SNP marker for identifying baihao species and application thereof

By using silver pheasant-specific SNP markers and primer sets, combined with Sanger sequencing technology, the problem of morphological identification of silver pheasant chicks and females has been solved, enabling accurate identification of individual silver pheasants and supporting their conservation and scientific research.

CN121065348BActive Publication Date: 2026-07-21GUANGZHOU ZOO (BRANDED AS GUANGZHOU WILDLIFE RES CENT)
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
GUANGZHOU ZOO (BRANDED AS GUANGZHOU WILDLIFE RES CENT)
Filing Date
2025-08-29
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

Existing species identification methods are insufficient to accurately distinguish between silver pheasant chicks and females, especially in hybrid individuals, which makes it difficult to determine their species affiliation, thus affecting the conservation and scientific research of silver pheasants.

Method used

By employing single nucleotide polymorphism (SNP) markers and screening for SNP sites specific to silver pheasants, combined with primer sets and detection systems, an efficient and accurate species identification method was established, and the genotype of the SNP sites was identified using Sanger sequencing technology.

Benefits of technology

This has enabled accurate identification of individual silver pheasants, reduced identification errors, and provided solid technical support for the protection and scientific research of silver pheasants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application relates to a SNP marker for Crossoptilon mantchuricum species identification and application thereof, and relates to the technical field of biology. The SNP marker can effectively solve the current identification problems caused by Crossoptilon mantchuricum hybridization, chick and female bird morphological identification difficulties and the like, and provides solid technical support for Crossoptilon mantchuricum protection, population monitoring and related scientific research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to SNP markers for species identification of silver pheasants and their applications. Background Technology

[0002] The genus *Lophura* belongs to the order Galliformes and the family Phasianidae, and includes 12 species of large pheasants, playing an important role in ecosystems and biodiversity. Among them, three species are found in China: the silver pheasant (*Lophura nycthemera*), the black pheasant (*Lophura leucomelanos*), and the blue pheasant (*Lophura swinhoii*).

[0003] The silver pheasant, also known as the silver pheasant or white pheasant, is an important member of the pheasant genus with an extremely wide distribution, encompassing Cambodia, China, Laos, Myanmar, Thailand, and Vietnam. In China, it is found throughout South China, Central China, and Southwest China. Besides its wide distribution, the silver pheasant also possesses unique hybridization characteristics, capable of interbreeding with other pheasant species in the same genus, such as the black pheasant. The probability of this hybridization varies under different environments. In captivity, due to the limited activity space and increased contact opportunities among pheasants of different genera, hybridization is more likely to occur compared to the natural wild environment. The emergence of hybrid individuals in captivity undermines the original purpose of wild species conservation efforts. Furthermore, if these individuals are released into the wild, they are highly likely to enter wild populations, leading to genetic pollution and disrupting the genetic purity and stability of wild populations. This poses a severe challenge to the conservation of the silver pheasant and presents a significant challenge to its species identification.

[0004] Currently, common species identification methods often rely on mitochondrial markers. However, this method has significant limitations, as it only reflects maternal genetic information and cannot comprehensively and accurately determine whether an individual is a hybrid offspring. From a morphological perspective, adult male silver pheasants can be visually distinguished from hybrids by their unique plumage and other characteristics. However, the morphological differences between chicks and females are not significant, making it difficult to accurately distinguish their species classification and hybridization based on appearance alone. These traditional identification methods often fail to accurately determine the species classification of hybrids, chicks, and females, which negatively impacts the conservation, management, and related scientific research of silver pheasants. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a SNP marker for the identification of silver pheasants. This SNP marker can effectively solve the identification difficulties caused by hybridization of silver pheasants and the difficulty in distinguishing the morphology of chicks and females, providing solid technical support for the protection, population monitoring, and related scientific research of silver pheasants.

[0006] To achieve the above objectives, the present invention provides an SNP marker for species identification of the silver pheasant, comprising at least one of SNP1-SNP29, as shown below:

[0007] SNP1 is located at position 52783760 of CM059454.1, with alleles A / T;

[0008] SNP2 is located at position 50674802 of CM059455.1, with alleles of G / T;

[0009] SNP3 is located at position 67434585 of CM059456.1, with alleles of G / T;

[0010] SNP4 is located at position 32909224 of CM059457.1, with alleles C / A;

[0011] SNP5 is located at position 45463750 of CM059458.1, with alleles C / A;

[0012] SNP6 is located at position 30596551 of CM059459.1, with alleles A / C;

[0013] SNP7 is located at position 25720838 of CM059460.1, with alleles A / C;

[0014] SNP8 is located at position 21092701 of CM059461.1, with alleles T / G;

[0015] SNP9 is located at position 11770694 of CM059462.1, with alleles T / G;

[0016] SNP10 is located at position 19293029 of CM059463.1, with alleles G / A;

[0017] SNP11 is located at position 15708961 of CM059464.1, with alleles of G / T;

[0018] SNP12 is located at position 16245322 of CM059465.1, with alleles T / C;

[0019] SNP13 is located at position 21062230 of CM059466.1, with alleles G / A;

[0020] SNP14 is located at position 17859502 of CM059467.1, with alleles A / GA;

[0021] SNP15 is located at position 391564 of CM059468.1, with alleles T / C;

[0022] SNP16 is located at position 13115183 of CM059469.1, with alleles A / C;

[0023] SNP17 is located at position 7524334 of CM059470.1, with alleles G / A;

[0024] SNP18 is located at position 2547686 of CM059471.1, with alleles G / A;

[0025] SNP19 is located at position 9926275 of CM059473.1, with alleles A / T;

[0026] SNP20 is located at position 8584648 of CM059474.1, with alleles T / A;

[0027] SNP21 is located at position 5367990 of CM059475.1, with alleles T / C;

[0028] SNP22 is located at position 887366 of CM059476.1, with an allele of C / T.

[0029] SNP23 is located at position 8044890 of CM059477.1, with alleles T / G;

[0030] SNP24 is located at position 2273112 of CM059478.1, with alleles T / A;

[0031] SNP25 is located at position 7208087 of CM059479.1, with alleles A / G;

[0032] SNP26 is located at position 1046139 of CM059480.1, with alleles A / G;

[0033] SNP27 is located at position 2788444 of CM059481.1, with alleles of G / C;

[0034] SNP28 is located at position 99795 of CM059482.1, with alleles T / G;

[0035] SNP29 is located at position 30285535 of CM059493.1, with alleles C / A.

[0036] Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, offer numerous significant advantages over previous genetic markers such as microsatellites. SNPs are widely distributed throughout the genome, covering the entire genome and providing more comprehensive genetic information, thus enabling precise identification of whether an individual is a hybrid offspring. They also exhibit low mutation rates and high stability, reducing identification errors caused by genetic marker mutations. Furthermore, SNPs are easy to genotype, greatly improving the convenience of experimental procedures and the accuracy of results. Based on these characteristics, screening for silver pheasant-specific SNPs for species identification has extremely high feasibility and application value. Therefore, the inventors propose the aforementioned SNP markers. By accurately identifying these silver pheasant-specific SNP loci, an efficient and accurate silver pheasant species identification system can be established, effectively solving the current identification difficulties caused by silver pheasant hybridization, and the difficulty in distinguishing the morphology of chicks and females. This provides solid technical support for silver pheasant conservation, population monitoring, and related scientific research.

[0037] In one embodiment, SNP1-SNP29 are included.

[0038] The present invention also provides a primer set for detecting the SNP marker, the primer set including at least one of primer pair 1 to primer pair 29, as shown below:

[0039] Primer pair 1 includes SEQ ID No. 1 and SEQ ID No. 2;

[0040] Primer pair 2 includes SEQ ID No. 3 and SEQ ID No. 4;

[0041] Primer pair 3 includes SEQ ID No. 5 and SEQ ID No. 6;

[0042] Primer pair 4 includes SEQ ID No. 7 and SEQ ID No. 8;

[0043] Primer pair 5 includes SEQ ID No. 9 and SEQ ID No. 10;

[0044] Primer pair 6 includes SEQ ID No. 11 and SEQ ID No. 12;

[0045] Primer pair 7 includes SEQ ID No. 13 and SEQ ID No. 14;

[0046] Primer pair 8 includes SEQ ID No. 15 and SEQ ID No. 16;

[0047] Primer pair 9 includes SEQ ID No. 17 and SEQ ID No. 18;

[0048] Primer pair 10 includes SEQ ID No. 19 and SEQ ID No. 20;

[0049] Primer pair 11 includes SEQ ID No. 21 and SEQ ID No. 22;

[0050] Primer pair 12 includes SEQ ID No. 23 and SEQ ID No. 24;

[0051] Primer pair 13 includes SEQ ID No. 25 and SEQ ID No. 26;

[0052] Primer pair 14 includes SEQ ID No. 27 and SEQ ID No. 28;

[0053] Primer pair 15 includes SEQ ID No. 29 and SEQ ID No. 30;

[0054] Primer pair 16 includes SEQ ID No. 31 and SEQ ID No. 32;

[0055] Primer pair 17 includes SEQ ID No. 33 and SEQ ID No. 34;

[0056] Primer pair 18 includes SEQ ID No. 35 and SEQ ID No. 36;

[0057] Primer pair 19 includes SEQ ID No. 37 and SEQ ID No. 38;

[0058] Primer pair 20 includes SEQ ID No. 39 and SEQ ID No. 40;

[0059] Primer pair 21 includes SEQ ID No. 41 and SEQ ID No. 42;

[0060] Primer pair 22 includes SEQ ID No. 43 and SEQ ID No. 44;

[0061] Primer pair 23 includes SEQ ID No. 45 and SEQ ID No. 46;

[0062] Primer pair 24 includes SEQ ID No. 47 and SEQ ID No. 48;

[0063] Primer pair 25 includes SEQ ID No. 49 and SEQ ID No. 50;

[0064] Primer pair 26 includes SEQ ID No. 51 and SEQ ID No. 52;

[0065] Primer pair 27 includes SEQ ID No. 53 and SEQ ID No. 54;

[0066] Primer pair 28 includes SEQ ID No. 55 and SEQ ID No. 56;

[0067] Primer pair 29 includes SEQ ID No. 57 and SEQ ID No. 58.

[0068] In one embodiment, the primer set includes primer pair 1 to primer pair 29.

[0069] The present invention also provides a detection system for species identification of silver pheasants, including an amplification system, wherein the amplification system includes the primer set described above.

[0070] The present invention also provides a kit for species identification of silver pheasants, the kit comprising the primer set or the detection system described above.

[0071] This invention also provides the application of the SNP marker, the primer set, the detection system, or the kit in the identification of silver pheasant species.

[0072] This invention also provides a method for species identification of silver pheasants, comprising the following steps: extracting DNA from the sample to be tested, performing PCR amplification using the primer set, the detection system, or the kit formulation described above, obtaining PCR amplification products, performing Sanger sequencing on the PCR amplification products to obtain the amplified target sequence of each SNP locus from the individual from which the sample to be tested originates, and comparing the sequence with that of a reference genome to obtain the genotype of the SNP marker.

[0073] In one embodiment, the Sanger sequencing is paired-end sequencing, and the primers are the primer set described above;

[0074] Alternatively, Sanger sequencing can be performed using the following primers for SNP1-SNP29:

[0075] SNP1 CTGCTTGAACTCCCCTCCTG;

[0076] SNP2 TTAGGCCATTGGCACTGGAG;

[0077] SNP3 TGACAGAAAGGGGAGCTTCG;

[0078] SNP4 GAGAGCAGTGCAAACTGCAA;

[0079] SNP5 GGGGAAGTGCAAATTTGGGTAG;

[0080] SNP6 CCCAGCCAAAGGAAACTTGC;

[0081] SNP7 TCCCAAGCAACATCTCCACT;

[0082] SNP8 TGAGGATGGCACAGCGAAAT;

[0083] SNP9 AGAAGAGAAGGCTGAGAAGCA;

[0084] SNP10 ATGCAAATGTCCTCCCCTGT;

[0085] SNP11 TGCAGAGTCTCATCCCCACT;

[0086] SNP12 GCAGCAGATGGATGCGTAGT;

[0087] SNP13 CTGCTGCTGCTCTGAGTCAC;

[0088] SNP14 AAACCCTCTGTGAGTCAGCAC;

[0089] SNP15 GGAGGTGAGGGTATCCTGCT;

[0090] SNP16 CGGGTCACCTCGAGTCATTC;

[0091] SNP17 CCAACGTTAGGCAGGCAATG;

[0092] SNP18 TCCTGGGCTGACTCCTTTCT;

[0093] SNP19 CCAAGGCTTGCTGTTGACTG;

[0094] SNP20 CCCTCTCGAGATCCCGTCT;

[0095] SNP21 GCATTCAGAGTGTCTGCTCCT;

[0096] SNP22 TAGCATGGGGACTCCTCAAC;

[0097] SNP23 AACTGAGAGCTCCCCTTCCT;

[0098] SNP24 TGCCAGAGCAGTCAATTCCT;

[0099] SNP25 GCTATGCTACTTCGTGCCCT;

[0100] SNP26 ACCAACACCAGCCTTTCCAT;

[0101] SNP27 TCACCTTGACCAACCTCCAA;

[0102] SNP28 AGGCTCCCATACTCTTCCGT;

[0103] SNP29 TGCTGAAAGAAATGGGGCTTG.

[0104] In one embodiment, the method further includes: determining whether the individual providing the test sample is a silver pheasant based on the genotype of the SNP marker.

[0105] In one embodiment, the site polymorphism of the SNP marker is represented as: allele 1 / allele 2, and the determination includes: when the genotype of the SNP marker of the individual is homozygous for allele 1, then the individual is determined to be a silver pheasant.

[0106] Compared with the prior art, the present invention has the following beneficial effects:

[0107] This invention discloses a SNP marker for species identification of silver pheasants and its application. This SNP marker can effectively solve the identification difficulties caused by current problems such as hybridization of silver pheasants and the difficulty in distinguishing the morphology of chicks and females, and provides solid technical support for the protection, population monitoring and related scientific research of silver pheasants. Detailed Implementation

[0108] To facilitate understanding of the present invention, a more complete description will be given below with reference to relevant embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that a thorough and complete understanding of the disclosure of the present invention will be achieved.

[0109] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0110] source:

[0111] Unless otherwise specified, all reagents, materials, and equipment used in this embodiment are commercially available; unless otherwise specified, all experimental methods are conventional experimental methods in this field.

[0112] Example

[0113] 1. Selection of specific SNP sites for silver pheasants.

[0114] 1.1 SNP dataset detection.

[0115] To construct a reliable SNP dataset, DNA was extracted from 34 individuals (13 silver pheasants, 12 blue pheasants, 6 black pheasants, and 3 Thai fire-backed pheasants) from the Guangzhou Zoo's Germplasm Bank for Endangered Wild Animals. After constructing the DNA library, paired-end 150bp sequencing was performed on the Illumina platform, with each sample's whole-genome resequencing data exceeding 10Gb. The raw reads after sequencing underwent quality control and were aligned to the chromosome-level reference genome of the blue pheasant (NCBI accession number: GCA_030408155.1) using BWA software. Since there is currently no chromosome-level reference genome for the silver pheasant, the inventors developed a reference genome based on the blue pheasant's chromosome level and applied it to the silver pheasant genome. The amplified fragments were then aligned to the silver pheasant genome using BLAST, showing high sequence similarity, thus enabling species identification of the silver pheasant. Subsequently, the alignment results were converted to a BAM file using Samtools software, and duplicate reads were removed using Picard software. Finally, SNP detection was performed using the HaplotypeCaller and GenotypeGVCFs commands in the Genome Analysis ToolKit software, followed by quality control using the VariantFiltration command. The quality control conditions were set as follows: "DP<50||DP>1000||QD<2.0||FS>60.0||MQ<40.0||MQRankSum<-12.5||ReadPosRankSum<-8.0||SOR>3.0||QUAL<30.0", --cluster-size 3, and --cluster-window-size 10, ultimately obtaining a reliable SNP dataset. 1.2 SNP site selection.

[0116] SNP datasets from four pheasant genera were further screened to select SNP loci suitable for individual identification. The screening criteria were: (1) homozygous loci in the silver pheasant genome were not present in the other three pheasant genera; (2) when the blast sequence of the 200 bp sequences flanking the SNP locus was aligned to the reference genome of the blue pheasant, only one SNP locus with a high degree of homology of more than 95% was retained; (3) there were no insertions or deletions within 200 bp flanking the SNP locus. Based on the above conditions, 29 SNP loci were pre-screened, located on 29 chromosomes, which cover the genome. Specific information is shown in Table 1.

[0117] Table 1. Information on 29 SNP sites specific to silver pheasants

[0118] SNP1 CM059454.1 52783760 A T SNP2 CM059455.1 50674802 G T SNP3 CM059456.1 67434585 G T SNP4 CM059457.1 32909224 C A SNP5 CM059458.1 45463750 C A SNP6 CM059459.1 30596551 A C SNP7 CM059460.1 25720838 A C SNP8 CM059461.1 21092701 T G SNP9 CM059462.1 11770694 T G SNP10 CM059463.1 19293029 G A SNP11 CM059464.1 15708961 G T SNP12 CM059465.1 16245322 T C SNP13 CM059466.1 21062230 G A SNP14 CM059467.1 17859502 A G SNP15 CM059468.1 391564 T C SNP16 CM059469.1 13115183 A C SNP17 CM059470.1 7524334 G A SNP18 CM059471.1 2547686 G A SNP19 CM059473.1 9926275 A T SNP20 CM059474.1 8584648 T A SNP21 CM059475.1 5367990 T C SNP22 CM059476.1 887366 C T SNP23 CM059477.1 8044890 T G SNP24 CM059478.1 2273112 T A SNP25 CM059479.1 7208087 A G SNP26 CM059480.1 1046139 A G SNP27 CM059481.1 2788444 G C SNP28 CM059482.1 99795 T G SNP29 CM059493.1 30285535 C A

[0119] 1.2 PCR amplification of SNP sites.

[0120] In addition, DNA samples from 5 silver pheasants, 6 blue pheasants, 3 black pheasants, and 4 Thai fire-backed pheasants (from the Guangzhou Zoo Endangered Wildlife Germplasm Bank) were selected to verify the 29 silver pheasant-specific SNP loci screened above.

[0121] Primers were designed based on the sequences flanking the SNP site. Detailed primer information is shown in Table 2.

[0122] The PCR amplification system consisted of 50 μL: 1 μL DNA, 25 μL PCR Mix (2×), 2 μL each of forward and reverse primers (10 pmol), and 20 μL ddH2O. The PCR program was as follows: 95℃, 5 min; 95℃, 30 s, 60℃, 30 s, 72℃, 30 s, 35 cycles; 72℃, 10 min; stored at 4℃.

[0123] The PCR products were subjected to 2% agarose gel electrophoresis, and the PCR products that met the target size were sent to Guangzhou Qingke Biotechnology Co., Ltd. for paired-end Sanger sequencing.

[0124] Table 2. Primer information for PCR amplification of 29 SNP sites.

[0125]

[0126]

[0127]

[0128] 1.3 SNP site analysis.

[0129] After obtaining paired-end sequencing data for each SNP locus, the sequencing sequence quality was checked using Chromas software, and high-quality locus sequences were retained. Then, Mega was used to assemble the paired-end sequences to obtain the amplified sequence for each SNP locus for each individual. This sequence was then compared with the reference genome sequence to obtain the genotype for each SNP locus. In this embodiment, the polymorphism of each SNP locus is represented as: allele 1 / allele 2.

[0130] The results showed that the silver pheasant was homozygous for allele 1 at all 29 SNP loci, while it was homozygous for allele 2 in the blue pheasant, black pheasant, and Thai fireback pheasant. In other words, when the test results for all 29 SNP loci were homozygous for allele 1, it was identified as a silver pheasant; otherwise, it was identified as a non-silver pheasant or a non-purebred silver pheasant. Specific SNP locus information is shown in Table 3.

[0131] Table 3. 29 specific SNP sites of the silver pheasant

[0132]

[0133] The above results indicate that these 29 SNP loci are all SNP loci specific to silver pheasants, which can be used to identify whether an individual is a silver pheasant, establish a purebred silver pheasant population, and provide important technical support for the genetic conservation of the silver pheasant species.

[0134] 1.4 Sanger sequencing primer selection.

[0135] To further reduce the sequencing cost for identification, Sanger sequencing primers were screened.

[0136] After PCR amplification of the 29 SNP loci, SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP12, SNP13, SNP14, SNP15, SNP16, SNP18, SNP19, SNP21, SNP23, SNP24, SNP25, SNP26, and SNP29 were sequenced using their forward primers, while SNP11, SNP17, SNP20, SNP22, SNP27, and SNP28 were sequenced using their reverse primers. The resulting SNP genotypes were consistent with the bidirectional sequencing results. Therefore, the Sanger sequencing step can also use a single primer for different loci to obtain effective and reliable SNP genotypes. Using this Sanger sequencing primer combination can reduce sequencing costs by half.

[0137] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0138] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. The application of a primer set for detecting SNP markers for silver pheasant species identification in silver pheasant species identification, characterized in that, This SNP marker consists of SNP1-SNP29, with the reference genome being the Blue Pheasant reference genome with NCBI accession number: GCA_030408155.

1. SNP1-SNP29 are shown below: SNP1 is located at position 52783760 of CM059454.1, with alleles A / T; SNP2 is located at position 50674802 of CM059455.1, with alleles of G / T; SNP3 is located at position 67434585 of CM059456.1, with alleles of G / T; SNP4 is located at position 32909224 of CM059457.1, with alleles C / A; SNP5 is located at position 45463750 of CM059458.1, with alleles C / A; SNP6 is located at position 30596551 of CM059459.1, with alleles A / C; SNP7 is located at position 25720838 of CM059460.1, with alleles A / C; SNP8 is located at position 21092701 of CM059461.1, with alleles T / G; SNP9 is located at position 11770694 of CM059462.1, with alleles T / G; SNP10 is located at position 19293029 of CM059463.1, with alleles G / A; SNP11 is located at position 15708961 of CM059464.1, with alleles of G / T; SNP12 is located at position 16245322 of CM059465.1, with alleles T / C; SNP13 is located at position 21062230 of CM059466.1, with alleles G / A; SNP14 is located at position 17859502 of CM059467.1, with alleles A / G; SNP15 is located at position 391564 of CM059468.1, with alleles T / C; SNP16 is located at position 13115183 of CM059469.1, with alleles A / C; SNP17 is located at position 7524334 of CM059470.1, with alleles G / A; SNP18 is located at position 2547686 of CM059471.1, with alleles G / A; SNP19 is located at position 9926275 of CM059473.1, with alleles A / T; SNP20 is located at position 8584648 of CM059474.1, with alleles T / A; SNP21 is located at position 5367990 of CM059475.1, with alleles T / C; SNP22 is located at position 887366 of CM059476.1, with an allele of C / T. SNP23 is located at position 8044890 of CM059477.1, with alleles T / G; SNP24 is located at position 2273112 of CM059478.1, with alleles T / A; SNP25 is located at position 7208087 of CM059479.1, with alleles A / G; SNP26 is located at position 1046139 of CM059480.1, with alleles A / G; SNP27 is located at position 2788444 of CM059481.1, with alleles of G / C; SNP28 is located at position 99795 of CM059482.1, with alleles T / G; SNP29 is located at position 30285535 of CM059493.1, with alleles C / A.

2. A primer set for detecting SNP markers for species identification of the silver pheasant in the application described in claim 1, characterized in that, This primer set consists of primer pair 1 to primer pair 29, as shown below: Primer pair 1 is SEQ ID No. 1 and SEQ ID No. 2; Primer pair 2 is SEQ ID No. 3 and SEQ ID No. 4; Primer pair 3 is SEQ ID No. 5 and SEQ ID No. 6; Primer pair 4 is SEQ ID No. 7 and SEQ ID No. 8; Primer pair 5 is SEQ ID No. 9 and SEQ ID No. 10; Primer pair 6 are SEQ ID No. 11 and SEQ ID No. 12; Primer pair 7 is SEQ ID No. 13 and SEQ ID No. 14; Primer pair 8 is SEQ ID No. 15 and SEQ ID No. 16; Primer pair 9 is SEQ ID No. 17 and SEQ ID No. 18; Primer pair 10 is SEQ ID No. 19 and SEQ ID No. 20; Primer pair 11 is SEQ ID No. 21 and SEQ ID No. 22; Primer pair 12 is SEQ ID No. 23 and SEQ ID No. 24; Primer pair 13 is SEQ ID No. 25 and SEQ ID No. 26; Primer pair 14 is SEQ ID No. 27 and SEQ ID No. 28; Primer pair 15 is SEQ ID No. 29 and SEQ ID No. 30; Primer pair 16 is SEQ ID No. 31 and SEQ ID No. 32; Primer pair 17 is SEQ ID No. 33 and SEQ ID No. 34; Primer pair 18 is SEQ ID No. 35 and SEQ ID No. 36; Primer pair 19 is SEQ ID No. 37 and SEQ ID No. 38; Primer pair 20 is SEQ ID No. 39 and SEQ ID No. 40; Primer pair 21 is SEQ ID No. 41 and SEQ ID No. 42; Primer pair 22 is SEQ ID No. 43 and SEQ ID No. 44; Primer pair 23 is SEQ ID No. 45 and SEQ ID No. 46; Primer pair 24 is SEQ ID No. 47 and SEQ ID No. 48; Primer pair 25 is SEQ ID No. 49 and SEQ ID No. 50; Primer pair 26 is SEQ ID No. 51 and SEQ ID No. 52; Primer pair 27 is SEQ ID No. 53 and SEQ ID No. 54; Primer pair 28 is SEQ ID No. 55 and SEQ ID No. 56; Primer pair 29 is SEQ ID No. 57 and SEQ ID No.

58.

3. A detection system for species identification of the silver pheasant, characterized in that, It includes an amplification system, wherein the amplification system comprises the primer set as described in claim 2.

4. A kit for species identification of silver pheasants, characterized in that, The kit includes the primer set as described in claim 2 or the detection system as described in claim 3.

5. The application of the primer set of claim 2, the detection system of claim 3, or the kit of claim 4 in the identification of silver pheasant species.

6. A method for species identification of the silver pheasant, characterized in that, Includes the following steps: DNA is extracted from the sample to be tested, and PCR amplification is performed using the primer set described in claim 2, the detection system described in claim 3, or the kit described in claim 4 to obtain PCR amplification products. The PCR amplification products are then subjected to Sanger sequencing to obtain the amplification target sequence of each SNP site of the individual from which the sample to be tested is obtained. The sequence is compared with that of the reference genome to obtain the genotype of the SNP marker in the application described in claim 1. Based on the genotype of the SNP marker, it is determined whether the individual providing the sample to be tested is a silver pheasant. The reference genome is the blue pheasant reference genome with NCBI accession number: GCA_030408155.

1.

7. The method according to claim 6, characterized in that, The Sanger sequencing is paired-end sequencing, and the primers are the primer set described in claim 2.

8. The method according to claim 6, characterized in that, The Sanger sequencing was performed on SNP1-SNP29 using the following primers: The primer for SNP1 is CTGCTTGAACTCCCCTCCTG; The primer for SNP2 is TTAGGCCATTGGCACTGGAG; The primer for SNP3 is TGACAGAAAGGGGAGCTTCG; The primer for SNP4 is GAGAGCAGTGCAAACTGCAA; The primer for SNP5 is GGGGAAGTGCAAATTTGGGTAG; The primer for SNP6 is CCCAGCCAAAGGAAACTTGC; The primer for SNP7 is TCCCAAGCAACATCTCCACT; The primer for SNP8 is TGAGGATGGCACAGCGAAAT; The primer for SNP9 is AGAGAGAAGGCTGAGAAGCA; The primer for SNP10 is ATGCAAATGTCCTCCCCTGT; The primer for SNP11 is TGCAGAGTCTCATCCCCACT; The primer for SNP12 is GCAGCAGATGGATGCGTAGT; The primers for SNP13 are CTGCTGCTGCTCTGAGTCAC; The primer for SNP14 is AAACCCTCTGTGAGTCAGCAC; The primer for SNP15 is GGAGGTGAGGGTATCCTGCT; The primer for SNP16 is CGGGTCACCTCGAGTCATTC; The primer for SNP17 is CCAACGTTAGGCAGGCAATG; The primer for SNP18 is TCCTGGGCTGACTCCTTTCT; The primer for SNP19 is CCAAGGCTTGCTGTTGACTG; The primer for SNP20 is CCCTCTCGAGATCCCGTCT; The primer for SNP21 is GCATTCAGAGTGTCTGCTCCT; The primer for SNP22 is TAGCATGGGGACTCCTCAAC; The primer for SNP23 is AACTGAGAGCTCCCCTTCCT; The primer for SNP24 is TGCCAGAGCAGTCAATTCCT; The primer for SNP25 is GCTATGCTACTTCGTGCCCT; The primer for SNP26 is ACCAACACCAGCCTTTCCAT; The primers for SNP27 are TCACCTTGACCAACCTCCAA; The primer for SNP28 is AGGCTCCCATACTCTTCCGT; The primer for SNP29 is TGCTGAAAGAAATGGGGCTTG.