InDel marker of brown glume character of rice, regulatory gene and application thereof
By discovering the brown husk trait caused by the deletion of exons in the polyphenol oxidase gene in rice, and using InDel markers and gene editing technology, the problems of high labor intensity and low efficiency in hybrid rice seed production were solved, enabling targeted modification of rice husk color and supporting the mechanization of hybrid rice seed production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUNAN AGRI UNIV
- Filing Date
- 2025-09-12
- Publication Date
- 2026-07-21
AI Technical Summary
Existing technologies are labor-intensive and inefficient in the process of hybrid rice seed production, making it difficult to achieve full mechanization. Furthermore, the genetic regulation mechanism of rice husk color is complex and lacks effective genetic resources.
By discovering and utilizing the brown glume trait caused by a 6 bp deletion in the exon region of the polyphenol oxidase encoding gene (LOC_Os04g53300), InDel markers were designed and combined with gene editing technology to achieve precise editing in rice, resulting in brown or normal glume materials.
This invention provides a method for rapidly and directionally obtaining brown glumes, which improves the mechanization efficiency of hybrid rice seed production, provides suitable parent materials, and offers an efficient and feasible method for achieving fully mechanized seed production.
Smart Images

Figure CN121065386B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of crop genetics and relates to the application of polyphenol oxidase genes. Background Technology
[0002] Hybrid rice seed production still mainly relies on manual sowing, transplanting, pollination, and harvesting techniques, resulting in high production costs, high labor intensity, and low efficiency (Wang Jie et al., Anhui Agricultural Sciences, 2013, 41: 5682-5683+5686; Xia Yumei et al., Hybrid Rice, 2020, 35: 1-5). Among these methods, the mechanized mixed sowing of both parent lines is an effective way to achieve full mechanization of hybrid rice seed production, thereby improving its seed production efficiency (Xia Yumei et al., Hybrid Rice, 2020, 35: 1-5). Mechanized seed production based on the mixed sowing of hybrid rice parents requires that the parents have the same or similar growth period and be mixed and sown in an appropriate ratio. On this basis, different technical means are needed to separate the hybrid and the restorer line self-pollinated at harvest, or to remove the male parent and produce only the hybrid, so as to achieve full mechanization (Tang Wenbang et al., Chinese Journal of Rice Science, 2020, 34:95-103). By taking advantage of the differences between the male and female seeds, physical means are used to separate the hybrid and the self-pollinated after mixed harvest (Tang Wenbang et al., Chinese Journal of Rice Science, 2020, 34:95-103). For example, if the parents with different glumes are selected, the two can be separated by a microcomputer color sorter (Xu Ke et al., Hybrid Rice, 2018, 33(04):17-21).
[0003] The color of cultivated rice varieties is often manifested in the traits of the outer glume, inner glume, glumes, lemma tips, stigma, seed coat, awns, leaf sheaths, leaves, and internodes. Studies have shown that the main substances causing color changes in rice are flavonoids (Xu Xia et al., Chinese Journal of Rice Science, 2015, 29:335-342). Glume color is a marker that can be identified after rice heading, and its trait is relatively stable and less affected by the environment (He Libin et al., Zhejiang Journal of Agricultural Sciences, 2001, 13:357-360). The inheritance of rice color genes is complex, with some controlled by a single gene and others by 2-3 pairs of interacting genes. Compared with the conventional yellow glume color of cultivated rice, abnormal glume colors mainly include golden yellow, black, and brown (Li Hui et al., Biological Resources, 2021, 43:427-434). The main reported mutant of rice glume color is the golden glume mutant. gh-1, gh-2, gh-3, gh-4, gh-5 and gh-6 And, as well as the brown husk mutant ibfl , bh6 , bh1 , fb1 and M47286(Li et al., Biological Resources, 2021, 43: 427-434), while black husks are a trait of common wild rice (Zhu et al., Plant physiol., 2011, 155: 1301-1311). Among them, gh-1 and gh-2 Due to the genes regulating flavonoid pigments OsCHI Mutations in the cinnamyl alcohol dehydrogenase gene in the lignin synthesis pathway lead to golden-yellow glumes and internodes in rice (Hong et al., Planta, 2012, 236: 141-151; Zhang et al., Plant physiol., 2006, 140: 972-983), and brown husk inhibitors. IBF1 It can regulate the synthesis and deposition of pigments in rice husks and inhibit... BF The latter may be affected OsKF1 Regulation (Xu Xia et al., Chinese Journal of Rice Science, 2015, 29:335-342), OsBh4 It encodes an amino acid transporter protein that is involved in regulating the formation of the black husk phenotype in rice (Zhu et al., Plant physiol., 2011, 155:1301-1311).
[0004] Therefore, the genetic regulation mechanism of rice husk color is relatively complex and remains unclear. More related genes need to be cloned for further exploration, so as to provide favorable resources for breeding suitable hybrid rice parents for large-scale seed production. Summary of the Invention
[0005] This invention proposes an InDel marker, regulatory gene, and application for the brown husk trait in rice, providing a new approach to altering the color of rice husks.
[0006] The technical solution of this invention is implemented as follows: This application is based on brown glume mutant material with the background of Xiangzaoxian 42. Genetic analysis showed that this phenotype was caused by a single gene dominant mutation. Gene localization revealed that the mutation site was located in an exon region of a polyphenol oxidase encoding gene (MSU_Locus is LOC_Os04g53300), where a 6 bp deletion (GCGACT) was found, resulting in the brown glume of the material. Knocking out this gene in the brown glume mutant material resulted in normal glume color. Precise editing was performed on the wild-type material of Xiangzaoxian 42 to obtain material with the corresponding 6 bp (GCGACT) deletion, which showed brown glume.
[0007] On the one hand, protection is requested for an InDel marker for the brown husk trait in rice, wherein the InDel marker is an acquired molecular marker with the nucleotide sequence GCGACT, located at bases 31751341-31751346 on chromosome 4 of rice (base positions refer to published data). Oryza sativa ssp japonica cv. Nipponbare Sequences between genomes.
[0008] On the other hand, a gene lacking the aforementioned InDel marker was provided, namely the sequence obtained after deleting the InDel marker from gene number LOC_Os04g53300. The nucleotide sequence of Xiangzaoxian 42 after deleting the InDel marker is shown in SEQ ID No. 1.
[0009] The second claim seeks protection for the application of the aforementioned InDel marker or the aforementioned gene in altering the color of rice husks.
[0010] The steps for the above application are selected from any of the following: ① Using gene editing technology, rice materials were constructed that lacked the InDel marker mentioned above in the LOC_Os04g53300 gene; ② Construct rice materials containing the genes with the InDel marker sequence deletion mentioned above; ③ Using gene editing technology, rice materials containing the gene with the missing InDel marker sequence LOC_Os04g53300 were knocked out.
[0011] The third claim seeks protection for a method for preparing brown-hulled rice material, the steps of which are as follows: (1) Construct a gene-editing vector based on the InDel marker and gene design template sequence and primer pairs described above; (2) Using the precise editing carrier of step (1), rice plants lacking the above InDel markers were prepared against the background of normal colored glumes rice to be improved, i.e. brown glumes rice material.
[0012] Furthermore, the template sequence in step (1) above is shown in SEQ ID No. 2; the primer pair sequences in step (1) above are shown in SEQ ID No. 3 and SEQ ID No. 4.
[0013] The application of the brown glume mutant prepared using the above method is selected from any of the following: ① Germplasm innovation; ② Cultivation of hybrid rice parent lines.
[0014] The present invention has the following beneficial effects: This invention reveals a novel function of a polyphenol oxidase-encoding gene (MSU_Locus: LOC_Os04g53300), with a 6 bp deletion (GCGACT) at a specific site in its exon sequence, resulting in brown husks in rice. Knocking out this gene in brown husk mutant materials restores the husk color to normal. Compared to existing technologies, the method of this invention is highly innovative, being the first to discover an association between the InDel marker with a 6 bp deletion (GCGACT) and the brown husk trait, and that the polyphenol oxidase-encoding gene (MSU_Locus: LOC_Os04g53300) controls husk color production. Furthermore, this invention establishes a rapid and targeted method for obtaining brown husks, namely, precisely editing the polyphenol oxidase-encoding gene to obtain materials with a 6 bp deletion at the corresponding sequence site, resulting in brown husks. This provides an efficient and feasible method for creating materials suitable for mechanized hybrid rice seed production. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0016] Figure 1 The glume phenotype is that of the brown glume mutant.
[0017] Figure 2 Phenotypic analysis of backcross F1 and F2.
[0018] Figure 3 For gene localization interval analysis.
[0019] Figure 4 This is a comparison diagram of the mutation site and nearby sequences of the hcm mutant with the reference gene sequence of Nipponbare.
[0020] Figure 5 This is a comparison diagram of the amplified sequence corresponding to Xiangzaoxian 42 and the reference gene sequence of Nipponbare.
[0021] Figure 6 The structure diagram of the knockout vector for the polyphenol oxidase gene in the brown husk mutant material.
[0022] Figure 7 Sequence and phenotypic analysis of polyphenol oxidase gene knockout material for brown glumes mutant materials.
[0023] Figure 8 A precisely edited carrier structure diagram for Xiangzaoxian No. 42.
[0024] Figure 9 The glumes phenotypes of Xiangzaoxian 42 are precisely edited materials and controls, among which C27, C28, C29 and C30 are precisely edited lines.
[0025] Figure 10 The sequencing results of the PCR amplified sequences of C28, C29, and C30 of the precise edited material for Xiangzaoxian 42 were compared with the sequences of wild-type Xiangzaoxian 42 and the hcm mutant.
[0026] Figure 11 The sequencing peak diagram of the PCR amplification sequence of material C27 for Xiangzaoxian 42 was analyzed online on the website (http: / / skl.scau.edu.cn / dsdecode / ). Detailed Implementation
[0027] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0028] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0029] Example 1: Radiation-induced mutagenesis of Xiangzaoxian 42 to obtain mutant material with brown glumes and mutant gene. In a radiation-induced mutation library using Xiangzaoxian 42 as the parent, under normal planting and conventional water and fertilizer management, a mutant was found whose glumes turned brown. hcm (Hull-colored mutant), this trait has been stable after multiple generations of self-pollination and has been named Shihei No. 1. The rice seed hcm was deposited on July 15, 2025, at the China Center for Type Culture Collection (Wuhan, China), classified as *Oryza sativa* hcm, with accession number CCTCC NO: P202521, and deposited at Wuhan University, Wuhan, China. The mutant exhibits a brown glume color, significantly different from the yellow glumes of the control. Figure 1 ).
[0030] Will hcm Using conventional hybridization methods, the wild-type Xiangzaoxian 42 was backcrossed with the BC1F1 cultivar 42, with the BC1F1 cultivar 42 serving as the female and male parents respectively. After seed harvest, normal sowing and planting were carried out, with routine water and fertilizer management. The glumes color of the BC1F1 plants was examined at harvest. The results showed that regardless of the color of the glumes, the BC1F1 cultivar 42 was successfully backcrossed with the wild-type Xiangzaoxian 42. hcmWhen used as the female or male parent, the color of the seeds produced by its BC1F1 plants is similar to... hcm The mutants are identical, all being brown. Figure 2 This indicates that this color trait is controlled by a dominant gene, that is... hcm The mutation type is a dominant mutation.
[0031] BC1F2 seeds were harvested and planted at the Hunan Agricultural University Rice Research Institute. Observation of the glume phenotype in the BC1F2 population showed obvious segregation in glume color. If this phenotype is controlled by a dominant gene, then the number of glumes with brown color in this population should be about three times that of normal glumes. Statistical analysis of the phenotype was performed, and the chi-square test results showed that in nine independent experiments... p All values are greater than 0.05. Figure 2 The result indicates that the experimental data conforms to a segregation ratio of 3:1. This further demonstrates that the phenotype of this mutant is controlled by a single dominant gene locus.
[0032] Using ZH11 and hcm Hybridization was performed, and self-pollination was continued to obtain the F2 population. These were planted at the Yunyuan Base of Hunan Agricultural University. During the grain-filling stage, leaves from plants exhibiting brown glumes (poo11) and normal yellow glumes (pool2) were selected based on glume color and mixed in equal amounts. Parental lines ZH11 and... hcm The mutant leaves were used as a reference. Wuhan Shuanglvyuan Chuangxin Technology Research Institute Co., Ltd. was commissioned to conduct differential analysis and comparison among samples using GSR40K (patent name: Rice Green Gene Chip and Application; application number 2018800836058).
[0033] DNA was extracted from leaf samples using conventional methods. DNA concentration was measured using a UV spectrophotometer, and DNA meeting quality requirements (concentration above 50 ng / μL, 260 / 280 between 18 and 2.0) was uniformly diluted to a concentration of 50-100 ng / μL. The DNA template was first denatured into single strands using NaOH, neutralized, and then reacted with whole-genome amplification reagent at 37°C for 20-24 hours. The amplified whole-genome DNA was then broken down into small fragments and reacted at 37°C for 1 hour. The fragmented DNA was then mixed thoroughly with isopropanol and other reagents, incubated at 4°C for 30 minutes, and then centrifuged at 3000g for 20 minutes. After discarding the supernatant, the DNA was dried at room temperature for 1 hour; a solvent (containing 10%-30% formamide) was added to dissolve the DNA, and the mixture was incubated at 48°C for 1 hour; the resuspended DNA was then placed in a dry bath at 95°C for 20 minutes; the cooled DNA was spotted onto the corresponding positions on the chip, and the mixture was incubated in a hybridization oven at 48°C for 16-24 hours; after hybridization, the chip underwent single-base extension, with fluorescent signals on the bases, thus increasing the intensity of the fluorescence signal for easy scanning; the chip was scanned using an iScan scanner; the raw data generated by the scan was analyzed and genotyped using Genome Studio software. Based on the Nipponbare Genome 6th Edition, the framework of each chromosome was constructed, and the relationship between specific loci of the offspring and parental genotypes was compared.
[0034] like Figure 3 As shown, the obvious differential regions between pool 11 and pool 2 are located on chromosomes 4, 6, and 12. Considering that pool 2 has the same phenotype as ZH11 (i.e., the genotype of the trait-related region in pool 2 is the same as that in ZH11, shown in red), and that this gene is a dominant mutation, meaning the heterozygous genotype in F2 is brown husk, the differential regions on chromosomes 6 and 12 are excluded. Therefore, it is inferred that the trait-related region is located within the 1.7MB region of Chr04, ranging from 30.9 to 32.6MB. Figure 3 The area indicated by the red arrow.
[0035] Furthermore, utilizing hcmThe BC1F2 population, constructed with wild-type Xiangzaoxian 42, was analyzed using BSA (bμLk segregant analysis) phenotypic mapping based on genome resequencing. Gene resequencing was commissioned to BGI Genomics, with 12Gb of data from each parent and 20Gb from each of the two pools. Based on the resequencing data, Chengdu Besbayer Biotechnology Co., Ltd. was commissioned to perform splicing and comparative analysis using the MH63 genome (http: / / rice.hzau.edu.cn / cgi-bin / gb2 / gbrowse / MH63RS2 / ) as a reference. The analysis revealed only one phenotypic candidate gene (MSU_Locus: LOC_Os04g53300) within the aforementioned 1.7MB region of Chr04, suggesting that this gene is likely... hcm A gene that mutates the brown husk. This gene encodes a polyphenol oxidase, in... hcm The mutant gene has a 6-base deletion in its exon region (GCGACT).
[0036] Using primers: PO-BamH1F3: CCGCACGGGATCCACCGCGA; PO-Sac1R3: tagcGAGCTCCGTATGTGACATGCAGGAAGC.
[0037] Xiangzaoxian No. 42 and hcm Leaf DNA was used as a template for PCR to amplify a 637 bp sequence containing the mutation site. After sequencing, the sequence was compared with the Nipponbare reference genome sequence (https: / / rapdb.dna.affrc.go.jp / tools / blast) to confirm the mutation site. hcm The corresponding 6 bp sequence (GCGACT) is missing in the wild type. Figure 4 The sequence shown in the red box is missing at positions 31751341-31751346 on chromosome 4 of the Nipponbare genome. Figure 4 and Figure 5 Since the base preceding GCGACT is T, this deleted sequence can also be interpreted as TGCGAC, corresponding to bases 31751340-31751345 on chromosome 4 of the Nipponbare genome. Figure 4 and Figure 5 Subsequently, five pairs of primers were synthesized based on the Nipponbare reference gene sequence: POHind3F1:ATCCCAAGCTTCCGATATGATCAACGACGTTCGCTC; PO-Pst1R1:GGTCGACCCTGCAGGACACG; PO-Section2F1: CGCCATGGAGAGCATCAACGTA; PO-Section2R1: CATGGGAAGAAGAGCCAGCA; PO-Section2F2: GCCGTTGCGCTCATGAAGAA; PO-Section2R2:CCCAGTATCCTCTCATGGAAGTAC; PO-Section2F3:GAGTGGCTCATGAGATTCTGTG; PO-Section2R3:AAGAAGAAGCTGGCGTCGAG; 2F4-4: CAACCCCGTCCACAGATGGA; 2R4-4: GCCGATGTCGTCCAGCAAGT.
[0038] Xiangzaoxian No. 42 and hcm Using mutant leaf DNA as templates, the gene nucleotide sequence containing exons, introns, UTRs, and part of the promoter sequence was obtained from Xiangzaoxian 42 and hcm mutants after amplification, sequencing, and splicing. hcm Except for the deletion of 6 bp (GCGACT), the mutant sequence is no different from that of Xiangzaoxian 42. The nucleotide sequence of the gene LOC_Os04g53300 in Xiangzaoxian 42 that lacks the InDel marker is shown in SEQ ID No. 1.
[0039] Example 2: Knocking out this gene in brown husk mutant material resulted in normal husk color. Given hcm The mutant is a dominant mutation in a single gene; this invention knocks out the mutant. hcm Candidate genes in the mutant were identified to determine whether the husk had returned to normal.
[0040] In March 2022, with hcmUsing mutants as a background, CRISPR-Cas9 gene editing technology was employed to design a dual-target knockout model. The knockout target sites were T1: GCGAGGGTACTCTGGAGGT and T2: GCTTTGCACCGCAAGACGA. Gene knockout design, vector construction, and rice genetic transformation were commissioned to Wuhan Boyuan Biotechnology Co., Ltd., following the methods described in the literature (Xing et al. BMC Plant Biology 2014, 14:327). The vector diagram is shown below. Figure 6 As shown.
[0041] The specific construction steps are as follows: 1. Synthesize the following template sequence and amplification primers using conventional chemical synthesis methods. template: Gcgaagggtactctggaggtgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcagctcttgcaccgcaagacga; Primers: 40166_0(+):cagtGGTCTCatgcagcgaagggtactctggaggtg; 40166_0(-):cagtGGTCTCaaaactcgtcttgcggtgcaagagctgc.
[0042] 2. Prepare a 50 μL system and perform the amplification reaction according to the following procedure: PCR system and procedure Component volume Nuclease-free Water 20μL Biorun Pfu PCR Mix 25μL 40166_0(+) (100uM) 2μL 40166_0(-) (100uM) 2μL Template 1μL Total volume 50μL PCR program Number of steps 94℃ for 5 min 1 94℃ for 30 seconds 50℃ for 45 seconds 30 seconds 72℃ for 12 seconds 30 seconds 72℃ for 10 minutes 1 16℃ for 30 minutes Electrophoresis was performed on a 1.5% agarose gel at 5 V / cm for 20 minutes. The T1-T2 (193 bp) fragment was excised under UV light and placed in a system for sol-gel recovery. The recovery procedure is detailed in the manufacturer's kit instructions. The recovered DNA was dissolved in 30 μL of water (the recovered product was labeled as rDNAt1). After verification, the DNA was ligated into the vector.
[0043] 3. Enzyme digestion and ligation Enzyme ligation system and reaction conditions Component volume Nuclease-free Water 8μL 10*Buffer 2μL BsaI / Eco31I 1μL T4 ligase 1μL Plasmid vector 4μL rDNAt1 4μL total 20μL Reaction conditions: Number of steps 37℃ for 20 min 1 37℃ for 10 min 5 20℃ for 10 minutes 5 37℃ for 20 min 1 80℃ for 5 min 1 4. Transformation 5 μL of the ligation product was transformed into competent E. coli cells using standard methods, and the cells were then plated in kanamycin-resistant agar plates and incubated at 37°C for 12 hours.
[0044] 5. Positive clones were identified by sequencing, and plasmids were extracted and transformed into Agrobacterium EHA105. The transformation was performed using Agrobacterium-mediated callus transformation. hcm Mutant.
[0045] After the test-tube seedlings stabilized, the obtained transgenic lines were amplified and sequenced to identify the target fragment, and effective knockout mutant materials were screened and obtained. The TGFast™ Plant Genome Rapid Extraction Kit (catalog number: TM0301) was used, following the instructions. Specific PCR amplification primers were designed targeting the location of the CRISPR material's target site. PO-Section2F1: CGCCATGGAGAGCATCAACGTA; PO-Section2R1: CATGGGAAGAAGAGCCAGCA; Genotyping of mutants was performed. Using the extracted DNA as a template, the gene fragment was amplified by PCR using the aforementioned primers. After sequencing, the amplified fragment sequences were compared to screen for mutant plants (CrPO-1 and CrPO-2) with deletions or additions of the gene target site sequence that were not multiples of 3. Planting continued, with routine water and fertilizer management until harvest. The color of the husks of the knockout materials was observed, and all recovered to a normal yellow color. Figure 7 ).
[0046] Example 3: Precise editing was performed on wild-type material to obtain material with a corresponding 6bp deletion, whose glumes exhibited a brown color. In November 2023, using Xiangzaoxian 42 as a case study, precise gene editing technology (Lin et al., Nature Biotechnology, 2021, 39: 923-927) was employed to precisely edit the HCM gene. The gene editing design, vector construction, and plant genetic transformation were entrusted to Wuhan Boyuan Biotechnology Co., Ltd. The precise editing vector is as follows: Figure 8 As shown, the carrier construction process is as follows: The template sequence and amplification primers were synthesized using conventional chemical synthesis methods. Template (SEQ ID No.2): aggaagacggaggcgaggttgtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctccagcaatatgccgaacctcgcctccgtcaaataagcttgacgcggttctatctagttacgcgttaaaccaactaga aaaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcacggcgccagcgcg acgctgcgtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc Primers: D15738_0C1(+): cagtCGTCTCatgcaaggaagacggaggcgaggttg (SEQ ID No. 3); D15738_0C1(-): cagtCGTCTCatcaagcaccgactcggtgccac (SEQ ID No. 4).
[0047] 2. Prepare a 50 μL system and perform the amplification reaction according to the following procedure: PCR system and procedure Component volume Nuclease-free Water 20μL Biorun Pfu PCR Mix 25μL D15738_0C1(+) (100uM) 2μL D15738_0C1(-) (100uM) 2μL Template 1μL Total volume 50μL PCR program Number of steps 94℃ for 5 min 1 94℃ for 30 seconds 50℃ for 45 seconds 30 seconds 72℃ for 22 seconds 30 seconds 72℃ for 10 minutes 1 16℃ for 30 minutes Using 1.5% agarose gel electrophoresis at 5V / cm for 20 minutes, the T1-T2 (369bp) electrophoretic fragment was excised under UV light and placed in a system for sol-gel recovery. The recovery procedure is detailed in the manufacturer's kit instructions. The recovered DNA was dissolved and recovered in 30μL of water (the recovered product was labeled as rDNAT1). After verification, it was ligated into the vector.
[0048] 3. Vector enzyme digestion Enzyme ligation system Component volume Nuclease-free Water 13μL 10*Buffer 2μL BsaI / Eco31I 1μL Plasmid vector 4μL Total 20μL Reaction conditions: 37℃, enzyme digestion for 1 hour 4. rDNAT1 digestion Enzyme ligation system and reaction conditions Component volume Nuclease-free Water 13μL 10*Buffer 2μL BsmBI / Esp3I 1μL rDNAT1 4μL Total 20μL Reaction conditions: 37℃ for 1 hour The vector digests and recovered fragment digests were combined and purified using a PCR purification kit (the purified product was labeled p-rDNAT1) for use in the next ligation reaction. 5. Connection reaction reaction system Component volume Nuclease-free Water 5.5μL 10*Buffer 1μL T4 ligase 1μL p-rDNAT1 2.5μL Total 10μL Reaction conditions: 20℃, 1 hour 6. Transformation Transform 5 μL of the ligation product into competent E. coli cells using standard methods. 7. Positive clones were identified by sequencing, and plasmids were extracted and transformed into Agrobacterium EHA105. Using Agrobacterium-mediated callus transformation, Xiangzaoxian 42 was transformed, and positive lines were obtained through screening.
[0049] Four mutant strains (C27, C28, C29, C30) provided by the company were planted in Changsha in 2024. Under standard water and fertilizer management, by harvest time, the glumes of all four strains were brown. Figure 9 After extracting DNA from leaves at harvest, the DNA was amplified using primers J78458-F2 (6bp): cgtcatcgaggggatcgag and J78458-380R2 (6bp): cacaaatccgtctctccatctg, followed by sequencing. The sequences were compared with those of wild-type Xiangzaoxian 42 and the hcm mutant. Analysis revealed a 6bp homozygous deletion at this gene locus in all three materials (C28, C29, C30), and the deleted sequence was identical to that of the hcm mutant. Figure 10 Another strain, C27, had its sequencing peak diagram decoded using default parameters on the website (http: / / skl.scau.edu.cn / dsdecode / ), revealing a heterozygous 6 bp deletion. Figure 11 The above successfully achieved targeted, rapid, and precise editing of the characteristic sequence of this gene (MSU_Locus is LOC_Os04g53300) in wild-type materials, obtaining materials with a corresponding 6 bp deletion (GCGACT), whose glumes exhibit a brown color. This application example provides a foundation for subsequent use of this gene sequence to modify the glume traits of restorer line materials, thereby realizing mechanized seed production based on mixed sowing and harvesting.
[0050] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. The application of a gene in altering the color of rice husks, characterized by: The nucleotide sequence of the gene is shown in SEQ ID No. 1; The steps of the application are selected from any of the following: ① Using gene editing technology, rice material containing the gene shown in SEQ ID No. 1 was constructed in rice Xiangzaoxian 42, and rice material with brown glumes was obtained; ② Using gene editing technology, the gene containing the gene shown in SEQ ID No. 1 was knocked out in the rice mutant hcm to obtain rice material with yellow husk color.
2. A method for preparing brown-hulled rice material, characterized in that, The steps are as follows: (1) Design template sequences and primer pairs to construct a precise editing vector in rice Xiangzaoxian 42; the template sequence is shown in SEQ ID No.2, and the primer pair sequences are shown in SEQ ID No.3 and SEQ ID No.4; (2) Using the precise editing carrier from step (1), with the rice to be improved as the background, a precise editing plant, namely brown glumes rice material, is prepared.
3. The application of the brown husk rice material prepared using the method of claim 2, characterized in that, The application is for cultivating brown-hulled rice germplasm or as a parent line for hybrid rice.