overexpression vector. Figure 1 a and b). Using a standard Agrobacterium-mediated transient expression assay in tobacco, GFP fluorescence was observed with a handheld UV lamp at 2 days (2 dpi, day post-inoculation) and 4 days after Agrobacterium infection. Compared to the 35S-GF P-OcsT control group (without inserted gene expression-enhancing elements), all AT-rich fragments enhanced GFP fluorescence, transcription, and protein levels at varying degrees. Figure 1 ce).

[0103] As can be seen, AT-rich-1 (ATAAACATAAACATAAACATAAACATAAA) and AT-rich-2 (TTAAACTTAAACTTAAACTTAAACTTAAA) contain 5 repeats of AT-rich elements, and the GFP transcription in their samples is 3.5 times higher than that in the control. Figure 1 d). The GFP transcription rate of the AT-rich-3 sample containing 7 repeat AT elements (TTAAACATAAACATAAACATAAACATAAACATAAACTTAAA) was 6.0-fold higher, and the GFP transcription rate of the AT-rich-4 sample containing 10 repeat AT elements (TTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACA TAAA) was 7.0-fold higher. Figure 1 d).

[0104] The results showed that gene expression enhancement elements composed of individual tandems of “ATAAA” and “TTAAA” (AT-rich-1 and AT-rich-2) or spaced tandems of “ATAAA” and “TTAAA” (AT-rich-3 and AT-rich-4) exhibited a significant gene transcription enhancement effect of more than 3 times. Elements with more AT may show a stronger gene transcription enhancement effect, and the number of repeats of “ATAAA” and “TTAAA” elements may be able to control the level of gene transcription enhancement.

[0105] Example 2: Gene expression enhancement effects of three more gene expression enhancing elements (123bp, 262bp, and 364bp).

[0106] The 262bp region (CTCGATGAACAGCGTAGGGGGTGGCCCGGAGGGGTTACGAAGC GTGTTCATTGACCGTGTTGTTGTCTCATAAGTCTTGAATAATTATTTTTAATAATTATTCATGTTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAATAGAAAATATAATTTCAAAATTCAAAAAA) and the 123bp region (TTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCA CTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAA TGGAAAAAGAAATTAAAA) in the SBG51 sequence contain seven “ATAAA” or “TTAAA” elements. Figure 2a), in addition, the 364bp region (TTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACA TATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAATAGAAAATATAATTTCAAAATTCAAAAAAGTTACTGCAGTAAATATTTATTTACTTCAGTAAAAATAATCGGGTGAAATTTATTTCACTTGAGA TGAATTGTCCACCAATGTCTCCAATTGAATCGGTGGACATTGGTGACATTAATTTTATGACGATAATACCCCTCATTTAAAACTAACAGGCGCGTCGCAGTGCGCTGATAAAGCTGTCGGAACTTTCCCAAATCTTAAAA) contains 10 "ATAAA" or "TTAAA" elements ( Figure 2 a). Three DNA fragments were inserted into the HindIII restriction site downstream of the 35S-GFP-OcsT expression module to obtain overexpression vectors of 35S-GFP-262bp, 35S-GFP-123bp, and 35S-GFP-364bp, respectively. Figure 2 b). Using a standard Agrobacterium-mediated transient expression assay in tobacco, GFP fluorescence was observed with a handheld UV lamp at 2 days (2 dpi, day post-inoculation) and 4 days after Agrobacterium infection. 35S-GFP-262bp, 35S-GFP-123bp, and 35S-GFP-364bp significantly enhanced GFP transcription and protein levels. Figure 2 The 364bp region containing 10 elements showed the strongest effect among the three gene expression enhancing elements. Figure 2 ce).

[0107] The results above show that gene expression enhancement elements containing multiple tandem repeats of "ATAAA" and "TTAAA" can enhance gene expression. Even if the spacer sequence contains more than dozens of bases or includes other sequences preceding the gene expression enhancement sequence, such gene expression enhancement elements can still enhance gene expression.

[0108] Example 3: Gene expression enhancement effects of three more gene expression enhancing elements (SCR region and A-rich region, SBG51 all).

[0109] like Figure 3As shown in Figure a, we inserted the UBQ10-GFP-Nos T (hereinafter referred to as GFP) expression module, composed of the Arabidopsis thaliana UBQ10 promoter (GenBank: ON111458.1), GFP reporter gene (GenBank: E17099.1), and nopaline terminator (GenBank: MK078637.1), into the binary vector pCAMBIA1300 to obtain the plant expression vector GFP (Zhang Y., Lyu, S., Hu, Z., Yang, X., Zhu, H. and Deng, S. (2023) Identification and functional characterization of the SUMO system in sweet potato under salt and drought stress. Plant Science 330, 111645). Downstream of the GFP vector expression module, at the HindIII restriction site, we inserted... Figure 4 The SBG51 sequence (nucleotide sequence shown in SEQ ID NO.1) was used to obtain the SBG51-GFP overexpression vector. Using a standard Agrobacterium-mediated transient expression assay in tobacco, GF P fluorescence was observed using a handheld UV lamp at 2 days (2 dpi, day post-inoculation) and 4 days after Agrobacterium infection. Compared to the control GFP vector (without the SBG51 sequence inserted), the GFP fluorescence pattern of the SBG51-GFP sample was significantly enhanced. Figure 3 b). qPCR analysis revealed that, 2 days after infection (2 dpi), compared to the control GFP sample, the transcription of the GFP gene in the SBG51-GFP sample was significantly increased by 6.6 times. Figure 3 c). Due to post-transcriptional gene silencing (PTGS), the protein in the control GFP sample, as detected by Western blotting, had completely disappeared 6 days after infection (6 dpi), while the fluorescence of the SBG51-GFP sample was still detectable 8 days after infection (8 dpi). Figure 3 d).

[0110] The SBG51 sequence contains 662 bases. Positions 643-12 form a stem-loop structure; positions 110-328 are an A-rich region; positions 354-379 form a secondary stem-loop structure; and positions 383-642 constitute the SC R region. Figure 5As shown, the SBG51 vector was shortened in a similar manner, and the DNA sequence necessary for enhanced expression in the SBG51 vector was analyzed. Figure 5 a). In the SBG51-Δ1-GFP construct, the stem loop, satellite conserved region (SCR), and secondary stem loop were deleted, but the A-rich region was retained. In the SBG51-Δ2-GFP construct, the A-rich region and secondary stem loop were deleted, but the stem loop and SCR were retained. In the SBG51-Δ3-GFP construct, only the stem loop and the sequence between the MCS and the A-rich region were retained. Interestingly, GFP fluorescence, gene expression, and protein levels showed that SBG51-Δ1-GFP and SBG51-Δ2-GFP had similar effects on gene expression to SBG51-GFP, but SBG51-Δ3-GFP had only a slight effect. Figure 5 This result indicates that both SCR and A-rich DNA sequences have expression-enhancing effects, but stem-loop is not essential.

[0111] Example 4 also showed an enhancing effect on proteins with low expression.

[0112] The AtPHOT1 gene is 2988 bp long and translates into a protein of 996 amino acids. This large molecular weight protein is usually expressed at very low levels in the tobacco transient expression system.

[0113] like Figure 6 As shown, we inserted AtPHOT1 (Arabidopsis thaliana blue light receptor protein gene, GenBank: AY040062.1) into the following gene sequences: Figure 3 Upstream of the GFP gene in the GFP expression module shown in Figure a (same as the plant expression vector GFP vector in Example 3) and the SBG 51-GFP expression module (same as the SBG51-GFP overexpression vector in Example 3), expression vectors capable of expressing the AtPHOT1-GFP fusion protein were obtained, namely UBQ10-AtPHOT1-GFP and SBG51-UBQ10-AtPHOT1-GFP, respectively. Using a conventional Agrobacterium-mediated transient expression experiment in tobacco, the AtPHOT1-GFP protein level was detected by Western blotting at 2 days (2 dpi), 6 days (6 dpi), and 8 days (8 dpi) after Agrobacterium infection. Without SBG51 sequence enhancement, AtPHOT1 was difficult to detect in the tobacco transient expression system, while SBG51 significantly enhanced the AtPHOT1-GFP protein level. Figure 6 ).

[0114] This embodiment demonstrates that the gene expression enhancing element of this application can significantly enhance the expression level of high molecular weight, low-expression proteins.

[0115] Example 5: Different promoters and terminators do not affect the gene expression enhancement element effect of this application.

[0116] Based on Example 2, the SBG51 sequence was still used as the gene expression enhancement element, and the Arabidopsis thaliana UBQ10 promoter (GenBank: ON111458.1) and nopaline terminator (GenBank: MK078637.1) were replaced, specifically as follows: Figure 3 As shown in Figure e, we inserted the 35S-GFP-OcsT (hereinafter referred to as 35S-GFP) expression module, composed of the 35S promoter (GenBank: MT611510.1), the GFP reporter gene (GenBank: E17099.1), and the octopine terminator (Ocs-T: Ocs terminator, GenBank: V00088.1, 1439–1629), into the binary vector pCAMBIA1300 to obtain the plant expression vector 35S-GFP. At the Hind III restriction site downstream of the 35S-GFP vector expression module, we inserted... Figure 4 The SBG51 sequence shown (nucleotide sequence as shown in SEQ ID NO.1) was used to obtain the SBG51-35S-GFP overexpression vector. Using a standard Agrobacterium-mediated transient expression assay in tobacco, GFP fluorescence was observed with a handheld UV lamp at 2 days (2 dpi, day post-inoculation) and 4 days after Agrobacterium infection. Compared to the control 35S-GFP vector, the GFP fluorescence pattern of the SBG51-35S-GFP sample was significantly enhanced. Figure 3 f). Compared to 35S-GFP, SBG51-35S-GFP showed a 30.6-fold increase in gene transcription (f). Figure 3 g), SBG51-35S-GFP also accumulated more GFP protein ( Figure 3 h).

[0117] The results of this embodiment show that the SBG51-based DNA sequence works well in combination with the UBQ10 promoter, 35S promoter, NOS terminator, and OCS terminator. This indicates that the gene-enhancing element of this application is independent of promoters and terminators and can work with various promoters and terminators to achieve gene-enhancing effects.

[0118] Example 6: Gene expression enhancing elements do not affect the spatial and temporal expression patterns of the promoter itself.

[0119] like Figure 7As shown in Figure a, we replaced the UBQ10 promoter in the plant expression vector GFP in Example 3 with the promoter of the Arabidopsis FT gene (nucleotide sequence as shown in SEQ ID NO.2, Adrian J., Farrona S., Reimer JJ, Albani MC, Coupland G. and Turck F. cis-Regulatory elements and chromatin state coordinately control temporal and spatial expression of FLOWERING LOCUS T in Arabidopsis. Plant Cell 2010 22(5):1425-1440.) and the promoter of the TMM gene (nucleotide sequence as shown in SEQ ID NO.3, Nadeau JA and Sack FD Control of stomatal distribution on the Arabidopsis leaf surface. Science 2002 296(5573):1697-1700.) to obtain pFT-GFP-NosT (hereinafter referred to as pFT-GFP) and pTMM-GFP-NosT, respectively. T (hereinafter referred to as pTMM-GFP). FT promoter activity exhibits circadian rhythms, while the TMM promoter is expressed only in stomatal cells. Figure 7 As shown, at the Hind III restriction site downstream of the expression module, an insertion is made as follows: Figure 4 The SBG51 sequence shown (nucleotide sequence as shown in SEQ ID NO. 1) was used to obtain SBG51-pFT-GFP and SBG51-pTMM-GFP overexpression vectors, respectively. Transgenic Arabidopsis thaliana was constructed using these vectors via conventional Agrobacterium-mediated transformation. GFP gene transcription in six independent lines of each genotype was analyzed by qPCR. Although there were significant differences in gene expression among different lines, the SBG51 overexpression vector generally increased GFP transcription by 2–3 times compared to the control genotype. Figure 7 b). Furthermore, in SBG51-pFT-GFP transgenic plants, the temporal expression pattern controlled by the FT promoter was maintained ( Figure 7 c). SBG51-pTM M-GFP transgenic plants showed stronger fluorescence only in stomata than pTM M-GFP. Figure 7 d).

[0120] This embodiment illustrates that, through stable transformation, the SBG51 sequence can significantly enhance gene expression in stably transformed plants while maintaining the specificity of the spatial and temporal expression patterns of these promoters.

[0121] Furthermore, this embodiment also shows that replacing the promoter with the promoter of the Arabidopsis thaliana FT gene and the promoter of the TMM gene does not affect the gene expression enhancement element of SBG51 in this application. This also shows that the gene enhancement element of this application is independent of the promoter and terminator, and can work with various promoters and terminators to exert gene enhancement effects.

[0122] Example 7: Gene expression enhancing elements function downstream of terminators

[0123] We inserted a multiple cloning site (MCS) into SBG51 to obtain SBG51-MCS, and then inserted it into the binary vector pCAMBIA1300 to obtain the p1300-SBG51-MCS vector. The p1300-SBG51-MCS vector contains four unique restriction endonuclease sites (EcoRI, KpnI / XbaI, BstEII, and HindIII). We inserted the UBQ10-GFP-NosT expression module, composed of the UBQ10 promoter (UBQ10-p, GenBank: ON111458.1), the GFP reporter gene (GFP, GenBank: E17099.1), and the Nos terminator (Nos-T, GenBank: MK078637.1), into the above four sites to obtain SBG51-GFP-1, SBG51-GFP-2, SBG51-GFP-3, and SBG51-GFP-4. Figure 8 a). Among them, SBG51-GFP-2 is in Figure 3 The SBG51-GFP overexpression vector was used. In a standard Agrobacterium-mediated transient expression assay in tobacco, GFP fluorescence was observed using a handheld UV lamp at 2 days (2 dpi) and 4 days (4 dpi) after Agrobacterium infection. GFP gene expression levels were detected by qPCR, and GFP protein levels were detected by Western blotting. The SBG51-GFP-1 and SBG51-GFP-2 vectors showed enhanced gene expression, but the SBG51-GFP-3 and SBG51-GFP-4 vectors did not. Figure 8 (b, c, d).

[0124] In addition, we inserted the 35S-GFP-OcsT (hereinafter referred to as 35S-GFP) expression module, which consists of the 35S promoter (35S-p: 35S promoter, GenBank: MT611510.1), the GFP reporter gene (GFP, GenBank: E17099.1), and the Ocs terminator (Ocs-T: Ocs terminator, GenBank: V00088.1, 1439-1629), into the binary vector pCAMBIA1300 to obtain the plant expression vector 35S-GFP. We inserted a 123bp region (TTAAAAAATAAAAAAATAAAACATA AAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAA) from SBG51 at the HindIII site downstream of the Ocs terminator and the SalI site upstream of the Ocs terminator, respectively, to obtain the 35S-GFP-OcsT-123bp and 35S-GFP-123bp-OcsT expression vectors. Figure 9 a). Using a conventional Agrobacterium-mediated transient expression assay in tobacco, GFP fluorescence was observed with a handheld UV lamp at 2 days (2 dpi) and 4 days (4 dpi) after Agrobacterium infection. GFP gene expression levels were detected by qPCR, and GFP protein levels were detected by Western blotting. When the 123 bp region was inserted between GFP and the Ocs terminator, it had no positive effect on gene expression; instead, it had an adverse effect. Figure 9 bd).

[0125] This embodiment demonstrates that the gene expression enhancing element of this application, when acting upstream of the promoter and upstream of the terminator of the gene expression module, does not enhance gene expression. However, when the gene expression enhancing element of this application acts downstream of the terminator of the expression module, it enhances gene expression.

[0126] Example 8: Gene expression enhancing elements can exert enhancing effects in various plants.

[0127] The RUBY reporter gene (3939bp, GenBank: OQ653532.1, 253-4191) is an open reading frame that couples three genes, CYP76AD1, DOD A, and GT, to a single open reading frame, encoding three large enzymes that catalyze the synthesis of betaine (He Y., Zhang, T., Sun, H., Zhan, H. and Zhao, Y. (2020) A reporter for noninvasively monitoring gene expression and plant transformation. Hortic Res 7, 152.). We inserted the 35S-RUBY-OcsT (hereinafter referred to as 35S-RUBY) expression module, composed of the 35S promoter (35S-p: 35S promoter, GenBank: MT611510.1), the RUBY reporter gene (GenBank: OQ653532.1, 253–4191), and the Ocs terminator (Ocs-T: Ocs terminator, GenBank: V00088.1, 1439–1629), into the binary vector pCAMBIA1300 to obtain the plant expression vector 35S-RUBY. Figure 10 a, b). We inserted the AT-rich-4 sequence into the HindIII restriction site downstream of the 35S-RUBY-OcsT expression module to obtain an overexpression vector. Using a conventional Agrobacterium-mediated transient expression experiment, the RUBY gene was expressed in tobacco leaves, poplar leaves, and tomato fruits, and the accumulation of betaine in leaves and fruits was observed. The results showed that the AT-rich-4 sequence significantly enhanced the expression level of RUBY, resulting in the accumulation of more betaine in leaves and fruits. Figure 10 ce).

[0128] This embodiment illustrates that the gene expression enhancing element of this application can enhance gene expression in a variety of different plants, including tobacco (Nicotianabenthamiana) leaves, poplar leaves, and tomato fruits.

[0129] Example 9: Gene expression enhancing elements can also exert an enhancing effect in yeast.

[0130] like Figure 11As shown, an AT-rich-4 (TTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAA) fragment was inserted into the BamHI site downstream of the expression module of the pHISi vector (from Clontech, K1603-1 yeast one-hybrid kit) to obtain an overexpression vector. The vector was integrated into the genome of yeast strain Y1HGold (from Clontech, 630491 yeast one-hybrid kit) using a conventional PEG-LiAc transformation method. Yeast growth was observed on media containing 0 mM, 5 mM, 15 mM, and 45 mM of 3-amino-1,2,4-triazole (3-AT) to assess the expression level of the HIS3 gene.

[0131] like Figure 11 As shown, the AT-rich-4 gene expression enhancing element of this application significantly enhances the expression of the HIS3 gene, thereby enabling yeast to grow well on high-concentration 3-AT medium.

[0132] As can be seen from this embodiment, the gene expression enhancing element of this application can also exert a gene enhancement effect in the yeast system. Furthermore, it can also be seen that the gene expression enhancing element of this application does not affect the gene enhancement effect when other promoters and terminators are replaced.

[0133] Example 10: Gene expression enhancing elements can also exert an enhancing effect in mammals.

[0134] like Figure 12 As shown, an AT-rich-4 (TTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAA) fragment was inserted into the BbsI site downstream of the expression module in the piggyBac CMV-GFP-FRT vector (Addgene, Plasmid#92078) to obtain an overexpression vector. The expression module was transfected into mammalian cells (human kidney epithelial cell line HEK293) using the PiggyBac vector system via conventional transfection methods and integrated into the genome. GFP expression levels were assessed by examining GFP intensity using flow cytometry. Figure 12 As shown in c, the gene expression enhancement element of the AT-rich-4 fragment rich in “ATA AA” and “TTAAA” elements can significantly enhance the expression of the GFP gene, thereby exhibiting higher GFP fluorescence intensity.

[0135] As can be seen from this embodiment, the gene expression enhancing element of this application can also exert a gene expression enhancing effect in mammals.

[0136] Example 11:

[0137] The 35S promoter (GenBank: MT611510.1), the GFP reporter gene (GenBank: E17099.1), and the octopine terminator (Ocs-T: Octs terminator, GenBank: V00088.1, 1439-1629) were combined to form the 35S-GFP-OcsT expression module (abbreviated as 35S-GFP-OcsT). We named the 1028–1361 bp region of the alpha satellite ring of Multan virus (alphasatellite, GenBank: MW816854.1) α-AT, the 763–1025 bp region of the beta satellite ring of tomato yellow leaf curl virus (betasatellite, GenBank: AJ421621.1) β-AT-1, and the reverse complementary sequence of the 169–209 region β-AT-2. α-AT, β-AT-1, and β-AT-2 are all rich in the “ATAAA” or “TTAAA” elements.

[0138] We inserted the 35S-GFP-OcsT expression module into the binary vector pCAMBIA1300 to obtain an overexpression vector, resulting in the plant expression vector 35S-OcsT. We then inserted α-AT, β-AT-1, and β-AT-2 into the HindIII restriction site downstream of the 35S-OcsT expression module to obtain 35S-GFP-α-AT, 35S-GFP-β-AT-1, and 35S-GFP-β-AT-2, respectively. Figure 13 a). Using a standard Agrobacterium-mediated transient expression assay in tobacco, GFP fluorescence was observed with a handheld UV lamp 2 days after Agrobacterium infection (2 dpi, day post-inoculation). Compared to the 35S-OcsT vector control group (without inserted gene expression-enhancing elements, i.e., - in the figure), all AT-rich fragments enhanced GFP fluorescence, transcription, and protein levels at varying degrees. Figure 13 bd).

Claims

1. A gene expression enhancing element, characterized in that, The gene expression enhancing element is any of the following sequences: The SBG51 sequence portion; the SBG51 portion is: the 124th to the 246th position of SEQ ID NO.1, the 18th to the 279th position of SEQ ID NO.1, or the 124th to the 487th position of SEQ ID NO.

1.

2. A gene expression module for enhancing gene expression, characterized in that, The gene expression enhancement element as described in claim 1 is inserted downstream of the terminator of the gene expression module to obtain a gene expression module that enhances gene expression.

3. A gene expression module for enhancing gene expression, characterized in that, include: A promoter, The coding sequence of a single target gene or the coding sequences of multiple target genes fused together; A terminator; The gene expression enhancement element of claim 1 is inserted downstream of the terminator of the gene regulatory sequence.

4. The gene expression module as described in claim 3, characterized in that, The promoters and / or terminators are derived from plants or viruses.

5. The gene expression module as described in claim 4, characterized in that, The promoters are selected from: the 35S promoter of the plant virus cauliflower mosaic virus (CaMV), the Arabidopsis UBQ10 promoter, the Arabidopsis FLOWERING LOCUS T (FT) promoter, the Arabidopsis TOO MANY MOUTHS promoter, the yeast mini promoter, the constitutive promoter actin promoter from plants, the simian virus 40 early promoter from animals, and the cytomegalovirus promoter; The terminators are selected from: Agrobacterium tumefaciens carmine synthase gene NOS terminator, Octopus carmine synthase gene OCS terminator, HIS3 gene terminator, Arabidopsis heat shock protein 18.2 terminator, and tobacco elongation protein gene terminator.

6. The application of the gene expression module according to any one of claims 2-5 in eukaryotes; The application described is that the gene expression enhancement module enhances gene expression in eukaryotic genomes; The eukaryotes mentioned are tobacco, poplar, tomato, yeast, or human renal epithelial cells HEK293.

7. A gene expression vector for enhancing gene expression, characterized in that, It includes one or more gene expression modules as described in any one of claims 2-5.

8. The gene expression vector according to claim 7, characterized in that, The expression vector is an expression vector expressed in yeast or human kidney epithelial cells HEK293, or a binary expression vector expressed in plant cells, wherein the plant is tobacco, poplar, or tomato.

9. A method for enhancing gene expression, characterized in that, The gene expression enhancing element as described in claim 1 or the SBG1 sequence shown in SEQ ID NO.1 is inserted downstream of the terminator of the expression vector and transferred into the host; the host is a plant, human renal epithelial cells HEK293, or microbial cells, wherein the plant is tobacco, poplar, or tomato, and the microorganism is yeast.

10. The application of the gene expression enhancing element of claim 1, or the SBG1 sequence as shown in SEQ ID NO.1, or the gene expression module of any one of claims 2-5, or the gene expression vector of any one of claims 7-8, in enhancing the expression of the nucleic acid sequence to be expressed or improving the transcriptional effect of the promoter in tobacco, poplar, tomato, yeast, or human renal epithelial cells HEK293.

11. The application according to claim 10, characterized in that, The application described is Agrobacterium-mediated transient expression in tobacco.

12. A transgenic cell, characterized in that, The transgenic cell contains the gene expression enhancement element of claim 1, the gene expression module of any one of claims 2-5, or the gene expression vector of any one of claims 7-8.

13. The transgenic cell according to claim 12, characterized in that, The transgenic cells are tobacco, poplar, tomato, yeast, or human renal epithelial cells HEK293.

Images