Use of a long non-coding RNA in diagnosis and / or treatment of breast cancer

Abstract

The application discloses application of long-chain non-coding RNA in diagnosis and / or treatment of breast cancer and belongs to the technical field of biological medicine. The application first finds that the expression level of a new long-chain non-coding RNA-LncRNA-RJ1 in tumor tissues of triple-negative breast cancer patients, triple-negative breast cancer drug-resistant patients and triple-negative breast cancer patients with poor prognosis is obviously higher than that in normal tissues, and with the increase of the expression level, the prognosis of breast cancer patients and breast cancer drug-resistant patients is also poorer; the expression level of LncRNA-RJ1 is related to the drug resistance of triple-negative breast cancer patients, the breast cancer cell migration ability is also significantly reduced when the expression level of LncRNA-RJ1 is reduced, therefore, LncRNA-RJ1 can be used as a new biomarker for preparing products for diagnosing and / or treating breast cancer, and a new way is opened for triple-negative breast cancer chemotherapy drug resistance and drug efficacy evaluation.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of a long non-coding RNA in the diagnosis and / or treatment of breast cancer. Background Technology

[0002] Triple-negative breast cancer is a highly malignant subtype of breast cancer. It is characterized by negative expression of estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2. Clinical treatment mainly involves chemotherapy, but it is prone to problems such as chemotherapy resistance, high risk of recurrence and metastasis, and poor prognosis, which has become a major challenge in clinical treatment.

[0003] Long non-coding RNAs (lncRNAs), a class of non-coding RNAs exceeding 200 nucleotides in length, have been widely identified and involved in biological processes such as tumor cell proliferation, migration, apoptosis, and drug resistance regulation, providing novel molecular targets for tumor diagnosis, treatment, and prognostic assessment. However, current research on lncRNAs specifically expressed in triple-negative breast cancer and their regulatory mechanisms remains insufficient. The identified lncRNAs suffer from insufficient specificity and limited diagnostic efficacy in clinical translation, failing to meet the needs of precision medicine.

[0004] In terms of treatment, the chemotherapy resistance mechanism in triple-negative breast cancer is complex, and existing chemotherapy regimens are not effective for resistant patients, lacking effective strategies to reverse resistance. Furthermore, the lack of biomarkers that can accurately assess patient prognosis and resistance risk leads to a high degree of uncertainty in treatment selection, hindering personalized treatment. In addition, existing interventions targeting tumor-associated lncRNAs are insufficient in specifically inhibiting target lncRNA expression and improving treatment safety and efficacy, and mature clinical applications have not yet been developed.

[0005] Therefore, it is urgent to discover novel lncRNAs that are specifically highly expressed in triple-negative breast cancer and closely related to disease progression, drug resistance, and prognosis, clarify their biological functions and regulatory mechanisms, and develop diagnostic reagents, prognostic assessment tools, and targeted therapies based on these lncRNAs. This will provide new technical approaches to address the problems of insufficient diagnostic accuracy, chemotherapy resistance, and difficulty in prognostic assessment in triple-negative breast cancer. Summary of the Invention

[0006] Therefore, the purpose of this invention is to provide an application of long non-coding RNA in the diagnosis and / or treatment of breast cancer.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides a biomarker for diagnosing breast cancer, wherein the biomarker is a long non-coding RNA-LncRNA-RJ1, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0009] Secondly, the present invention provides the application of the above-mentioned biomarkers in the preparation of reagents or kits for diagnosing breast cancer.

[0010] Based on the above technical solution, the breast cancer further includes drug-insensitive triple-negative breast cancer and drug-resistant triple-negative breast cancer.

[0011] Based on the above technical solution, the breast cancer cell lines further include T47D, BT474, SK-BR-3, BT549 and MDA-MB-231.

[0012] Based on the above technical solution, the reagent or kit further includes primers for detecting the above-mentioned biomarkers.

[0013] Based on the above technical solution, the nucleotide sequence of the primer is shown in SEQ ID No. 2-3.

[0014] Thirdly, the present invention provides an inhibitor for treating breast cancer, said inhibitor comprising the shRNA or oligonucleotide of the aforementioned long non-coding RNA - LncRNA-RJ1.

[0015] Based on the above technical solution, the nucleotide sequence of the encoding gene of the shRNA is further shown in SEQ ID NO: 4-5 or SEQ ID NO: 6-7.

[0016] Based on the above technical solution, the inhibitor further includes an anticancer drug.

[0017] Based on the above technical solution, the anticancer drug further includes paclitaxel.

[0018] Fourthly, the present invention provides the use of the above-mentioned inhibitor in the preparation of a medicament for treating breast cancer.

[0019] Based on the above technical solution, the breast cancer further includes drug-insensitive triple-negative breast cancer and drug-resistant triple-negative breast cancer.

[0020] Based on the above technical solution, the breast cancer cell lines further include T47D, BT474, SK-BR-3, BT549 and MDA-MB-231.

[0021] Fifthly, the present invention provides the use of the above-mentioned inhibitor in the preparation of a medicament for reversing chemotherapy resistance in breast cancer.

[0022] Based on the above technical solution, the breast cancer further includes drug-resistant triple-negative breast cancer.

[0023] Based on the above technical solution, the breast cancer cell lines further include T47D, BT474, SK-BR-3, BT549 and MDA-MB-231.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] This invention discovers a novel long non-coding RNA, named LncRNA-RJ1. Its expression level in tumor tissues of triple-negative breast cancer patients, drug-resistant triple-negative breast cancer patients, and patients with poor prognosis of triple-negative breast cancer is significantly higher than in normal tissues. Furthermore, the prognosis of breast cancer patients and drug-resistant breast cancer patients worsens with increasing expression levels. Further research revealed that LncRNA-RJ1 expression levels are correlated with drug resistance in triple-negative breast cancer patients; decreased LncRNA-RJ1 expression levels are associated with significantly reduced breast cancer cell migration ability. Based on these findings, LncRNA-RJ1 can serve as a novel biomarker for the preparation of products for diagnosing and / or treating breast cancer, opening new avenues for evaluating chemotherapy resistance and efficacy in triple-negative breast cancer. Attached Figure Description

[0026] To more clearly illustrate the embodiments of the present invention, the accompanying drawings involved in the embodiments will be briefly described below.

[0027] Figure 1 The results show the expression levels of LncRNA-RJ1 in different tissues and cells in Example 1. A represents the expression level of LncRNA-RJ1 in breast cancer tissue and adjacent normal tissue, and B represents the expression level of LncRNA-RJ1 in different cells.

[0028] Figure 2 This is a graph showing the relationship between LncRNA-RJ1 expression level and patient prognosis in Example 2. In this graph, A represents the relationship between LncRNA-RJ1 expression level and patient survival time in breast cancer patients, and B represents the clinical characteristics of breast cancer patients and the correlation between LncRNA-RJ1 and breast cancer.

[0029] Figure 3 To verify the expression level of LncRNA-RJ1 in the cell line stably knocked out by ShRNA constructed in Example 3, A represents the detection results of different groups in the MDA-MB-231 cell line, and B represents the detection results of different groups in the BT549 cell line.

[0030] Figure 4In Example 4, the migration ability of the constructed stable LncRNA-RJ1 knockout cell line was detected using a cell scratch assay. In this example, A represents the detection results of different groups in the MDA-MB-231 cell line, and B represents the detection results of different groups in the BT549 cell line.

[0031] Figure 5 Example 5 uses the constructed stable LncRNA-RJ1 knockout cell line to detect its ferroptosis level. In this example, A is the statistical result of MDA measurement of MDA-MB-231 cells after experimental treatment, and B is the statistical result of MDA measurement of BT549 cells after experimental treatment.

[0032] Figure 6 The results of Example 6 show the effect of LncRNA-RJ1 knockout on the chemosensitivity of two cell groups. In Example 6, A shows the expression level of LncRNA-RJ1 in two drug-resistant cell lines, and B shows the effect of LncRNA-RJ1 knockout on the IC50 of MDA-MB-231 breast cancer cells. 50 The effect of C on the IC50 value, where C represents the effect of LncRNA-RJ1 knockout on BT549 breast cancer cells. 50 The impact of the value.

[0033] Figure 7 The results of detecting the expression levels of LRP1 and its downstream proteins in the ShRNA-constructed LncRNA-RJ1 cell line in Example 7 are shown. In this example, A represents the change in LRP1 protein level, and B represents the change in FTMT protein level.

[0034] Figure 8 The results of Example 8 show the effect of ShRNA inhibition of LncRNA-RJ1 expression on the sensitivity of cell chemotherapy in vivo. In the figure, A shows the appearance of tumor tissues in different groups of mice and the tissue weight statistics of tumor tissues; B shows the results of HE staining and tissue immunohistochemistry of tumor tissue sections in different groups of mice; C shows the expression level of FTMT protein in tumor tissues of mice in different groups. In the figure, 1-4 are mouse numbers, C represents the control group, S1 represents the LncRNA-RJ1 group, S2 represents the LncRNA-RJ2 group, and paclitaxel and plus signs together indicate that paclitaxel was injected. Detailed Implementation

[0035] The present invention will be described in detail below with reference to the embodiments. However, the implementation of the present invention is not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments can be obtained without creative effort and all fall within the protection scope of the present invention.

[0036] Example 1: Expression level of LncRNA-RJ1 in breast cancer tissues and cells

[0037] This embodiment uses real-time quantitative PCR (qPCR) technology to detect and evaluate the expression level of lncRNA-RJ1 in the tested tissues, so as to clarify the expression level of lncRNA-RJ1 in the target tissues. By using Cox regression analysis, the expression differences of lncRNA-RJ1 in tumor tissues and normal tissues are systematically analyzed and explored, providing data support for subsequent research on its association with diseases.

[0038] This embodiment collected and analyzed tissue samples (including cancerous tissue (n=30) and adjacent normal tissue (n=30)) from patients diagnosed with breast cancer at the Affiliated Zhongshan Hospital of Dalian University from 2014 to 2023; at the same time, it also analyzed human normal breast cells MCF-10A, breast cancer-related cell lines T47D, BT474, SK-BR-3, BT549 and MDA-MB-231.

[0039] The nucleotide sequence of LncRNA-RJ1 is shown below (SEQ ID No. 1):

[0040] .

[0041] Primer sequences:

[0042] LncRNA-RJ1 qPCR-F: (5'-3'): CACGTCAGAGCTGCTTCTTGT (SEQ ID No. 2);

[0043] LncRNA-RJ1 qPCR-R: (5'-3'): GGAGAATGGGGGAGGGGAGATA (SEQ ID No. 3);

[0044] PCR reaction system

[0045] The PCR template is cDNA obtained by reverse transcription of whole RNA extracted from cancer tissue and tumor cells; add the following components to the PCR tube and mix well to avoid foaming, and then perform the PCR reaction.

[0046] Table 1. Reaction System

[0047]

[0048] Real-time PCR experiments were performed using an ABI 7500fast instrument. The specific reaction conditions are as follows:

[0049] Table 2. Reaction conditions

[0050]

[0051] After the experimental process is completed, the generated raw data is first exported and classified and archived. Then, professional data analysis software is used to systematically process and analyze the exported data in order to extract effective research information.

[0052] The experimental data obtained in this embodiment using qPCR technology can directly reflect the expression of relevant indicators, as shown in the results. Figure 1 As shown, Figure 1 Results A showed that LncRNA-RJ1 expression was significantly upregulated in breast cancer tissues, showing a marked difference compared to normal tissues; meanwhile, Figure 1 B shows that the expression level of LncRNA-RJ1 in breast cancer cells is significantly higher than that in normal breast cells. Therefore, it can be inferred that the LncRNA-RJ1 fragment exhibits high expression levels in breast cancer.

[0053] Example 2: Relationship between LncRNA-RJ1 expression level and prognosis in breast cancer patients

[0054] This embodiment collected tissue samples from 60 patients diagnosed with triple-negative breast cancer at the Affiliated Zhongshan Hospital of Dalian University between 2014 and 2024, covering both cancerous and adjacent normal tissues. Quantitative real-time PCR (using the same detection method as in Example 1) was employed to detect the expression level of LncRNA-RJ1 in the tumor samples of these 60 patients. The patients were then divided into high-expression and low-expression groups based on the median LncRNA-RJ1 expression level. Kaplan-Meier analysis and Cox regression analysis were used to further explore the association between LncRNA-RJ1 expression level and patient survival and prognosis.

[0055] The results are as follows Figure 2 As shown, where Figure 2 A reflects the relationship between the mRNA expression level of LncRNA-RJ1 and patient survival time in triple-negative breast cancer patients. Figure 2 B shows the relationship between LncRNA-RJ1 expression levels and clinical characteristics of breast cancer patients, suggesting that high expression of LncRNA-RJ1 is associated with poor prognosis.

[0056] Example 3: Lentiviral drugs targeting the LncRNA-RJ1 gene can reduce the expression level of LncRNA-RJ1 in triple-negative breast cancer cells.

[0057] 1. In this experiment, the following two shRNAs (short hair RNA interference sequences) were designed to knock out the expression of LncRNA-RJ1.

[0058] LncRNA-RJ1 shRNA1:

[0059] AATTCGCTGATGCCCTTTTGCGCCGCTTCAAGAGAGCGGCGCAAAAGGGCATCAGCTTTTTG (5'-3'F, SEQ ID No. 4)

[0060] GGCCGCAAAAAAGCTGATGCCCTTTTGCGCCGCTCTCTTGAAGCGGCGCAAAAGGGCATCAGCG (5'-3'R, SEQ ID No. 5)

[0061] LncRNA-RJ1 shRNA2:

[0062] AATTCCGAACTATTTCACAGCCCACCTTCAAGAGAGGTGGGCTGTGAAATAGTTCCAAAAA (5'-3'F, SEQ ID No. 6)

[0063] GGCCGTTTTTGGAACTATTTCACAGCCCACCTCTCTTGAAGGTGGGCTGTGAAATAGTTCGG (5'-3'R, SEQ ID No. 7)

[0064] The experiment also included a control (empty vector plasmid PLKO.1), and its corresponding shRNA (PLKO.1 with inserted LncRNA-RJ1-shRNA sequence) was used as a control gene interference sequence against LncRNA-RJ1 to eliminate the influence of non-specific interference on the experimental results.

[0065] 2. Lentiviral packaging

[0066] 2.1. Solution Preparation: Two sets of mixed solutions were prepared according to the required experimental dosage:

[0067] Plasmid mixture: Take 3 μg of lentiviral packaging plasmid 1 (psPAX2 and pMD2.G), 3 μg of target plasmid (PLKO.1 plasmid with LncRNA-RJ1-shRNA inserted), add 2 ml of DMEM medium, and mix thoroughly;

[0068] Transfection reagent mixture: Take 21 μL of PEI transfection reagent, add 2 ml of DMEM medium, and mix gently.

[0069] The two mixtures were slowly mixed, vortexed for 10 seconds, and then left to stand at room temperature for 20 minutes to prepare the transfection mixture.

[0070] 2.2 Cell transfection:

[0071] HEK293T cells in the logarithmic growth phase were seeded into culture dishes. When the cell density reached 80%-90%, the old culture medium was carefully aspirated, and the above transfection mixture (about 4 ml) was slowly added along the wall of the dish. The culture dish was gently shaken to ensure the liquid evenly covered the cells. The culture dish was then returned to a 37°C, 5% CO2 incubator and cultured for 8 hours. After that, the transfection mixture was aspirated, and 7 ml of complete culture medium was added for continued culture.

[0072] 2.3 Virus Collection and Processing:

[0073] Forty-eight hours after transfection, the culture supernatant was collected using a sterile pipette, transferred to a centrifuge tube, and temporarily stored at 4°C. 4 ml of complete culture medium was added to the culture dish, and the culture was continued for another 24 hours before collecting the supernatant a second time. Both supernatants were centrifuged (3000 rpm, 4°C, 15 minutes) to remove cell debris. After centrifugation, the supernatant was filtered through a 0.22 μm filter membrane into a new centrifuge tube to obtain a clear filtrate.

[0074] 2.4 Virus Concentration and Preservation:

[0075] Based on filtrate volume: 5×PEG 8000 The solution was mixed with PEG in a 4:1 ratio. 8000 After sealing the centrifuge tubes, the solution was placed at 4°C. The tubes were gently inverted and mixed every 20 minutes for a total of 3-6 times, then allowed to stand overnight. The next day, the mixture was centrifuged at 3000×g for 30 minutes (4°C). The supernatant was carefully discarded, and the virus precipitate at the bottom of the tube was retained. 200 μL of complete culture medium was added to the precipitate, and the mixture was gently pipetted until completely dissolved. The precipitate was then transferred to 1.5 ml EP tubes and incubated overnight at 4°C to allow for complete resuspending of the virus. The resuspended virus solution was aliquoted into sterile cryovials, labeled, and stored at -80°C for long-term preservation, avoiding repeated freeze-thaw cycles.

[0076] 2.5 Lentiviral Infection and Screening of Breast Cancer Cells: Cell Seeding and Infection. Breast cancer cells in logarithmic growth phase (BT549 cells and MDA-MB-231 cells) were harvested, and after adjusting the cell density, they were seeded into 6-well plates, with each well containing 20%-30% cells. After complete cell adhesion, the culture medium in the wells was aspirated, and the prepared lentivirus solution was added, along with 1 ml of complete culture medium. The 6-well plates were gently shaken to distribute the virus solution evenly. The plates were then returned to the incubator, and the cells were cultured for 6-8 hours. The cell status was observed, and fresh complete culture medium was added or the total volume was increased to 2 ml, depending on the cell growth. The cells were then cultured for another 48 hours.

[0077] 2.6 Infection Efficiency Detection and Screening: qPCR technology was used to detect infected cells. Infected breast cancer cells from each group were collected, total RNA was extracted and reverse transcribed into cDNA, and qPCR was performed using the cDNA as a template to detect the relative expression level of LncRNA-RJ1 in the cells. Based on the detection results, cell groups with significantly downregulated LncRNA-RJ1 expression levels were screened for subsequent experiments.

[0078] See results Figure 3 Both LncRNA-RJ1 shRNA1 and LncRNA-RJ1 shRNA2 significantly inhibited the expression of lncRNA-RJ1, demonstrating the successful construction of a stable knockout cell line for LncRNA-RJ1. In the triple-negative breast cancer cell lines BT549 and MDA-MB-231, the expression of LncRNA-RJ1 was significantly reduced in the stably knocked-out cells. Figure 3 (A and 3B).

[0079] Example 4: Inhibiting LncRNA-RJ1 expression levels to suppress tumor cell migration ability

[0080] Cell scratch assay: This experiment used target cells (BT549 cells and MDA-MB-231 cells) in the logarithmic growth phase as the research object. According to the experimental requirements, experimental groups (LncRNA-RJ1 knockout cell group) and control groups (untreated control cell group) were set up. Three biological replicates were set up for each group to reduce error.

[0081] 1. Cell pretreatment: One day before the experiment, cells in each group were pretreated at approximately 5 × 10⁶ cells per well. 5 The cells were seeded at a density of 1,000 cells per well into 6-well cell culture plates. 2 mL of serum-containing complete culture medium was added to each well. The plates were then incubated in a 37°C, 5% CO2 incubator to ensure that the cells reached 100% confluence (forming a tight monolayer of cells) on the day of the experiment.

[0082] 2. Scratch preparation and treatment: Remove the culture plate and, in a sterile laminar flow hood, use a sterile 200 μL pipette tip perpendicular to the bottom of the well to make one parallel scratch along the diameter of each well in the 6-well plate. After scratching, gently rinse each well 3 times with sterile phosphate-buffered saline (PBS) to remove cell debris and suspended cells. Then, add 2 mL of serum-free culture medium to each well (to inhibit cell proliferation from interfering with migration results) and mark the initial time point (0 h).

[0083] 3. Culture observation and result recording: The treated culture plates were returned to the incubator for further culture. The plates were removed at 0 h, 12 h, and 24 h. Three different fields of view were selected in the middle and two ends of each well under an inverted optical microscope for photographing and recording. At the end of the experiment, the cells were fixed with 4% paraformaldehyde solution at room temperature for 30 minutes, and then the images were analyzed.

[0084] The results of the scratch test are shown below. Figure 4 The results showed that, compared to the control group, knocking out LncRNA-RJ1 reduced MDA-MB-231 ( Figure 4 A) and BT549 ( Figure 4 B) The cell's migration ability is significantly reduced.

[0085] Example 5: Knocking out LncRNA-RJ1 enhances ferroptosis in breast cancer cells

[0086] Malondialdehyde (MDA) assay: The stable LncRNA-RJ1 knockout cell lines BT549 and MDA-MB-231 constructed in Example 3 were used as experimental subjects. Both groups included an untreated control group, LncRNA-RJ1 Sh1 groups, and LncRNA-RJ1 Sh2 groups. The experimental groups also included LncRNA-RJ1 Sh1 + paclitaxel groups, LncRNA-RJ1 Sh2 + paclitaxel groups, and a paclitaxel-treated control group. Paclitaxel was used at 10 μmol for 24 h. MDA levels were detected using a malondialdehyde (MDA) assay kit (brand: Elabscience, country of origin: China). All operations were strictly performed according to the kit's instructions to ensure the accuracy and reproducibility of the results.

[0087] 1. Sample preparation: Collect cells in the experimental setup treatment phase and adjust the cell count to approximately 3 × 10⁻⁶. 6 Add the extraction buffer provided with the kit to the collected cells, mix thoroughly, and then perform cell lysis. After the cells are completely lysed, collect the resulting cell lysate for later use.

[0088] 2. Reaction system construction and incubation: Add an appropriate amount of the above cell lysis buffer to a sterile centrifuge tube, and set up a positive control group (add positive control sample according to the kit requirements); add the working solution from the kit to each centrifuge tube, and gently invert the centrifuge tube to mix the reaction mixture thoroughly; place the centrifuge tube containing the mixture in a 100°C environment for 40 minutes to ensure that the reaction proceeds fully.

[0089] 3. Subsequent processing and detection: After incubation, remove the centrifuge tubes and allow them to cool to room temperature. Once the mixture has cooled, centrifuge it (centrifugation parameters can be found in the kit instructions; typically, low-speed centrifugation is used). After centrifugation, carefully aspirate the supernatant and transfer it to the corresponding wells of an enzyme-linked immunosorbent assay (ELISA) plate. Measure the optical density (OD) of each well at 532 nm using a microplate reader and record the raw data. Perform analysis.

[0090] Malondialdehyde (MDA) is an important metabolite produced during lipid peroxidation of unsaturated fatty acids in the body under oxidative stress. Its level can indirectly reflect the degree of lipid peroxidation in the body, and thus assess the level of ferroptosis.

[0091] The results are as follows Figure 5 As shown in the figure, the MDA levels of two cell lines were measured after different treatments. It can be seen from the figure that the ferroptosis levels in each group treated with paclitaxel were significantly higher than those in the control group. Furthermore, knocking out LncRNA-RJ1 also significantly increased ferroptosis levels. Figure 5A and 5B).

[0092] Example 6: Inhibiting LncRNA-RJ1 expression can enhance the sensitivity of triple-negative breast cancer cells to chemotherapeutic drugs.

[0093] This experiment examined the expression level of LncRNA-RJ1 in control cell lines (non-paclitaxel-resistant MDA-MB-231 and non-paclitaxel-resistant BT549 cells) and the corresponding paclitaxel-resistant cell lines MDA-MB-231 and MDA-MB-231.

[0094] The lncRNA RJ1 stable knockout cells (BT549 cells and MDA-MB-231 cells) constructed in Example 3 were used as the research objects. Three types of samples were set up for both types of cells: control cells (not knocked out), lncRNA RJ1 shRNA1 knockout cells and lncRNA RJ1 shRNA2 knockout cells.

[0095] The cell counting kit (CCK-8) (supplier: Yeasen Biotechnology Co., Ltd., China) was used, and the specific operation was strictly carried out in accordance with the experimental protocol provided by the manufacturer.

[0096] 1. Cell seeding and grouping: Various cell types were seeded at a density of 1,000 cells per well in 96-well plates, and cultured in medium containing 10% serum in each well. The experiment was divided into a control group and a paclitaxel treatment group. The paclitaxel group was treated with a drug concentration gradient (0, 0.001, 0.01, 0.1, 1, 2, 5, 10 μmol / L), and all groups were cultured for 24 hours.

[0097] 2. Detection and Data Analysis: After culture, CCK-8 reagent was added to each well, and incubation continued for 1 hour. The absorbance of each well was measured at 450 nm using a microplate reader. The raw data were recorded and statistically analyzed. Based on the cell proliferation after treatment with different drug concentrations, the half-maximal inhibitory concentration (IC50) of paclitaxel for each group of cells was calculated. 50 value).

[0098] The results are as follows Figure 6 As shown, the expression level of LncRNA-RJ1 is significantly increased in paclitaxel-resistant breast cancer cells. Figure 6 A) Drug IC 50 The results of the value determination experiment showed that, in both cell types, the IC50 of cells after knocking out LncRNA-RJ1 was significantly lower. 50 The value decreased significantly, indicating a significant reduction in cellular chemotherapy resistance. Figure 6 B and Figure 6 C).

[0099] Example 7: Knockout of LncRNA-RJ1 cells affects the expression levels of LRP1 and its downstream protein FTMT.

[0100] This embodiment uses an immunoblotting assay for verification, and the specific process is as follows:

[0101] 1. SDS-PAGE gel preparation: Calculate and prepare the corresponding concentration of SDS-PAGE gel according to the molecular weight of the target protein to be detected (for example, use a higher concentration gel for small molecular weight proteins and a lower concentration gel for large molecular weight proteins) to ensure uniform gel polymerization without bubbles or cracks.

[0102] 2. Electrophoresis procedure: Connect the positive and negative electrodes of the assembled electrophoresis apparatus accurately, slowly inject 1×Running Buffer into the electrophoresis tank to ensure that the buffer completely submerges the gel sample wells; add protein samples and protein markers in sequence according to the experimental design, set the constant voltage to 80 V and start electrophoresis until the protein samples are separated to the appropriate position on the gel (this can be judged by the marker migration).

[0103] 3. Transfer Process: After electrophoresis, carefully peel off the gel and remove the top compressed gel. Stack the gel layers in the transfer clamp in the following order: "negative electrode black side - sponge - three layers of filter paper - gel - NC membrane - three layers of filter paper - sponge - positive electrode white side", ensuring that each layer is free of air bubbles and aligned. Place the transfer clamp into the transfer tank, place an ice plate inside the tank, and cover the outside with an ice box to maintain a low temperature environment. After injecting 1×Trans Buffer, set the constant voltage to 80 V for transfer for 2 hours. After the transfer is completed, briefly stain the NC membrane in Ponceau S solution and observe the protein bands to verify the transfer effect. Then, cut out the NC membrane region containing the target protein according to the protein marker position.

[0104] 4. Immunoassay and Detection: Place the cut NC membrane in blocking buffer and block at room temperature for 1 hour to block non-specific binding; discard the blocking buffer and wash the NC membrane three times with PBS-T buffer for 10 minutes each time; dilute the commercial primary antibody with blocking buffer according to the recommended ratio in the instructions, add it to the NC membrane, and incubate overnight at 4°C; recover the primary antibody the next day and wash the NC membrane three times with 0.5% PBS-T buffer for 10 minutes each time; dilute the secondary antibody (mouse anti-rabbit or goat anti-rabbit secondary antibody) with blocking buffer at a ratio of 1:10000 and incubate the NC membrane at room temperature for 1 hour; discard the secondary antibody after incubation and wash the membrane three more times with PBS-T buffer for 10 minutes each time; after the NC membrane is dried, place it in an Odyssey exposure apparatus for exposure imaging, observe and record the grayscale and expression of the target protein band.

[0105] Experimental results are as follows Figure 7As shown in Figures A and 7B, knocking out LncRNA-RJ1 promotes increased expression levels of LRP1 while inhibiting the protein levels of its downstream molecule FTMT. Studies have indicated that FTMT can suppress ferroptosis.

[0106] Example 8: Inhibiting LncRNA-RJ1 expression in vivo can increase tumor susceptibility to chemotherapy drugs.

[0107] 1. Cell-derived xenograft tumor model

[0108] Establishment of a mouse subcutaneous tumor model: Five-week-old female nude mice were randomly divided into six groups (n=4 per group), and the injection dose was 1×10⁻⁶. 6 Tumor cells were injected subcutaneously into the right flank of each mouse. Then, the experimental group mice received intraperitoneal injections of paclitaxel (10 mg / kg) every 3 days. The specific groupings are as follows:

[0109] Control group: The injected tumor cells were breast cancer cells MDA-MB-231.

[0110] LncRNA-RJ1 Sh1 group: The injected tumor cells were stable LncRNA-RJ1 knockout MDA-MB-231 cells treated with LncRNA-RJ1 Sh1.

[0111] LncRNA-RJ1 Sh2 group: The injected tumor cells were stable LncRNA-RJ1 knockout MDA-MB-231 cells treated with LncRNA-RJ1 Sh2.

[0112] Paclitaxel group: The injected tumor cells were breast cancer cells MDA-MB-231, and the injected drug was paclitaxel.

[0113] Paclitaxel + LncRNA-RJ1 Sh1 group: The injected tumor cells were stable LncRNA-RJ1 knockout MDA-MB-231 cells treated with LncRNA-RJ1 Sh1, and the injected drug was paclitaxel.

[0114] Paclitaxel + LncRNA-RJ1 Sh2 group: The injected tumor cells were stable LncRNA-RJ1 knockout MDA-MB-231 cells treated with LncRNA-RJ1 Sh2, and the injected drug was paclitaxel.

[0115] 2. This experiment assessed tumor growth in mice by periodically measuring tumor volume and used Western blot to detect the expression of key proteins. The specific procedures are as follows:

[0116] 2.1 Tumor Volume Monitoring: Tumor volume was measured every 5 days in each experimental group of mice, starting from tumor inoculation. The longest diameter (length) and shortest diameter (width) of the tumor were recorded using vernier calipers. The formula "tumor volume (mm²)" was used. 3 = Length × Width 2 Calculate the tumor volume of each group of mice using the formula ×0.5”, record the data, and plot the tumor growth curve.

[0117] 2.2 Tumor Sample Collection and Processing: After 35 days of the experiment, all mice were euthanized. Immediately after euthanasia, tumor tissue was removed from the mice. The appearance, size and growth status of the tumors were observed and recorded. The tumor tissue was then divided into two parts: one part was used for subsequent protein extraction, and the other part was flash-frozen in liquid nitrogen and stored at -80°C.

[0118] 2.3 Protein Expression Detection (Western blot): The tumor tissue samples described above were used to extract total protein using conventional protein extraction methods. After determining the protein concentration using the BCA method and standardizing the loading volume, the samples were subjected to SDS-PAGE electrophoresis, membrane transfer, blocking, and immunoincubation, following the procedure outlined in Example 7 for "Western blot experiment". The primary antibody used was a specific antibody targeting FTMT protein, and the secondary antibody was a suitable fluorescently labeled secondary antibody. Finally, the relative expression levels of FTMT protein in each group of tumor tissues were analyzed and compared using an Odyssey exposure system to reflect the level of ferroptosis in the tissues.

[0119] 3. Immunohistochemistry

[0120] This experiment used immunohistochemistry to detect the expression and localization of target proteins in tissue samples. The specific procedure is as follows:

[0121] 3.1 Dewaxing and Hydration: The paraffin sections of the tissue samples to be tested were placed in a 60℃ oven and baked for 30-60 minutes to enhance the adhesion between the sections and the glass slides. After baking, the sections were immersed in xylene I, xylene II, and xylene III for 10 minutes each to complete the dewaxing process. Then, they were transferred to an ethanol gradient (concentration from high to low: 100%, 95%, 80%, 70%), and immersed for 2 minutes at each ethanol level to achieve tissue hydration. Finally, the sections were washed three times with PBS buffer for 3 minutes each time to remove residual ethanol.

[0122] 3.2 Cell permeation and blocking: Prepare blocking and permeation solution (formulation: 40 ml PBS with 120 μl Triton X-100 and 400 μl 30% H2O2), preheat it and evenly infiltrate the sections, incubate at room temperature in the dark for 30 minutes to reduce the activity of endogenous peroxidase in the tissue and reduce non-specific staining; after incubation, wash the sections 3 times with PBS buffer for 3 minutes each time to remove residual blocking and permeation solution.

[0123] 3.3 Antigen retrieval: The antigen retrieval method was used. The slides were immersed in 0.01 M sodium citrate buffer at pH 6.0, and then placed in a microwave oven and heated on high for 4 minutes until the buffer boiled. The microwave oven was turned off, and the slides were removed and allowed to cool naturally to room temperature. The heating-cooling process was repeated twice, and sodium citrate buffer was replenished in time during the process to prevent the slides from drying out. After the antigen retrieval was completed, the slides were washed three times with PBS buffer for 3 minutes each time.

[0124] 3.4 Serum blocking: Select serum from the same source as the secondary antibody to be used later, evenly cover the tissue section area, and incubate in a 37°C incubator for 30 minutes to block non-specific binding sites in the tissue; after incubation, gently absorb excess serum from the surface of the section with clean filter paper, without washing with water.

[0125] 3.5 Primary antibody incubation: Dilute the commercial primary antibody according to the recommended ratio in the instructions, and add 20 μl of the diluted primary antibody to each slide to ensure that the primary antibody evenly covers the tissue; then incubate the slides overnight at 4°C; after the primary antibody incubation is completed, wash the slides three times with PBS buffer for 3 minutes each time to remove unbound primary antibody.

[0126] 3.6 Secondary antibody incubation: Dilute mouse anti-rabbit secondary antibody or goat anti-rabbit secondary antibody at an appropriate ratio, add 20 μl of diluted secondary antibody to each slide, and incubate in a 37℃ incubator for 1-2 hours to allow the secondary antibody to specifically bind to the primary antibody bound to the antigen. After incubation, wash the slides three times with PBS buffer for 3 minutes each time to remove unbound secondary antibody.

[0127] 3.7 Slide development: Prepare DAB-H2O2 chromogenic solution and evenly drop it onto the surface of the tissue section. Develop the chromogenic solution at room temperature for 10 minutes. During the chromogenic process, observe the staining status under a microscope in real time. When the target area is clearly stained and the background staining is relatively light, immediately rinse the section with distilled water to stop the chromogenic reaction and avoid over-development.

[0128] 3.8 Counterstaining and Mounting: After staining, the sections were immersed in hematoxylin staining solution for 30 seconds to counterstain the cell nuclei. After staining, the sections were gently rinsed with running water, then immersed in hydrochloric acid alcohol for 2 seconds to remove excess hematoxylin staining solution. The sections were then soaked in running water for 15 minutes to allow them to turn blue again. After dehydration, the sections were placed in an ethanol gradient (concentration from low to high: 50%, 70%, 95%, 100%), soaking for 2 minutes at each level. After dehydration, the sections were soaked in xylene for 5 minutes to make them transparent. Finally, a suitable amount of neutral resin was dropped onto the surface of the tissue section, and a coverslip was placed on top for mounting. After the resin solidified, the immunohistochemical staining results were observed and recorded under a microscope.

[0129] The results are as follows Figure 8 As shown in the photographs of the tumor tissue appearance and the results of HE staining and Ki67 immunohistochemistry of the tumor sections, it can be found that the tumor's proliferative capacity was significantly reduced and the corresponding tumor size was significantly reduced after knocking out LncRNA-RJ1.

[0130] exist Figure 8 As can be seen, the tumor's proliferative capacity is reduced after knocking out LncRNA-RJ1. After using paclitaxel, the tumor's proliferative capacity is significantly reduced after knocking out LncRNA-RJ1, and the tumor weight also reflects the same trend.

[0131] Ki67 represents the proliferative capacity of tissue cells, which is composed of... Figure 8 As shown in Figure B, knocking out LncRNA-RJ1 significantly reduced the Ki67 expression level in mouse tumors, and the proliferation capacity of mouse tumors was also reduced under chemotherapy treatment.

[0132] Depend on Figure 8 As can be seen from C, the expression level of FTMT protein in mouse tumor tissues was also reduced after knocking out LncRNA-RJ1. It can be seen that the FTMT protein level in the tissues was significantly reduced after knocking out LncRNA-RJ1, and the same trend was observed after treatment with paclitaxel.

[0133] The descriptions of the above embodiments are only intended to assist those skilled in the art in understanding the core ideas of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made based on the present invention, implemented by those skilled in the art without departing from the concept of the present invention, should be included within the scope of protection of the present invention.

Claims

1. A biomarker for diagnosing breast cancer, characterized by, The biomarker is a long non-coding RNA-LncRNA-RJ1, the nucleotide sequence of which is shown in SEQ ID No.

1.

2. The use of the biomarker of claim 1 in the preparation of reagents or kits for diagnosing triple-negative breast cancer.

3. Use according to claim 2, characterized in that, The aforementioned triple-negative breast cancer includes drug-resistant triple-negative breast cancer and drug-resistant triple-negative breast cancer.

4. An inhibitor for treating breast cancer, characterized in that, The inhibitor comprises the shRNA or oligonucleotide of the long non-coding RNA-LncRNA-RJ1 as described in claim 1; the nucleotide sequence of the encoding gene of the shRNA is shown in SEQ ID NO: 4-5 or SEQ ID NO: 6-7.

5. The inhibitor according to claim 4, characterized in that, The inhibitors mentioned also include anticancer drugs.

6. The use of the inhibitor according to claim 4 or 5 in the preparation of a medicament for treating breast cancer, characterized in that, The breast cancers mentioned are drug-insensitive triple-negative breast cancer and drug-resistant triple-negative breast cancer.

7. The use of the inhibitor according to claim 4 or 5 in the preparation of a medicament for reversing chemotherapy resistance in breast cancer, characterized in that, The breast cancer mentioned is drug-resistant triple-negative breast cancer.

Images