Retroviral transfection systems, recombinant retroviruses and their preparation methods

Abstract

This invention discloses a retroviral transfection system based on bovine leukemia virus (BLV), a recombinant retrovirus, and its preparation method. The retroviral transfection system consists of a packaging plasmid BLV-Plasmid I, an envelope plasmid BLV-Plasmid II, and an expression vector plasmid BLV-Plasmid III containing a target gene expression cassette. The recombinant retrovirus packaged by this system can infect common cell lines such as 293T cells, and exhibits good infectivity and high integration stability in ruminant cells such as MAC-T cells, enabling efficient expression of exogenous genes. This system is a three-plasmid system, which effectively reduces the difficulty of constructing expression vector plasmids for inserting target genes and effectively increases the target gene capacity. This system not only provides a safer, more efficient, and more specific technical platform for ruminant cell engineering, vaccine delivery, and anti-infection research, but also opens up new directions for the development and application of novel retroviral vectors.

Description

Technical Field

[0001] This invention relates to bovine leukemia virus, and more particularly to a retroviral transfection system, a recombinant retrovirus, and a method for its preparation. Background Technology

[0002] Retroviral vectors are gene delivery tools developed using the characteristics of retroviruses. Their core mechanism involves viral reverse transcriptase converting RNA genomes into DNA, which is then integrated into host cells, achieving long-term stable expression of exogenous genes. Current mainstream vectors such as HIV and MLV are highly efficient in various mammalian cell models, but they face significant limitations in some ruminant cell models, including insufficient target recognition, poor tissue specificity, low cross-species receptor compatibility, and decreased transfection efficiency. Furthermore, they pose potential biosafety risks such as random integration leading to mutations, vector recombination, or cross-species transmission.

[0003] Bovine leukemia virus (BLV) belongs to the genus *D* retroviruses, the same genus as human T-cell leukemia virus type 1 (HTLV-1). BLV can remain latent in host cells for extended periods without causing obvious symptoms; this latent infection strategy allows BLV to persist in the host without being completely eliminated by the immune system. Furthermore, BLV can influence gene expression and function in host cells through the genome, and infected cells typically exhibit high proliferative capacity. Therefore, although BLV's infection mechanism is similar to other retroviruses, its unique transmission route, latent infection capacity, and interaction with host genes give it a significant advantage in transmission among ruminants.

[0004] While existing single plasmid packaging systems based on the entire BLV genome simplify the virus production process, they still have significant drawbacks: on the one hand, the complete viral genome and the target gene must be co-placed in a single plasmid, which leads to an excessively large vector, significantly increasing the difficulty of cloning and the probability of sequence errors; on the other hand, the BLV genome itself is nearly 9kb in length, which limits the length of the target gene fragment, greatly restricting the delivery of multi-gene co-expression or large gene editing elements. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide a retroviral transfection system based on bovine leukemia virus that is applicable to various mammalian cells, especially ruminant cells. The second purpose is to provide recombinant retroviruses obtained through this retroviral transfection system and their preparation methods.

[0006] Technical solution: The retroviral transfection system of the present invention includes:

[0007] (a) Based on the pCAGGS vector, the packaging plasmid BLV-Plasmid I, containing the gag-pro-pol, R3, G4, rex and tax genes of bovine leukemia virus, was inserted at the XhoI restriction site.

[0008] (b) BLV-Plasmid II, which expresses the homologous or heterologous envelope protein gene of bovine leukemia virus;

[0009] (c) Based on the pCAGGS vector, the CMV enhancer and chicken β-actin promoter sequences were replaced with pCMV elements, and the expression vector plasmid BLV-Plasmid III, consisting of bovine leukemia virus 5'LTR sequence, gag-pro-pol gene signal peptide sequence, selection gene promoter element, selection gene, target gene expression cassette, and bovine leukemia virus 3'LTR sequence, was sequentially inserted after the pCMV elements.

[0010] The target gene expression cassette includes: a screening gene promoter element, a screening gene, a target gene promoter element, a target gene, and optionally includes at least one reporter gene.

[0011] Preferably, the packaging plasmid BLV-Plasmid I has the nucleotide sequence shown in SEQ ID NO: 1.

[0012] Preferably, in the envelope plasmid BLV-Plasmid II, the heterologous envelope protein gene is selected from any one of the following: vesicular stomatitis virus G glycoprotein gene, feline endogenous retrovirus envelope RD114 gene, mouse leukemia virus envelope 4070A gene, measles virus H / F gene, and cokar virus G glycoprotein gene.

[0013] Preferably, the envelope plasmid BLV-Plasmid II uses vesicular stomatitis virus G glycoprotein as the envelope protein, and is a pCMV-VSV-G plasmid.

[0014] Preferably, in the target gene expression cassette of expression vector plasmid BLV-Plasmid III, the screening gene promoter element and the target gene promoter element are independently selected from any one of β-Actin promoter, EF-1α promoter, phosphoglycerate kinase promoter, ubiquitin C promoter, CMV promoter, and SV40 promoter; the screening gene is selected from any one or more of puromycin resistance gene, neomycin resistance gene, hygromycin resistance gene, bleomycin resistance gene, and blast fungicide resistance gene; and the reporter gene is selected from any one or more of fluorescent protein gene and enzyme reporter gene.

[0015] Preferably, the expression vector plasmid BLV-Plasmid III uses the EF-1α promoter as the select gene promoter element and the puromycin resistance gene as the select gene, and has the nucleotide sequence shown in SEQ ID NO: 2, with a target gene expression cassette inserted at bases 5712-5713.

[0016] Preferably, the expression vector plasmid BLV-Plasmid III target gene expression cassette uses the CMV promoter as the target gene promoter element, the bovine lysozyme and bovine tracheal antimicrobial peptide genes as target genes, and GFP as the reporter gene, and has the nucleotide sequence shown in SEQ ID NO: 3.

[0017] The recombinant retrovirus described in this invention is a virus prepared using the aforementioned retrovirus transfection system.

[0018] The method for preparing recombinant retrovirus according to the present invention includes the following steps:

[0019] (1) The packaging plasmid BLV-Plasmid I, the envelope plasmid BLV-Plasmid II, and the expression vector plasmid BLV-Plasmid III in the aforementioned retroviral transfection system were mixed at a mass ratio of 0.5-1.5:1.5-2.5:2.5-3.5 and co-transfected into cells in the logarithmic growth phase.

[0020] (2) After continuous culture, the supernatant was collected and purified to obtain recombinant retrovirus.

[0021] Preferably, the transfected cells are any one of MAC-T cells, 293T cells, Tb 1Lu cells, Vero cells, BHK-21 cells, and HEK 293 cells.

[0022] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: 1. The retroviral transfection system is designed based on BLV, and the recombinant retroviruses packaged are not only easy to infect common cell lines such as 293T cells, but also have good infectivity, stable integration, and high efficiency in expressing exogenous genes in ruminant cells such as MAC-T cells; 2. The retroviral transfection system is a three-plasmid system, which effectively reduces the difficulty of constructing expression vector plasmids for inserting target genes and can effectively increase the capacity of target genes; 3. This retroviral transfection system provides a safer, more efficient, and more specific technical platform for ruminant cell engineering, vaccine delivery, and anti-infection research, while also opening up new directions for the development and application of novel retroviral vectors. Attached Figure Description

[0023] Figure 1Fluorescence microscopy observation results of cells after viral infection for retroviral transfection system preparation;

[0024] Figure 2 Figure showing the results of stable expression verification of exogenous genes and proteins after virus infection of 293T cell line for retroviral transfection system;

[0025] Figure 3 Figure showing the results of stable expression verification of exogenous genes and proteins after the Tb 1Lu cell line was infected with the retroviral transfection system.

[0026] Figure 4 Figure showing the results of verifying the stable expression of exogenous genes and proteins after the preparation of a retroviral transfection system and infection of MAC-T cell lines;

[0027] Figure 5 Figure showing the in vitro antibacterial effect of 293T cell line stably expressing the LYZ-TAP fusion gene against Pseudomonas aeruginosa;

[0028] Figure 6 The in vitro anti-Klebsiella pneumoniae results of the Tb 1Lu cell line stably expressing the LYZ-TAP fusion gene;

[0029] Figure 7 Figure showing the in vitro anti-Staphylococcus aureus results of MAC-T cell lines stably expressing the LYZ-TAP fusion gene. Detailed Implementation

[0030] The technical solution of the present invention will be further described below.

[0031] Example 1: Construction of packaging plasmid BLV-Plasmid I

[0032] 1. Primers as shown in Table 1 were designed based on the publicly available bovine leukemia virus whole genome sequence (GenBank accession number: LC080656) and synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0033] Table 1. List of primers used in the construction of BLV-Plasmid I

[0034]

[0035] Note: F is the forward primer, R is the reverse primer, and the underlined part is the homologous arm.

[0036] 2. Using the pCAGGS-BLV17985 infectious clone plasmid as a template, PCR amplification was performed using primers 1 and 2 via PhantaFlash Master Mix to obtain the bovine leukemia virus gag-pro-pol fragment. The fragment was purified by gel electrophoresis, recovered using a DNA gel purification kit, and stored at -20°C for later use.

[0037] The pCAGGS vector (Newp Biotech, V008798) was linearized using XhoI restriction enzyme, purified by gel electrophoresis, recovered using a DNA gel purification kit, and stored at -20°C for later use.

[0038] Using homologous recombination technology, the gag-pro-pol fragment was ligated to the aforementioned recombinant linearized pCAGGS vector using the ClonExpress Ultra One Step Cloning kit to obtain the recombinant pCAGGS-gag-pol vector.

[0039] Using pCAGGS-BLV17985 infectious clone plasmid as a template, PCR amplification was performed using primers 3 and 4 via Phanta FlashMaster Mix to obtain the bovine leukemia virus R3-G4 fragment. The fragment was purified by gel electrophoresis, recovered using a DNA gel purification kit, and stored at -20°C for later use.

[0040] Using primers 5 and 6, reverse PCR amplification was performed using Phanta Flash Master Mix to linearize the aforementioned recombinant pCAGGS-gag-pol vector. The vector was purified by gel electrophoresis, recovered using a DNA gel purification kit, and stored at -20°C for later use.

[0041] Using homologous recombination technology, the fragment R3-G4 was ligated to the aforementioned linearized pCAGGS-gag-pol vector using the ClonExpress Ultra One Step Cloning kit to obtain the recombinant plasmid pCAGGS-gag-pol-R3-G4.

[0042] The resulting recombinant plasmid was transformed into DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and after culture, single colonies were picked and sequenced by Nanjing Qingke Biotechnology Co., Ltd. to obtain the packaging plasmid BLV-Plasmid I with the sequence shown in SEQ ID NO: 1.

[0043] The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, annealing for 5 s, extension at 72℃ for 1 kb / 60 ​​s, 35 cycles; and final extension at 72℃ for 10 min. The annealing temperatures for each reaction are shown in Table 1 above.

[0044] Example 2: Construction of expression vector plasmid BLV-Plasmid III without target gene cassette

[0045] 1. Based on the publicly available gene sequences, primers as shown in Table 2 were designed and synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0046] Table 2. List of primers used for the construction of BLV-Plasmid III without the target gene expression cassette.

[0047]

[0048] Note: F is the forward primer, R is the reverse primer, and the underlined part is the homologous arm.

[0049] 2. Using primers 7 and 8, reverse PCR amplification was performed using Phanta Flash Master Mix to linearize the pCAGGS vector;

[0050] Using pCDNA3.1 as a template (Newp Biotech, V012531), the PCMV fragment was amplified using primers 9 and 10;

[0051] Using pCAGGS-BLV17985 infectious clone plasmid as a template, primers 11 and 12 were used to amplify the 5'LTR-GAG signal peptide fragment of bovine leukemia virus.

[0052] Using primers 9 and 12, the PCMV fragment and the bovine leukemia virus 5'LTR-GAG signal peptide fragment were amplified by overlap extension PCR to obtain fusion fragment 1;

[0053] Using the lentiviral vector system shuttle plasmid PLV3-CMV-GFP-MCS-EF1a-PuroR (Newp Biotech, V014370) as a template, the PURO fragment of the puromycin resistance gene was amplified using primers 13 and 14.

[0054] Using primers 15 and 16, the 3'LTR fragment of bovine leukemia virus was amplified using the infectious clone plasmid pCAGGS-BLV17985 as a template.

[0055] Using primers 13 and 16, the PURO fragment of the puromycin resistance gene and the 3'LTR fragment of bovine leukemia virus were amplified by overlap extension PCR to obtain fusion fragment 2;

[0056] Using primers 9 and 16, fusion fragments 1 and 2 were amplified by overlap extension PCR to obtain fusion fragment 3;

[0057] Using homologous recombination technology, the fusion fragment 3 was ligated to the aforementioned linearized pCAGGS vector using the ClonExpress Ultra One Step Cloning kit to obtain the recombinant pCAGGS vector.

[0058] After each of the above steps, the DNA was purified by gel electrophoresis and recovered using a DNA gel purification kit for subsequent use.

[0059] The resulting recombinant plasmid was transformed into DH5α competent cells, plated on LB plates containing ampicillin at a final concentration of 100 μg / mL, and after culture, single colonies were picked and sequenced by Nanjing Qingke Biotechnology Co., Ltd. to obtain the expression vector plasmid BLV-Plasmid III with the sequence shown in SEQ ID NO: 2, which uses the EF-1α promoter as the selection gene promoter element, the puromycin resistance gene as the selection gene, and does not contain the target gene expression cassette.

[0060] The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, annealing for 5 s, extension at 72℃ for 1 kb / 60 ​​s, 35 cycles; and final extension at 72℃ for 10 min. The annealing temperatures for each reaction are shown in Table 2 above.

[0061] Example 3: Construction of expression vector plasmid BLV-Plasmid III containing the target gene cassette

[0062] Using the CMV promoter as the target gene promoter element, the bovine lysozyme and bovine tracheal antimicrobial peptide genes as target genes, and GFP as the reporter gene, an expression vector plasmid BLV-Plasmid III containing the target gene cassette was constructed.

[0063] Based on the publicly available bovine lysozyme gene (LYZ) sequence (GenBank ID: HQ285242.1) and bovine tracheal antimicrobial peptide gene (TAP) sequence (GenBank ID: NM_174776), a target gene cassette fragment with the sequence shown in SEQ ID NO: 4 was designed. This fragment was synthesized by Nanjing Qingke Biotechnology Co., Ltd. and constructed between bases 5712-5713 of the expression vector plasmid BLV-Plasmid III obtained in Example 3, which does not contain the target gene cassette. This yielded the expression vector plasmid BLV-Plasmid III with the sequence shown in SEQ ID NO: 3, which uses the bovine lysozyme gene and the bovine tracheal antimicrobial peptide gene as target genes.

[0064] Example 4: Preparation and Validation of Recombinant Bovine Leukemia Virus Targeting Bovine Lysozyme Gene and Bovine Tracheal Antimicrobial Peptide Gene

[0065] 1. Preparation of recombinant bovine leukemia virus

[0066] The packaging plasmid BLV-Plasmid I, the envelope plasmid BLV-Plasmid II, and the expression vector plasmid BLV-Plasmid III prepared in Example 3, which contains bovine lysozyme gene and bovine tracheal antimicrobial peptide gene as target genes, were mixed at a mass ratio of 1:2:3 to obtain the retroviral transfection system plasmid BLV-LYZ+TAP / GFP. Among them, the envelope plasmid BLV-Plasmid II was selected from pCMV-VSV-G plasmid (addgene, Plasmid#8454).

[0067] The packaging plasmid BLV-Plasmid I, the envelope plasmid BLV-Plasmid II, and the expression vector plasmid BLV-Plasmid III with GFP as the target gene and reporter gene prepared according to the method described in the previous examples were mixed at a mass ratio of 1:2:3 to obtain the retroviral transfection system plasmid BLV-GFP. The envelope plasmid BLV-Plasmid II was selected from pCMV-VSV-G plasmid (addgene, Plasmid#8454).

[0068] 293T cells were seeded into 6-well cell culture plates and grown until the cell density reached 70-80%.

[0069] Discard the cell culture supernatant, add 2 mL of fresh DMEM medium containing 10% fetal bovine serum, take the aforementioned mixed retrovirus transfection system plasmid, and transfect it with Lipofectamine 3000 at a concentration of 2.5 μg / well. Continue to incubate at 37℃ and 5% CO2 for 8 h, then change the medium.

[0070] After changing the medium, the cells were cultured for another 48 and 72 hours. The cell culture supernatant was collected, filtered through a 0.45 μm filter to remove cell debris, and then mixed to obtain the virus supernatant.

[0071] 2. Infectivity verification

[0072] The following three cell lines were selected as infection targets: 293T cells; MAC-T cells; and TB1Lu cells.

[0073] The three cell types were seeded into 48-well plates. After the cell density reached 50-70%, the obtained viral supernatant was added. After 24 hours of infection, the culture medium was replaced with fresh medium.

[0074] After changing the medium, the cells were cultured for another 96 hours post-infection. Then, a final concentration of 0.5 μg / mL puromycin was added to the cell culture medium for screening.

[0075] The screening endpoint was the complete death of cells in the non-infected group and the survival and stable growth of cells in the infected group, resulting in 293T-BLV-LYZ+TAP, Tb1Lu-BLV-LYZ+TAP, MAC-T-BLV-LYZ+TAP cells and 293T-T-BLV-GFP, Tb1Lu-T-BLV-GFP, MAC-TT-BLV-GFP cells.

[0076] 3. Validation of stable expression of exogenous proteins

[0077] The positive cells obtained through screening were obtained by:

[0078] (1) Observe GFP expression under a fluorescence microscope to determine the positive rate;

[0079] (2) RT-qPCR was used to detect the expression level of GFP gene in the two types of stably transfected cells mentioned above.

[0080] Genomic DNA was extracted from cells that stably expressed the gene and RT-PCR was performed using the SYBR Green Premix Ex Taq system. The primer sequences for GFP and the internal reference gene GADPH are shown in Table 3 below. The reaction conditions were: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s; 60℃ annealing extension for 30 s; 40 cycles.

[0081] Table 3 Primer sequences for GFP and GADPH

[0082] GFP upstream primer CGTAAACGGCCACAAGTTCA GFP downstream primers CTTCATGTGGTCGGGGTAGC GADPH upstream primer GGCAAGTTCAACGGCACA GADPH downstream primer ACCACATACTCAGCACCAGCA

[0083] Fluorescence values ​​were collected during the extension phase of each cycle. Using GADPH as an internal control, Ct values ​​were calculated, and the relative expression level of GFP was determined using the ΔΔCt method.

[0084] (3) Western blot analysis of GFP expression

[0085] 1. After digesting the cells with trypsin-EDTA, resuspend them in sterile PBS, centrifuge at 3000 rpm for 5 min, and resuspend them again in sterile PBS. Repeat twice.

[0086] 2. Add 500 μL of RIPA lysis buffer and 5 μL of protease inhibitor PMSF to the cell pellet, vortex until homogeneous, and place on ice for lysis for 20 min, vortexing once every 5 min. Sonicate at 250 W under ice bath conditions, with a 5 s interval and a 3 s interval, for a total of 1 min to lyse the cells. Centrifuge at 12000g at 4℃ for 10 min, and collect the supernatant for later use.

[0087] 3. Using the Beyotime BCA protein concentration assay kit, calculate the protein concentration in the sample based on the standard curve and sample volume, and dilute to 1.5 μg / μL;

[0088] 4. Prepare a 12% concentration gel, with 6 mL of lower separating gel and 2 mL of upper stacking gel; heat the sample protein obtained in step 3 at 99℃ for 10 min, cool to room temperature, load 20 μL of sample into each well, and electrophores at a constant voltage of 120V for 150 min.

[0089] After the PVDF membrane was activated in methanol solution, it was transferred at a constant current of 200mA for 90min. After the transfer, the membrane was washed rapidly with TBST solution, blocked with 5% skim emulsion at room temperature for 2h, and washed with TBST for 5min each time, for a total of five times.

[0090] Dilute the mouse-derived GFP primary antibody with antibody dilution buffer, incubate overnight at 4°C for 16 h, and wash the membrane with TBST for 5 min each time, 5 times; dilute the HRP-labeled goat anti-mouse IgG secondary antibody with antibody dilution buffer, incubate on a shaker at room temperature for 1 h, and wash the membrane with TBST for 5 min each time, 5 times.

[0091] The bands were detected using a high-sensitivity ECL chemiluminescence reagent kit and exposed using a chemiluminescence imaging system.

[0092] Fluorescence microscopy observation results as follows Figure 1 As shown, the RT-qPCR and WB detection results are as follows: Figure 2-4 As shown, proteins extracted from 293T-BLV-LYZ+TAP, Tb 1Lu-BLV-LYZ+TAP, and MAC-T-BLV-LYZ+TAP cells showed a distinct and specific band at 54kD, indicating expression of the LYZ+TAP / GFP fusion protein; while 293T-GFP, Tb 1Lu-GFP, and MAC-T-GFP showed a distinct and specific band at 27kD, indicating expression of only GFP protein.

[0093] 4. Verification of the functional integrity of exogenous proteins

[0094] 4.1 Establishment of a Simulated Infection Model

[0095] To simulate common pathogen infections, the following typical strains were selected to construct in vitro infection models, including: Gram-negative bacteria: Pseudomonas aeruginosa ATCC 27853 and Klebsiella pneumoniae ATCC 13883; and Gram-positive bacteria: Staphylococcus aureus ATCC 25923 as infection model strains.

[0096] The above-mentioned strains were inoculated into LB medium and cultured at 37°C until the logarithmic growth phase. The bacterial culture was then adjusted to OD200. 600 =0.1. Subsequently, serial dilutions were performed to obtain working solutions with infection doses of 10, 100, 1000, and 10000 CFU / well, respectively, for subsequent infection experiments.

[0097] 4.2 Cell infection treatment

[0098] Stable LYZ+TAP-expressing 293T cells and empty vector control 293T cells were seeded into 48-well plates, with 3 × 10⁶ cells per well. 4 One cell;

[0099] After the cells have grown to 70-80% confluence, different concentrations of the previously prepared Gram-negative / positive bacterial working solutions are added for infection treatment. Each treatment is set up with 5 replicates, and a control group without infection is also set up.

[0100] The infection lasted for 60 hours. Starting from 12 hours, 200 μL of cell culture supernatant was collected from each well every 6 hours, and 200 μL of fresh complete culture medium was added.

[0101] OD was detected in cell culture supernatant using an enzyme-linked immunosorbent assay (ELISA) reader. 600 The antibacterial ability of 293T cells stably expressing LYZ+TAP was assessed by evaluating bacterial growth.

[0102] The results are as follows Figure 5-7 As shown, 293T cells stably expressing LYZ+TAP exhibit broad-spectrum anti-infection properties.

Claims

1. A retroviral transfection system, characterized in that, include: (a) Based on the pCAGGS vector, the packaging plasmid BLV-Plasmid I, containing the gag-pro-pol, R3, G4, rex and tax genes of bovine leukemia virus, was inserted at the XhoI restriction site. Its nucleotide sequence is shown in SEQ ID NO:

1. (b) Encapsulation plasmid BLV-Plasmid II, i.e. pCMV-VSV-G plasmid purchased from Addgene with trade number Plasmid #8454; (c) Based on the pCAGGS vector, the CMV enhancer and chicken β-actin promoter sequence were replaced with pCMV elements, and the expression vector plasmid BLV-PlasmidIII, consisting of bovine leukemia virus 5'LTR sequence, gag-pro-pol gene signal peptide sequence, selection gene promoter element, selection gene, target gene expression cassette and bovine leukemia virus 3'LTR sequence, was inserted sequentially after the pCMV elements. The expression vector plasmid BLV-Plasmid III uses the EF-1α promoter as the select gene promoter element and the puromycin resistance gene as the select gene. It is obtained by inserting a target gene expression cassette into a plasmid having the nucleotide sequence shown in SEQ ID NO: 2 at bases 5712-5713. The target gene expression cassette includes: a target gene promoter element, a target gene, and optionally at least one reporter gene.

2. The retroviral transfection system according to claim 1, characterized in that, The expression vector plasmid BLV-Plasmid III target gene expression cassette uses the CMV promoter as the target gene promoter element, the bovine lysozyme and bovine tracheal antimicrobial peptide genes as target genes, and GFP as the reporter gene, and has the nucleotide sequence shown in SEQ ID NO:

3.

3. A recombinant retrovirus, characterized in that, The virus is prepared using the retrovirus transfection system described in claim 1.

4. A method for preparing the recombinant retrovirus according to claim 3, characterized in that the step... include: (1) The packaging plasmid BLV-Plasmid I, the envelope plasmid BLV-Plasmid II, and the expression vector plasmid BLV-Plasmid III in the retrovirus transfection system of claim 1 are mixed at a mass ratio of 0.5-1.5:1.5-2.5:2.5-3.5 and co-transfected into cells in the logarithmic growth phase; (2) After continuous culture, the supernatant was collected and purified to obtain recombinant retrovirus; The cells mentioned in step 1 are any one of MAC-T cells, 293T cells, or Tb1Lu cells.

Images