Application of SNP-C645G site detection reagent in auxiliary identification of wheat ear grain number trait
By detecting the SNP-C645G site on chromosome 4B of the wheat genome, and using PCR amplification and enzyme digestion techniques to identify genotypes, the problem of poor repeatability of wheat ear grain number under different environments was solved, realizing efficient molecular marker-assisted selection breeding and improving wheat yield potential.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
- Filing Date
- 2025-10-14
- Publication Date
- 2026-07-14
Smart Images

Figure CN121087217B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to the application of a wheat spike grain number-related SNP-C645G site. Background Technology
[0002] Wheat is one of the world's most important food crops, and improving its productivity has always been a key research focus in agronomy. The number of grains per ear, a crucial factor influencing wheat yield, is determined by a combination of genetic, cultivation management, and environmental conditions. Due to the complexity of this quantitative trait, research on wheat grain number per ear is relatively limited. Therefore, identifying genetic loci controlling grain number per ear, developing molecular markers, and promoting genetic improvement of wheat yield traits are of great significance for ensuring global food security.
[0003] Wheat grain number is a typical quantitative trait, regulated by multiple genes. To date, over 200 QTLs controlling wheat spike-related traits have been reported, distributed across 21 chromosomes throughout the genome, primarily concentrated on chromosomes 1A, 2A, 2B, 4A, 4B, 5B, 6A, and 7A. Wheat grain number is closely related to spike agronomic traits such as the number of spikelets per spike and spike length. Liu et al. constructed a restricted interstitial (RIL) population to detect three additive QTLs controlling grain number on chromosomes 4B, 3A, and 5A in five environments. Mason et al., using a created RIL population, discovered three QTL loci controlling grain number on chromosomes 4B, 7A, and 7D, explaining 8.2%–10.4% of the phenotypic variation. Mizuno et al., using 188 DH families, identified seven QTLs controlling KNPS on chromosomes 2A, 2D, 4A, 6D, 5A, and 3B, explaining 3.8–14.3% of the phenotypic variation. Zhang Pengxia et al., using a RIL population of 134 wheat materials, detected four KNPS-related QTLs on chromosomes 2D, 4A, and 5B, contributing 8.85–15.02% to the phenotypic variation. Lin et al., using a RIL population of 300 materials constructed from wheat H461 × Chinese Spring, detected three KNPS-related QTLs on chromosomes 2B and 2D, explaining 3.07–26.57% of the phenotypic variation.
[0004] Although many QTLs related to wheat grain number have been identified, most QTLs have a small phenotypic contribution, require additive effects to be expressed, and have poor repeatability across different years and environments. Therefore, these QTLs are difficult to apply to the genetic improvement of wheat grain number. Summary of the Invention
[0005] To address the problems existing in the prior art, this invention provides an application of the wheat spike grain number-related SNP-C645G. By detecting this SNP site, wheat with a high spike grain number can be identified, providing a new method for molecular marker-assisted selection breeding of wheat.
[0006] The specific technical solution adopted in this invention is as follows: Application of the wheat spike grain number-related SNP-C645G locus in assisting the identification of wheat spike grain number trait, wherein the SNP-C645G is a locus located on chromosome 4B of the wheat genome, corresponding to the 645th base of the sequence shown in SEQ ID NO.1, and is C or G.
[0007] When the SNP-C645G site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the number of grains per ear is smaller or candidate smaller than that of wheat homozygous for genotype A.
[0008] The application is based on a reagent or kit containing a combination of PCR amplification-specific primers corresponding to the SNP-C645G site.
[0009] The PCR amplification specific primer combination includes primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5.
[0010] The beneficial effects of this invention are: This invention, through genetic variation analysis of a natural wheat population, discovered that the SNP corresponding to position 645 of SEQ ID NO. 1 has two genotypes: genotype A (C) and genotype B (G). Association analysis demonstrated that, in homozygous cases of these two genotypes, the number of grains per ear is: wheat homozygous for genotype A has fewer grains per ear or a candidate number of grains per ear is smaller than wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting this SNP. Experiments have shown that by detecting this SNP, wheat varieties with higher grain numbers per ear can be identified. This invention provides a new method for marker-assisted selection breeding of wheat, which is of great significance in breeding high-yielding wheat varieties or in research. The SNP locus developed in this invention not only expands the genetic resource tools for wheat but also demonstrates good and broad application potential through scientific experiments and statistical data verification. Attached Figure Description
[0011] Figure 1 This is a schematic diagram of the gene structure and a schematic diagram of the SNP sites of this invention.
[0012] Figure 2The electrophoretic detection results of the SNP-developed dCAPS-labeled enzyme digestion products of this invention are shown. In this context, lane G represents the bands that are cut by Hpy188I, and lane C represents the bands that cannot be cut by Hpy188I.
[0013] Figure 3 This is a schematic diagram illustrating the correlation between gene polymorphism sites and grain number in a natural population.
[0014] Figure 4 This is a schematic diagram of gene SNP sites and genotypes in the wheat population material of this invention.
[0015] Figure 5 This is a photo of the wheat harvesting site in Example 2.
[0016] Figure 6 These are field photos of the wheat ear grain count survey in Example 2. Detailed Implementation
[0017] The present invention will be further described below with reference to the accompanying drawings and specific embodiments: This invention discloses a SNP site related to the number of grains per ear of wheat. The SNP site corresponds to the 645th base of the sequence shown in SEQ ID NO.1. When this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B. The number of grains per ear is: wheat homozygous for genotype A is smaller or candidate smaller than wheat homozygous for genotype B.
[0018] The present invention also discloses a reagent or kit for identifying or assisting in the identification of wheat ear grain number traits. The reagent or kit is used for the above-mentioned SNP sites. The reagent or kit contains a PCR amplification specific primer combination and enzyme digestion component corresponding to the SNP sites, as well as other necessary components for gene detection, such as template DNA, buffer and dNTPs.
[0019] As a preferred embodiment of the present invention, the target DNA fragment for PCR amplification of the reagent or kit is designed to be 619-723bp in SEQ ID NO.1.
[0020] As a preferred embodiment of the present invention, the PCR amplification specific primer combination includes: primer pairs 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.
[0021] As a preferred embodiment of the present invention, the enzyme digestion component is the restriction endonuclease Hpy188I.
[0022] On the other hand, the present invention also includes a method for identifying or assisting in the identification of wheat ear grain number in the early stage of breeding. Based on the above-mentioned SNP sites, in the early stage of molecular marker-assisted selection breeding, primers are designed to amplify any DNA fragment containing the SNP sites in the genomic DNA of the wheat to be tested by PCR. The wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat ear grain number phenotype is identified or assisted in the identification based on the following correlation between genotype and phenotype: the wheat ear grain number of homozygous genotype A is less than or candidate less than that of wheat homozygous genotype B.
[0023] As a preferred embodiment of the present invention, the DNA fragment amplified by PCR is 619-723bp in SEQ ID NO.1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the restriction endonuclease Hpy188I is used for enzyme digestion.
[0024] As a preferred embodiment of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain PCR products; diluting this PCR product 50 times, using it as a template, amplifying with primers 2F and 2R to obtain PCR products; digesting the PCR product with the restriction endonuclease Hpy188I; if the PCR product cannot be cleaved, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product can be cleaved, the nucleotide polymorphism site is G / G, and the genotype is B; the number of grains per ear is: wheat homozygous for genotype A is smaller or candidate smaller than wheat homozygous for genotype B.
[0025] On the other hand, the present invention also includes the use of the above-mentioned wheat SNP sites, which is to screen or assist in screening the wheat spike-grain number phenotype in the early stage of molecular marker-assisted selection breeding.
[0026] Finally, the present invention also includes a primer combination comprising primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the above-mentioned SNP sites.
[0027] Example 1: Detection of SNPs related to wheat ear grain number and their PCR-enzyme digestion polymorphisms 1.1 Specific primers and sequence analysis for amplifying the genomic fragment containing this wheat SNP A SNP was found on chromosome 4B of the wheat genome, corresponding to position 645 in SEQ ID NO.1. Two genotypes were found at this locus in the naturally occurring wheat population: Genotype A: C Genotype B: G Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site: F1:AAATGGCAACCCTTGGGGGTG (SEQ ID NO: 2) R1:ATGGCCATCTTCATGACAA (SEQ ID NO: 3) F2:GTATTACACCACAATGATTAAG (SEQ ID NO: 4) R2: TTATTACTCTTGGGTGCTTGGT (SEQ ID NO: 5) The target sequences for PCR amplification using primer pairs F1 and R1 are as shown in SEQ ID NO. 1 (positions 489-1740); the target sequences for PCR amplification using primer pairs F2 and R2 are as shown in SEQ ID NO. 1 (positions 619-723). Enzyme digestion analysis showed that this polymorphism could be recognized by Hpy188I.
[0028] 1.2 Establishment of PCR-restriction polymorphism detection and genotyping methods 1) Extract genomic DNA from the wheat to be tested; 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) consists of: 7 μL ddH2O, 10 μL 2×Taq Mix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).
[0029] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, for 30 cycles; 72℃ for 10 min; and storage at 16℃.
[0030] 3) Dilute the PCR product from step 2) 10 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2×Taq Mix 10 μL, primer F1 (10 μmol / L) and primer R1 (10 μmol / L) 1 μL, template (20 ng / μL) 1 μL.
[0031] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 15 s, for 32 cycles; 72℃ for 10 min, and stored at 16℃.
[0032] 4) Digest the PCR product obtained in step 3) with Hpy188I to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified sites according to the following method: If the enzyme digestion product is a single or large fragment, then the wheat being tested is homozygous for C at the specified site (represented as C / C). Figure 2 Lane C in the swimming pool; If the enzyme digestion product consists of two or smaller fragments, then the wheat being tested is homozygous for G at the specified site (represented as G / G). Figure 2 Lane G in the middle of the swim.
[0033] 5) Based on the results of step 4), wheat is classified into two types, I and II, at the stated site: I: C / C (i.e., homozygous genotype A); II: G / G (i.e., homozygous genotype B); The part before the " / " represents the case on one homologous chromosome, and the part after the " / " represents the case on another homologous chromosome.
[0034] 1.3. Using dCAPS markers to genotype natural populations and performing association analysis with grain number traits. Each wheat variety in a natural population consisting of 348 hexaploid wheat varieties was used as a test wheat variety. Genotyping was performed according to the method in step 2. The amplification products of some wheat varieties were randomly sequenced for verification. The results are shown in Table 1.
[0035] Table 1. Information on the polymorphic sites described in natural wheat populations.
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043] Example 2: Association Analysis of Gene Polymorphism Sites and Grain Number in Natural Populations Our technical team conducted exon capture sequencing on 397 materials and performed specific genotyping on these materials. Genotyping included two cases: homozygous C / C genotype A and homozygous G / G genotype B. For example... Figure 4 Of the 397 materials, 372 materials could be clearly distinguished as homozygous C / C genotype A or homozygous G / G genotype B, while the remaining 25 materials could not be genotyped.
[0044] Furthermore, of these 397 materials, 348 had agronomic trait data from multiple years and locations, while the remaining 49 materials lacked sufficient data to meet the requirements for subsequent analysis. Therefore, as shown in Table 2 and... Figure 3 As shown, only these 348 data points were used in the association analysis between the genetic polymorphism sites in natural populations and the number of grains per ear. However, among these 348 data points, 17 materials did not have genotyping, so the actual number of samples used for the association analysis was 331.
[0045] In 2019, wheat populations of the above-mentioned natural populations were planted in dry-hot and dry-hot and hydrothermal fields at the Hebei Agricultural University Third Branch Experimental Station (Baoding, Hebei); in 2020, they were planted in dry-hot and dry-hot and hydrothermal and hydrothermal fields at the Hebei Agricultural University Hengshui Experimental Site (Baoding and Hengshui, Hebei); and in 2021, they were planted in dry-hot and dry-hot fields at the Hebei Agricultural University Gaocheng Experimental Site (Gaocheng Experimental Station). The number of grains per ear for each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the relationship between the number of grains per ear and the polymorphic loci. A mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 2. Figure 3 As shown.
[0046] Table 2. Results of association analysis between gene polymorphism sites in natural populations and grain number per ear.
[0047] The association analysis results in Table 2 show that the differences in grain number per spike between the two types in the natural population composed of 348 hexaploid wheat accessions shown in Table 1 were statistically significant (P < 0.05). Specifically, the grain number per spike in type I wheat was consistently lower than that in type II wheat. In several environments, the grain number per spike in type I wheat was 3.46, 2.53, 1.33, 2.44, 3.05, 1.12, 2.86, 2.15, 3.03, and 1.35 fewer than that in type II wheat, respectively. This study of the natural population indicates that type II is a superior genotype for increasing grain number per spike in wheat.
Claims
1. The application of the SNP-C645G site detection reagent in the auxiliary identification of wheat ear grain number trait, characterized by: The SNP-C645G is a site located on chromosome 4B of the wheat genome, corresponding to the 645th base of the sequence shown in SEQ ID NO.1, which is either C or G; When the SNP-C645G site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the number of grains per ear is smaller or candidate smaller than that of wheat homozygous for genotype A.
2. The application according to claim 1, characterized in that: The application is achieved using PCR-enzyme digestion, which is based on reagents or kits and the restriction endonuclease Hpy188I. The reagents or kits contain a combination of PCR amplification-specific primers corresponding to the SNP-C645G site. The PCR amplification specific primer combination includes: primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5; The PCR-enzyme digestion method includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain PCR products; diluting this PCR product 50 times, using it as a template, amplifying with primers 2F and 2R to obtain PCR products; digesting the PCR product with the restriction endonuclease Hpy188I; if the PCR product cannot be cleaved, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product can be cleaved, the nucleotide polymorphism site is G / G, and the genotype is B; the number of grains per ear is: wheat homozygous for genotype A is smaller or candidate smaller than wheat homozygous for genotype B.
Citation Information
Patent Citations
CN110184381A
CN119410814A