LbCas12a protein mutant and preparation method and application thereof

CN121087014BActive Publication Date: 2026-09-29HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511320180.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-16
Publication Date
2026-09-29
Estimated Expiration
2045-09-16

AI Technical Summary

Technical Problem

[0003]但在实际应用的过程中CRISPR/Cas系统仍然面临着巨大的挑战,如切割效率和检测灵敏度不足

Benefits of technology

(1)本发明通过对LbCas12a蛋白进行定向改造,在K390/K945位发生丙氨酸突变,制备得到了LbCas12a-K390A、LbCas12a-K945A蛋白突变体,基于该方法得到的蛋白突变体,在功能上展现出一系列显著优势,为其在多领域的应用奠定了坚实基础。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121087014B_ABST
    Figure CN121087014B_ABST
Patent Text Reader

Abstract

The application discloses a LbCas12a protein mutant and a preparation method and application thereof, the LbCas12a protein mutant is a mutation of K390A or K945A on a wild type LbCas12a protein, and the amino acid sequence of the wild type LbCas12a protein is shown as SEQ ID NO. 1. The application carries out directional modification on the LbCas12a protein, and the alanine mutation occurs at the positions of K390 / K945, so that the LbCas12a-K390A and LbCas12a-K945A protein mutants are prepared, the protein mutant obtained based on the method exhibits a series of significant advantages in function, and lays a solid foundation for the application of the protein mutant in multiple fields. Through Michaelis-Menten kinetics analysis, it is observed that when the LbCas12a-K390A / K945A protein mutant prepared by the application and the wild type LbCas12a protein target the same dsDNA target, the catalytic efficiency (expressed by Kcat / Km) of the LbCas12a-K390A / K945A protein mutant is 42.1 and 707.9 times that of the wild type LbCas12a respectively. These results show that the mutation of K390 and K945 to alanine can increase the affinity of the LbCas12a protein for the substrate to a certain extent, so that the LbCas12a protein has stronger trans cleavage activity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of protein function technology, specifically to an LbCas12a protein mutant, its preparation method, and its application. Background Technology

[0002] The CRISPR / Cas system is an acquired immune system in prokaryotes, used to resist the invasion of foreign genetic elements present in bacteriophages or plasmids. It is now widely used in genetic engineering. In recent years, nucleic acid detection technology using sgRNA-guided CRISPR / Cas nucleases has shown great promise in the field of molecular diagnostics. Nucleases such as Cas9, Cas12a, Cas12b, and Cas13a, with their sgRNA-guided specific cleavage activity, enable the development of highly specific nucleic acid diagnostic tools using the CRISPR / Cas system. By combining with RPA pre-amplification, Cas13a and Cas12a nucleases have been used to develop the SHERLOCK (specific and highly sensitive enzymatic reporter unlocking) system and the DETECTR (DNA endonuclease-targeted CRISPR trans reporter) system for highly sensitive and specific nucleic acid detection, respectively.

[0003] However, in practical applications, the CRISPR / Cas system still faces significant challenges, such as insufficient cleavage efficiency and detection sensitivity. Conventional CRISPR / Cas systems rely on the assembly of Cas proteins and sgRNAs and the recognition of RNPs and targets to activate trans-cleavage activity. This process often takes about 30 minutes, prolonging detection time in practical applications. Without an amplification step, the detection sensitivity of CRISPR / Cas12a for double-stranded targets only reaches 100 pM, which is insufficient for clinical testing and point-of-care testing (POCT) applications, hindering its widespread adoption.

[0004] Given the inherent advantages of LbCas12a and the current limitations of research, developing methods for its targeted modification and applying them to the high-sensitivity and specific detection of RNA viruses has significant scientific and practical value. Summary of the Invention

[0005] The main objective of this invention is to propose an LbCas12a protein mutant, its preparation method, and its application. The aim is to obtain the LbCas12a protein mutant through targeted modification and apply it to nucleic acid detection. This mutant has a high enzyme kinetic constant and detection sensitivity, which improves the detection performance of CRISPR / LbCas12a and creates favorable conditions for its application in the field of clinical testing.

[0006] To achieve the above objectives, the present invention proposes an LbCas12a protein mutant, wherein the LbCas12a protein mutant is a mutation of K390A or K945A in the wild-type LbCas12a protein, and the amino acid sequence of the wild-type LbCas12a protein is shown in SEQ ID NO.1.

[0007] The present invention also proposes a nucleic acid molecule that encodes the LbCas12a protein mutant as described above.

[0008] The present invention also proposes an expression vector comprising the nucleic acid molecule described above.

[0009] The present invention also proposes an engineered host cell comprising the LbCas12a protein mutant as described above, or the nucleic acid molecule as described above, or the expression vector as described above.

[0010] This invention also proposes a method for preparing an LbCas12a protein mutant, comprising the following steps: S1. Insert the full-length gene encoding the wild-type LbCas12a protein between the BamHⅠ and XhoⅠ sites of the pET_28a vector to construct the pET_28a-LbCas12a-WT vector; S2. Based on the nucleotide sequence encoding the mutated LbCas12a protein, design mutant primers targeting the K390A or K945A sites for site-directed PCR mutagenesis. S3. The PCR site-directed mutagenesis product from step S2 is recovered and inserted into the pET_28a-LbCas12a-WT vector constructed in step S1 to obtain the pET_28a-LbCas12a-K390A / K945A prokaryotic expression vector. S4. The pET_28a-LbCas12a-K390A / K945A prokaryotic expression vector was transformed, expressed, and purified to obtain the LbCas12a protein mutant.

[0011] Preferably, in step S3, the mutant primers include F-K390A and R-K390A, or F-K945A and R-K945A, wherein the sequence of F-K390A is shown in SEQ ID NO.7, the sequence of R-K390A is shown in SEQ ID NO.8, the sequence of F-K945A is shown in SEQ ID NO.9, and the sequence of R-K945A is shown in SEQ ID NO.10.

[0012] This invention also proposes the application of the LbCas12a protein mutant as described above in gene editing.

[0013] The present invention also proposes a CRISPR / Cas12a gene editing system comprising the LbCas12a protein mutant described above.

[0014] Preferably, the system further includes crRNA and / or dsDNA that target the target gene.

[0015] This invention also proposes the application of the LbCas12a protein mutant as described above in the preparation of nucleic acid detection platforms or nucleic acid detection kits.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention prepares LbCas12a-K390A and LbCas12a-K945A protein mutants by directional modification of LbCas12a protein and alanine mutation at K390 / K945. Based on the protein mutants obtained by this method, they exhibit a series of significant advantages in function, laying a solid foundation for their application in multiple fields. (2) The LbCas12a-K945A protein mutant prepared in this invention exhibits significantly enhanced trans-cleavage activity compared to the wild-type protein. In the same system, the LbCas12a-K945A protein mutant shows a significantly higher cleavage rate for the reporter probe than the wild-type LbCas12a protein. The LbCas12a-K945A protein mutant produces a fluorescence value 1.1 times that of the wild-type with a 400 nM reporter probe in a 50 μL system.

[0017] (3) Through Michaelis-Menten kinetic analysis, we observed that when the LbCas12a-K390A / K945A protein mutant prepared in this invention and the wild-type LbCas12a protein targeted the same dsDNA target, the catalytic efficiency (expressed as Kcat / Km) of the LbCas12a-K390A / K945A protein mutant was 42.1 times and 707.9 times that of the wild-type LbCas12a, respectively. These results indicate that the mutation of K390 and K945 to alanine can increase the affinity of LbCas12a protein for the substrate to a certain extent, making it more trans-cleavage active.

[0018] (4) The LbCas12a-K390A / K945A protein mutant prepared in this invention exhibits higher detection sensitivity for dsDNA targets. By serially diluting the dsDNA target and detecting the target at different concentrations after dilution, the LbCas12a-K390A / K945A protein mutant prepared in this invention demonstrates higher detection sensitivity. Compared with wild-type LbCas12a protein, the detection sensitivities of the LbCas12a-K390A / K945A protein mutant are 10 pM and 1 pM, respectively, representing increases of 10-fold and 100-fold. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a map of the prokaryotic expression vector for the LbCas12a-K945A protein mutant of this invention.

[0021] Figure 2 This is an SDS-PAGE electrophoresis diagram of the expression and purification process of the LbCas12a-K945A protein mutant of the present invention. M: 180 kDa protein marker; 1: Uninduced whole bacteria; 2: Induced whole bacteria; 3: Supernatant after disruption; 4: Precipitate after disruption; 5: Sample effluent; 6: 0 mM imidazole elution buffer; 7: 10 mM imidazole elution buffer; 8: 20 mM imidazole elution buffer; 9: 50 mM imidazole elution buffer; 10: 150 mM imidazole elution buffer; 11: 250 mM imidazole elution buffer; 12: 500 mM imidazole elution buffer.

[0022] Figure 3 This is a diagram illustrating the activity verification of the purified LbCas12a-K945A protein mutant of this invention.

[0023] Figure 4 Figure A shows the enzyme kinetic constant determination of the purified LbCas12a-K390A / K945A protein mutant of this invention; Figure B shows the fluorescence intensity-time curve of the wild-type protein; Figure B shows the time-fluorescence intensity curve of the LbCas12a-K390A protein mutant. Figure 4 C represents the time-fluorescence intensity diagram of the LbCas12a-K945A protein mutant; Figure 4 Michaelis-Menten kinetic analysis diagram of D.

[0024] Figure 5 This is a graph showing the sensitivity of the purified LbCas12a-K945A protein mutant to the dsDNA target.

[0025] Figure 6 This is a map of the prokaryotic expression vector for the LbCas12a-K390A protein mutant of this invention.

[0026] Figure 7 This is an SDS-PAGE electrophoresis diagram of the expression and purification process of the LbCas12a-K390A protein mutant of the present invention. M: 180 kDa protein marker; 1: Uninduced whole bacteria; 2: Induced whole bacteria; 3: Supernatant after disruption; 4: Precipitate after disruption; 5: Sample effluent; 6: 0 mM imidazole elution buffer; 7: 10 mM imidazole elution buffer; 8: 20 mM imidazole elution buffer; 9: 50 mM imidazole elution buffer.

[0027] Figure 8 This is a graph showing the sensitivity of the purified LbCas12a-K390A protein mutant to the dsDNA target.

[0028] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. Furthermore, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0031] Example 1: Obtaining the LbCas12a-K945A protein mutant and determining its enzyme kinetic constants and detection sensitivity. 1. Constructing an expression carrier (1) Insert the full-length gene encoding the wild-type LbCas12a protein between the BamHⅠ and XhoⅠ sites of the pET_28a vector to construct the pET_28a-LbCas12a-WT vector; (2) Based on the nucleotide sequence encoding the mutated LbCas12a protein, mutant primers were designed targeting the K945A site for site-directed PCR mutagenesis. (3) The PCR site-directed mutagenesis product was recovered and inserted into the constructed wild-type expression vector to obtain the pET_28a-LbCas12a-K945A prokaryotic expression vector (see Figure 1 ).

[0032] The amino acid sequence of the wild-type LbCas12a protein is shown in SEQ ID NO.1; the amino acid sequence of the LbCas12a-K945A protein mutant is shown in SEQ ID NO.2; and the nucleic acid sequence encoding the LbCas12a-K945A protein mutant is shown in SEQ ID NO.3.

[0033] The mutant primers are as follows: F-K945A (SEQ ID NO.4): GGTTTACCAAGCGTTCGAAAAAATGC R-K945A (SEQ ID NO.5): TTCGAACCTTGGTAAACCTGTTTC 2. Transformation and Expression The above prokaryotic expression vector was transformed into E. coli BL21(DE3) competent cells and plated on solid LB agar plates containing kanamycin (50 mg / L), and cultured overnight at 37 ℃. Single colonies were picked and cultured in 5 mL liquid LB medium containing kanamycin (50 mg / L) at 180 r / min for 6 h. The bacterial culture was then sequenced to verify the accuracy of the sequence.

[0034] Selected single colonies with correct sequencing were inoculated into liquid LB medium containing kanamycin and cultured at 37 °C and 180 r / min until the OD600 of the bacterial culture reached 0.6-0.8. Protein expression was then induced by adding 0.5 mM IPTG at 16 °C, 150 r / min, for 20 h. After induction, the bacterial cells were collected and homogenized using an autoclave until the bacterial culture was clear. The target complex was then purified using a nickel column. The purified complex was concentrated by ultrafiltration and transferred to a protein cryopreservation medium for storage. Protein expression was verified using SDS-PAGE and Coomassie Brilliant Blue staining. The results are shown below. Figure 2As shown in the figure, SDS-PAGE electrophoresis analysis revealed a clear target band at 143 kDa, which is consistent with the expected protein molecular weight, indicating that the LbCas12a-K945A protein mutant was successfully expressed and purified.

[0035] 3. Verification of the enzyme digestion activity of the LbCas12a-K945A protein mutant Using 50 μL as the volume standard, a final concentration of 100 nM of CRISPR / LbCas12a protein mutant or wild-type LbCas12a protein and 150 nM crRNA (sequence shown in SEQ ID NO.10) were pre-mixed and pre-incubated at 37°C for 10 min to form a crRNA / LbCas12a protein mutant nucleic acid complex. The crRNA-CRISPR / LbCas12a protein mutant or wild-type LbCas12a protein nucleic acid complex, dsDNA target (sequence shown in SEQ ID NO.11), 400 nM ssDNA FQ-Reporter (sequence shown in SEQ ID NO.12), and 10 μL of 5×Buffer were mixed and DEPC Treated Water was added to a final volume of 50 μL for the reaction. Trans-cleavage activity was measured, and fluorescence values ​​were plotted based on the change in fluorescence signal over time. Figure 3 As shown in the figure, the LbCas12a-K945A protein mutant prepared in this invention exhibits significantly enhanced trans-cleavage activity compared to the wild-type protein. In the same system, the cleavage rate of the reporter probe by the LbCas12a-K945A protein mutant is significantly higher than that of the wild-type LbCas12a protein. The fluorescence value of the 400 nM reporter probe obtained by the LbCas12a-K945A protein mutant in a 50 μL system is 1.1 times that of the wild-type.

[0036] 4. Determination of enzyme kinetic constants of LbCas12a-K945A protein mutant For enzyme kinetic assays, the reporter probe was diluted to 0.1 μmol / L. -1 0.2 μmol L -1 0.4 μmol L -1 0.8 μmol L -1 1.0 μmol L -1 1.6 μmol L -1 3.2 μmol L -1 The enzyme activity detection system contains 100 nmol L. -1 In vivo / in vitro assembled Cas12a protein, 5 μL reaction buffer, 47.2 nmol / L -1Activator (effective complex, Et=47.2 nmol L) -1 DEPC-treated water was used. The reaction system was incubated in a qPCR instrument for 30 min, and fluorescence signals were recorded every 30 s. The initial velocity (V0) was calculated by fitting linear regression, and the substrate concentration was plotted according to the following formula ( Figure 4 The Michaelis-Menten constant (GraphPad Software) is determined as follows: Y = (Vmax × X) / (Km + X), where X is the substrate concentration and Y is the enzyme rate. The turnover number (kcat) is determined by the following formula: kcat = Vmax / Et, where Et = 4 nmol / L. -1 .in, Figure 4 A represents the fluorescence intensity-time curve of the wild-type protein. Figure 4 B is the time-fluorescence intensity diagram of the LbCas12a-K945A protein mutant, from Figure 4 The comparison between A and B shows that Figure 4 The faster rise of the B curve indicates that the protein mutation enhanced enzyme activity and improved cleavage efficiency. Figure 4 Michaelis-Menten kinetic analysis of D revealed that when the LbCas12a-K945A protein mutant prepared in this invention and the wild-type LbCas12a protein targeted the same dsDNA target, the catalytic efficiency (expressed as Kcat / Km) of the LbCas12a-K945A protein mutant was 707.9 times that of the wild-type LbCas12a. These results indicate that the K945 mutation to alanine can increase the affinity of the LbCas12a protein for the substrate to a certain extent, giving it stronger trans-cleavage activity.

[0037] 5. Determination of the sensitivity of the LbCas12a-K945A protein mutant to dsDNA targets. The dsDNA target was diluted to different concentrations, and 2 μL of each diluted sample was used for CRISPR / Cas12a detection. The gain was set to 7, and three replicates were set for each dilution gradient. A working curve was generated to determine the sensitivity and detection range. Figure 5 As shown in the figure, the detection sensitivity of the LbCas12a-K945A protein mutant is 1 pM higher than that of the wild-type LbCas12a protein, which is 100 times higher.

[0038] Example 2: Obtaining the LbCas12a-K390A protein mutant and determining its enzyme kinetic constants and detection sensitivity. 1. Construction of expression carrier The full-length gene encoding the wild-type LbCas12a protein was inserted between the BamHⅠ and XhoⅠ sites in the pET_28a vector to construct the pET_28a-LbCas12a-WT vector; Based on the nucleotide sequence encoding the mutated LbCas12a protein, mutant primers were designed targeting the K390A site for site-directed PCR mutagenesis. The PCR site-directed mutagenesis product was recovered and inserted into the constructed wild-type expression vector to obtain the pET_28a-LbCas12a-K390A prokaryotic expression vector (see...). Figure 6 ).

[0039] The amino acid sequence of the LbCas12a-K390A protein mutant is shown in SEQ ID NO.6; the nucleic acid sequence encoding the LbCas12a-K390A protein mutant is shown in SEQ ID NO.7.

[0040] The mutant primers are as follows: F-K390A (SEQ ID NO.8):GCTTTGCCAAAATTGGTAGTTTCT R-K390A (SEQ ID NO.9): TTGGCAAAGCTCTTGCGG 2. Transformation and Expression The recombinant plasmid was transformed into E. coli BL21(DE3) competent cells and plated on solid LB agar plates containing kanamycin (50 mg / L). The cells were incubated overnight at 37 °C. Single colonies were picked and placed in 5 mL of liquid LB medium containing kanamycin (50 mg / L) and incubated at 180 r / min for 6 h. The bacterial culture was then sequenced to verify the accuracy of the sequence.

[0041] Selected single colonies with correct sequencing were inoculated into liquid LB medium containing kanamycin and cultured at 37 °C and 180 r / min until the OD600 of the bacterial culture reached 0.6-0.8. Protein expression was then induced by adding 0.5 mM IPTG at 16 °C, 150 r / min, for 20 h. After induction, the bacterial cells were collected and homogenized using an autoclave until the bacterial culture was clear. The target complex was then purified using a nickel column. The purified complex was concentrated by ultrafiltration and transferred to a protein cryopreservation medium for storage. Protein expression was verified using SDS-PAGE and Coomassie Brilliant Blue staining. The results are shown below. Figure 7 As shown, SDS-PAGE electrophoresis analysis revealed a clear target band at 143 kDa, consistent with the expected protein molecular weight, indicating successful expression and purification of the LbCas12a-K390A protein mutant.

[0042] 3. Verification of enzyme digestion activity of LbCas12a-K390A protein mutant A CRISPR / LbCas12a protein mutant or wild-type LbCas12a protein with a final concentration of 100 nM and 150 nM crRNA (sequence shown in SEQ ID NO.10: UAAUUUCUACUAAGUGUAGAUGAUACAUCACAUAAUGUAAC) was premixed at 37°C for 10 min using 50 μL as the volume standard and pre-incubated at 37°C to form a crRNA / LbCas12a protein mutant nucleic acid complex. The crRNA-CRISPR / LbCas12a protein mutant or wild-type LbCas12a protein nucleic acid complex, dsDNA target (sequence shown in SEQ ID NO. 11), 400 nM ssDNA FQ-Reporter (sequence shown in SEQ ID NO. 12: 5'-6FAM / TTATT / BHQ1-3'), and 10 μL of 5×Buffer were mixed and DEPC Treated Water was added to a final volume of 50 μL for the reaction. Trans-cleavage activity was then measured to obtain the desired results. Figure 4 .

[0043] 4. Determination of enzyme kinetic constants of LbCas12a-K390A protein mutant For enzyme kinetic assays, the reporter probe was diluted to 0.1 μmol / L. -1 0.2 μmol L -1 0.4 μmol L -1 0.8 μmol L -1 1.0 μmol L -1 1.6 μmol L -1 3.2 μmol L -1 The enzyme activity detection system contains 100 nmol L. -1 In vivo / in vitro assembled Cas12a protein, 5 μL reaction buffer, 47.2 nmol / L -1 Activator (effective complex, Et=47.2 nmol L) -1 DEPC-treated water was used. The reaction system was incubated in a qPCR instrument for 30 min, and fluorescence signals were recorded every 30 s. The initial velocity (V0) was calculated by fitting linear regression, and the substrate concentration was plotted according to the following formula ( Figure 4The Michaelis-Menten constant (GraphPad Software) is determined as follows: Y = (Vmax × X) / (Km + X), where X is the substrate concentration and Y is the enzyme rate. The turnover number (kcat) is determined by the following formula: kcat = Vmax / Et, where Et = 4 nmol / L. -1 (Table 1). Among them, Figure 4 A represents the fluorescence intensity-time curve of the wild-type protein. Figure 4 C represents the time-fluorescence intensity diagram of the LbCas12a-K390A protein mutant, from... Figure 4 The comparison between A and C shows that Figure 4 A faster rise in the C-curve indicates that the protein mutation enhanced enzyme activity and improved cleavage efficiency. Figure 4 Based on the Michaelis-Menten kinetic analysis in Table 1, we observed that when the LbCas12a-K390A protein mutant prepared in this invention targets the same dsDNA target as the wild-type LbCas12a protein, the catalytic efficiency (expressed as Kcat / Km) of the LbCas12a-K390A protein mutant is 42.1 times that of the wild-type LbCas12a. These results indicate that the K390 mutation to alanine can increase the affinity of the LbCas12a protein for the substrate to some extent, giving it stronger trans-cleavage activity.

[0044] Table 1. Determination of Michaelis Constant 5. Determination of the sensitivity of the LbCas12a-K390A protein mutant to dsDNA targets. The dsDNA target was diluted to different concentrations, and 2 μL of each diluted sample was used for CRISPR / Cas12a detection. The gain was set to 7, and three replicates were set for each dilution gradient. A working curve was plotted to determine the sensitivity and detection range. Figure 8 As shown in the figure, the detection sensitivity of the LbCas12a-K390A protein mutant is 10 pM higher than that of the wild-type LbCas12a protein, which is 10 times higher.

[0045] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.

Claims

1. A mutant of the LbCas12a protein, characterized in that, The LbCas12a protein mutant is a mutation of K390A or K945A in the wild-type LbCas12a protein, and the amino acid sequence of the wild-type LbCas12a protein is shown in SEQ ID NO.

1.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the LbCas12a protein mutant as described in claim 1.

3. An expression carrier, characterized in that, The expression vector comprises the nucleic acid molecule as described in claim 2.

4. An engineered host cell, characterized in that, The host cell comprises the LbCas12a protein mutant as described in claim 1, or the nucleic acid molecule as described in claim 2, or the expression vector as described in claim 3.

5. A method for preparing an LbCas12a protein mutant, characterized in that, Includes the following steps: S1. Insert the full-length gene encoding the wild-type LbCas12a protein into the pET_28a vector. BamHⅠ and XhoⅠ Between the sites, construct the pET_28a-LbCas12a-WT vector; S2. Based on the nucleotide sequence encoding the mutated LbCas12a protein, design mutant primers targeting the K390A or K945A sites for site-directed PCR mutagenesis. S3. The PCR site-directed mutagenesis product from step S2 is recovered and inserted into the pET_28a-LbCas12a-WT vector constructed in step S1 to obtain the pET_28a-LbCas12a-K390A / K945A prokaryotic expression vector. S4. The pET_28a-LbCas12a-K390A / K945A prokaryotic expression vector was transformed, expressed, and purified to obtain the LbCas12a protein mutant.

6. The preparation method according to claim 5, characterized in that, In step S3, the mutant primers include F-K945A and R-K945A or F-K390A and R-K390A, the sequence of F-K945A is shown in SEQ ID NO.4, the sequence of R-K945A is shown in SEQ ID NO.5, the sequence of F-K390A is shown in SEQ ID NO.8, and the sequence of R-K390A is shown in SEQ ID NO.

9.

7. A CRISPR / Cas12a gene editing system comprising the LbCas12a protein mutant as described in claim 1.

8. The CRISPR / Cas gene editing system according to claim 7, characterized in that, The system also includes crRNA and / or dsDNA that target the target gene.

9. The application of the LbCas12a protein mutant as described in claim 1 in the preparation of a nucleic acid detection platform or nucleic acid detection kit.

Citation Information

Patent Citations

  • Crispr / LbCas12a mutant protein applied to nucleic acid detection as well as preparation method and application of Crispr / LbCas12a mutant protein

    CN114214348A

  • Mutant of wild type LbCas12a protein and application of SNP (Single Nucleotide Polymorphism) detection

    CN116286734A