Use of gmabhd6 protein in controlling soybean oil content or soybean protein content

Abstract

The application discloses application of GmABHD6 protein in controlling oil content or soybean protein content, and belongs to the technical field of soybean quality. The application aims to improve the quality of soybean, and improve the oil content and protein content of soybean. The application discloses application of GmABHD6 protein in controlling oil content or soybean protein content or improving soybean yield, wherein the amino acid sequence of the GmABHD6 protein is shown as SEQ ID NO. 2. The GmABHD6 negatively regulates the oil content of soybean grains, and provides a theoretical basis for cultivating high-quality soybean.

Description

Technical Field

[0001] This invention belongs to the field of soybean quality technology, specifically relating to the application of GmABHD6 protein in controlling soybean oil content or soybean protein content. Background Technology

[0002] Soybeans originated in China and are now widely cultivated around the world. Soybean seeds contain approximately 40% protein and 20% oil, making them an important source of plant-based protein and oil for humans. With the continuous growth of the world's population and the increasing demand for soybeans, genetic improvement of soybean quality is becoming increasingly important.

[0003] Soybean oil contains a high proportion of unsaturated fatty acids, making it a nutrient-rich vegetable oil. The oil in soybean seeds is primarily stored as triacylglycerols (TAGs), which is the most common form of storage for vegetable oils. In terms of fatty acid composition, soybean oil contains five main fatty acid components: palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), and linolenic acid (C18:3). These fatty acids can be classified into three categories based on their degree of saturation: ① Oleic acid, as a monounsaturated fatty acid, contains one double bond in its carbon chain; ② Palmitic acid and stearic acid are saturated fatty acids, lacking double bonds in their carbon chains; ③ Linoleic acid and linolenic acid are polyunsaturated fatty acids (PUFAs), containing two or three unsaturated double bonds in their carbon chains. It is worth noting that PUFAs, due to the presence of multiple unsaturated bonds, are chemically more reactive and prone to oxidative degradation during storage and processing. This not only affects the quality of the oil but may also produce harmful substances. Soy protein is the plant-based protein with the amino acid composition most closely matching human needs, containing all the essential amino acids required by the human body, and is rich in calcium, phosphorus, iron, oligosaccharides, and various vitamins. Due to its balanced nutrition, soy protein drinks are often referred to as "plant milk." Furthermore, soy protein plays a role in regulating cholesterol levels, helping to lower cholesterol levels in individuals.

[0004] Studies have shown that the oil content of soybean seeds is not determined by a single gene, but is regulated by a multi-gene system. These traits are simultaneously influenced by genetic background, environmental conditions, and complex metabolic pathway interactions. Therefore, the final phenotype of soybean seed oil content is the result of the synergistic effect of internal and external factors. In recent years, significant progress has been made in the study of genes related to soybean oil content. Several key genes have been successfully cloned and their functions analyzed, laying a solid theoretical foundation for soybean molecular design breeding. Compared to the limitations of traditional breeding methods, which are time-consuming and inefficient, gene editing technology provides a solution for the genetic improvement of soybeans. Among them, the CRISPR / Cas9 system, due to its high efficiency and precision, has become an important technical means for soybean gene function research, variety improvement, and agronomic trait optimization, significantly improving breeding efficiency and shortening the breeding cycle. Currently, my country's soybean consumption continues to grow, and import dependence is increasing year by year. With the continuous growth of the population and the optimization and upgrading of dietary structure, improving soybean quality and yield has become an important direction for agricultural research. Therefore, cultivating high-quality soybean varieties is particularly urgent. Summary of the Invention

[0005] The purpose of this invention is to improve the quality of soybeans and increase their oil and protein content.

[0006] This invention provides an application of GmABHD6 protein in controlling soybean oil content, soybean protein content, or increasing soybean yield, wherein the amino acid sequence of the GmABHD6 protein is shown in SEQ ID NO.2.

[0007] This invention provides an application of the GmABHD6 gene in controlling soybean oil content, soybean protein content, or increasing soybean yield, wherein the GmABHD6 gene is shown in SEQ ID NO.1.

[0008] This invention provides the application of a recombinant vector containing the GmABHD6 gene in controlling soybean oil content, soybean protein content, or increasing soybean yield, wherein the GmABHD6 gene is shown in SEQ ID NO.1.

[0009] This invention provides the application of recombinant microbial cells containing the GmABHD6 gene in controlling soybean oil content, soybean protein content, or increasing soybean yield, wherein the GmABHD6 gene is shown in SEQ ID NO.1.

[0010] This invention provides the application of soybean plants overexpressing the GmABHD6 gene in increasing soybean protein content or soybean yield, wherein the GmABHD6 gene is shown in SEQ ID NO.1.

[0011] Further defined, soybean yield is determined by increased plant height, increased grain length and width, increased number of pods and grains per plant, and increased weight per 100 seeds.

[0012] This invention provides an application of soybean plants containing the mutant GmABHD6 gene in increasing soybean oil content.

[0013] Further specifying, the mutated GmABHD6 gene is as shown in any one of SEQ ID NO.7-9.

[0014] This invention provides a breeding method for increasing the oil content of soybeans, comprising the following steps: 1) Amplify the sgRNA of the GmABHD6 gene and insert the sgRNA into the CRISPR vector; the sgRNA of the GmABHD6 gene is shown in any one or more of SEQ ID NO.3-6; 2) The vector obtained in step 1) is introduced into Agrobacterium, and the Agrobacterium is used to transfer it into soybeans to obtain transgenic plants; 3) Identify the transgenic soybeans obtained in step 2) to obtain positive transgenic plants.

[0015] This invention provides a breeding method for increasing the protein content of soybeans, comprising the following steps: (1) Amplify the GmABHD6 gene and insert the gene sequence into a plant overexpression vector; the GmABHD6 gene is shown in SEQ ID NO.1; (2) The vector obtained in step (1) is introduced into Agrobacterium, and the Agrobacterium is used to transfer it into soybeans to obtain transgenic plants; (3) Identification step (2) The transgenic soybeans obtained in step (2) yielded positive transgenic plants.

[0016] Beneficial Effects: GmABHD6 Negatively Regulates Soybean Seed Oil Content: To investigate the gene function of GmABHD6, gmabhd6 mutants and GmABHD6 overexpressing plants were created, and the phenotypic characteristics of the transgenic plants were measured. Compared with the control (DN50), the gmabhd6 mutant plants showed significantly increased seed oil content and significantly decreased protein content; the GmABHD6 overexpressing lines showed significantly decreased seed oil content and significantly increased protein content. Transmission electron microscopy observation of sections at two developmental stages (MM and LM) showed that the number of oil bodies in gmabhd6 mutant seeds was greater than that in the control at both developmental stages, while the number of protein bodies was less than that in the control. In conclusion, GmABHD6 negatively regulates soybean seed oil content. Attached Figure Description

[0017] Figure 1Figure 1 shows the detection results of the overexpression vector; Note: A: Detection of the target gene on the Fu28 vector. M: DL5KPlus DNA molecular weight standard; 1: Positive control with PCR template of Fu28-GmABHD6 plasmid; 2: Negative control with PCR template of ddH2O; 3-12: PCR amplification results of the Fu28-GmABHD6 vector. B: Detection of the target gene on the pSOY1 vector. M: DL5KPlus DNA molecular weight standard; 1: Positive control with PCR template of pSOY1-GmABHD6 plasmid; 2: Negative control with PCR template of ddH2O; 3-12: PCR amplification results of the pSOY1-GmABHD6 vector. Figure 2 Figure showing the detection results of GmABHD6 overexpressing plants; Note: A: Bar test strip detection of overexpressing plants; B: PCR detection of overexpressing plants; M: DL5KPlus DNA molecular weight standard; 1: PCR template is pSOY1- GmABHD6 Plasmid positive control; 2: DN50; 3-6: ABHD6 OE1 7-10: ABHD6 OE2 ;11-14: ABHD6 OE3 C: Detection of expression level in overexpressing plants; CK: DN50; 1-4: ABHD6 OE1 ;5-8: ABHD6 OE2 ; 9-12: ABHD6 OE3 The experiment was performed three biological replicates, with the error value being the standard error. The internal reference gene used was... Actin2 and Actin11 The initial calculated value of the relative expression level is taken as 2. -∆Ct D: Western blot detection of overexpressing plants; CK: DN50; 1-4: ABHD6 OE1 ;5-8: ABHD6 OE2 ; 9-12: ABHD6 OE3 ； Figure 3Schematic diagram of soybean mutant knockout and detection; Note: A: Knockout target detection diagram, red horizontal lines indicate missing bases; B: Early termination of protein translation diagram; C: T-DNA insertion PCR detection results; M: DL2KPlus DNA molecular weight standard; 1: Positive control containing the Bar gene; 2: DN50; 3-7: gmabhd6ko1; 8-12: gmabhd6ko2; 13-17: gmabhd6ko3; D: Off-target detection results; Figure 4 Figure showing the results of oil, protein and fatty acid content in GmABHD6 transgenic soybean seeds; Figure 4 Oil, protein, and fatty acid content of GmABHD6 transgenic soybean seeds; Note: A, B: Seed quality phenotype of T2 generation transgenic plants; C, D: Seed quality phenotype of T3 generation transgenic plants; E: Fatty acid composition data of T2 generation transgenic plant seeds. Data were analyzed for significance using t-tests. The experiment was performed with ten biological replicates, and the error value was the standard error. *Significant difference P < 0.05; **Extremely significant difference P < 0.01; Figure 5 Image of transmission electron microscopy (TEM) observation of GmABHD6 transgenic soybean grains; Note: SSP represents protein bodies, OBs represents oil bodies. Bar = 5 μm; Figure 6 Figure 1 shows the phenotypic results of transgenic soybeans; Note: A: Comparison of plant height between transgenic and wild-type plants, Bar = 10 cm; C, E, F: Comparison of seed size between transgenic and wild-type plants, Bar = 1 cm; B: Comparison of significant differences in 100-seed weight; D: Comparison of significant differences in the number of seeds per plant. Data were analyzed for significance using t-tests. The experiment was performed with ten biological replicates, and the error value is the standard error. *Significant difference P < 0.05; **Extremely significant difference P < 0.01. Detailed Implementation

[0018] Table 1. All test primers

[0019] The soybean variety Dongnong 50 (DN50) was selected as the genetic transformation recipient material, and the cultivated soybean variety SN14 and the wild variety ZYD00006 were selected as materials for detecting the spatiotemporal expression specificity of genes. These materials, along with all transgenic plants, were planted in the transgenic field of Northeast Agricultural University from 2023 to 2024. Currently, the transgenic plants have been propagated to the T3 generation. Referring to the detailed description of each stage of soybean growth and development on the Soybase website (https: / / www.soybase.org / ), samples were taken from different tissues (roots, stems, flowers, leaves, pods, and seeds) and each stage of seed development. Seed development stages were further subdivided into: Cot stage (10-14 days after flowering), EM stage (30-50 days after flowering), MM stage (50-80 days after flowering), LM stage (80-110 days after flowering), and DS stage (mature dry seeds). Samples were taken for subsequent experimental analysis. The haplotype analysis used 997 germplasm resources from our research group and 2898 resource populations (from the public database Soyomics).

[0020] The *Escherichia coli* strains used were DH5α and BL21(DE3), and the *Agrobacterium tumefaciens* strain was EHA105. The selected knockout vector was pBSbdcas9i, the overexpression vector was pSOY1 (a gift from Professor Yongfu Fu), and the other introductory vector used was Fu28 (also a gift from Professor Yongfu Fu). The Fu28 and pSOY1 vectors are disclosed in patent application number CN202210517898.4.

[0021] The pBSbdcas9i knockout vector was provided by Wuhan Boyuan Company, and the Dicotyledonous Gene Editing Vector Kit (Basta) has the catalog number #REC44-1.

[0022] Example 1. GmABHD6 Creation of overexpression plants 1. Construction of the introductory platform Fu28 Found on the Phytozome website GmABHD6 The CDS sequence of the gene will GmABHD6 Connect the Fu28 introductory vector, select a suitable homologous arm on the Fu28 introductory vector, and design primers named Fu28- ABHD6 -F、Fu28- ABHD6 -R, primer sequences are shown in Table 1, and the gene was ligated into the vector using homologous recombination to obtain Fu28-. GmABHD6 .

[0023] Gm ABHD6 CDS sequence (SEQ ID NO.1); GmABHD6 amino acid sequence (SEQ ID NO.2); The detection primers were universal primers GFP-R, and their sequences are shown in Table 1.

[0024] 2. Fu28- GmABHD6 plasmid extraction The vector strain was stored in a laboratory freezer at -80°C, and the plasmid corresponds to chloramphenicol (Cm).

[0025] 3. LR reaction The target gene fragment from the Fu28 introductory vector was ligated into the plant expression vector pSOY1 using Gateway cloning technology. 2 µL of Fu28- GmABHD6 The plasmid, 2 µL of pSOY1 plasmid, and 1 µL of LR Clonase Enzyme Mix II were added to a centrifuge tube to obtain pSOY1- GmABHD6 The plasmid was briefly centrifuged and then reacted in a 25°C metal bath for 3 h. The product was transformed into Escherichia coli DH5α. The sequencing primers were the universal primers NOS-R, and the primer sequences are shown in Table 1.

[0026] 4. Transformation of Agrobacterium with expression vector and detection of Agrobacterium (1) Take out the Agrobacterium EHA105 competent cells frozen at -80℃ and place them on ice until they thaw before use.

[0027] (2) Take 10 µL (plasmid amount not exceeding 50 ng) of pSOY1- GmABHD6 The plasmid was added to the semi-melted EHA105 competent cells, and the mixture was gently blown and mixed with a pipette. The mixture was then placed on ice for 5 min.

[0028] (3) The competent cells were placed in liquid nitrogen for quick freezing for 5 min, then transferred to a 37°C water bath for heat shock for 5 min, and then placed in an ice bath for 5 min.

[0029] (4) Add 700 µL of antibiotic-free YEP liquid medium and incubate at 28°C and 220 rpm for 3 h with shaking.

[0030] (5) Take an appropriate amount of bacterial solution and spread it on a YEP solid plate containing the corresponding antibiotic. Incubate at 28°C upside down for 48-72 h until a single colony is formed.

[0031] (6) Pick a single colony in a clean bench and place it in 1 mL of YEP medium. Add 1 µL of spectinomycin (Spec) and 0.5 µL of rifampin (Rif). Incubate at 28°C and 220 rpm in a shaker until the bacterial culture becomes turbid. PCR detection of Agrobacterium-positive single colonies is performed using the primer Fu28- ABHD6-F and GFP-R, primer sequences are shown in Table 1. Bacterial culture was used as the detection template for the PCR reaction. The PCR reaction procedure is shown in Table 2 and the reaction procedure is shown in Table 3.

[0032] Table 2 PCR reaction system for positive monoclonal antibody detection

[0033] Table 3. PCR reaction procedure for positive monoclonal antibody detection.

[0034] (7) Gel electrophoresis detection: Prepare 1% agarose gel (weigh 1.5g agarose powder and dissolve it in 150 mL 1×TAE buffer, microwave for about 3 min until the liquid is transparent, cool and add nucleic acid dye, pour the dissolved agarose liquid into the gel casting plate, mix well, insert the comb, let stand for 40 min, when the gel turns milky white), spot the sample and complete the electrophoresis process.

[0035] (8) After the PCR reaction product is detected by agarose gel electrophoresis, if the electrophoretic bands of the positive control and the sample are clear and the size is correct, and the negative control has no band, it indicates that the bacterial culture sample can be used for the next experiment. It can be stored in a -80℃ refrigerator with an equal volume of 30% glycerol for later use.

[0036] 5. Soybean genetic transformation The laboratory culture medium formula is confidential. The specific conversion process is as follows: (1) Agrobacterium culture and treatment stage: PCR-positive Agrobacterium single clones were inoculated into liquid culture medium and cultured at 28℃ and 220 rpm with shaking until OD. 600 The concentration is 0.6-0.8. Collect the bacterial cells by centrifugation at 4000 rpm for 5 min, and then resuspend them to the appropriate concentration with freshly prepared infection buffer (containing 100 μM AS) for later use.

[0037] (2) Seed disinfection process: Select plump soybean seeds with no mechanical damage (DN50), and disinfect them by soaking in 75% ethanol solution for 5 min, shaking in 15% hydrogen peroxide solution for 12 min, and finally rinsing them repeatedly with sterile distilled water 5 times to completely remove disinfectant residue.

[0038] (3) Explant transformation: In a clean bench, soybean hypocotyls were cut and immersed in Agrobacterium suspension, and gently shaken to promote transformation. The explants were then transferred to a co-culture medium lined with filter paper and cultured at 25°C in the dark for 3-5 days.

[0039] (4) Establishment of regeneration culture system: After co-culture, the explants were regenerated for 5 days and then transferred to a culture medium containing screening antibiotics for 15-21 days of screening culture. After the formation of resistant shoots, they were transferred to elongation culture medium for 15-21 days of further culture.

[0040] (5) Identification of transgenic plants: Take new leaf tissue for rapid detection of Bar gene, screen positive plants, immerse the base of the plant in IBA solution for 30 s and then inoculate it into rooting medium to induce root development.

[0041] (6) Transplanting of transgenic plants: After the root system of tissue culture seedlings has developed, carefully remove the root agar and transplant them into sterile nutrient soil. Maintain suitable temperature and humidity conditions for adaptive culture and gradually transition to the normal growth environment.

[0042] Results: 1. Construction and detection of overexpression vectors: In order to explore the overexpression... GmABHD6 The influence of genes on the oil content of soybean seeds, creation GmABHD6 Overexpressing plants. First, GmABHD6 The CDS region sequence of the gene was ligated into the Fu28 entry vector for positive monoclonal identification, and the results are as follows: Figure 1 As shown in A. Then Fu28- GmABHD6 The plasmid underwent a logarithmic reaction to ligate the target gene fragment from the entry vector Fu28 into the plant expression vector pSOY1. Finally, the expression vector was transformed into Agrobacterium and Agrobacterium-positive assays were performed. The results are as follows: Figure 1 As shown in B in the diagram.

[0043] 6. Obtaining T0 generation plants by overexpression The overexpression vector was transferred into recipient plant DN50. Following induction, Agrobacterium tumefaciens culture preparation, explant infection, recovery culture, selection culture, elongation culture, and rooting culture, positive seedlings were detected using the Bar test strip method. The positive seedlings, after Bar test strip detection, were removed from the culture medium and hardened off, yielding a total of 8 regenerated plants and 20 seeds.

[0044] 7. GmABHD6 Identification of overexpressing plants (1) PCR detection of overexpressing plants Extracted using the CTAB method GmABHD6 Total DNA from overexpressing plants and control DN50 was collected and then PCR was performed using detection primers. If the band brightness and size were appropriate, further sequencing could be performed. After obtaining the DNA from the plants to be tested, it was used as a template to prepare the PCR system on ice and perform the PCR reaction. The primers used were Fu28- ABHD6 -F and GFP-R, the detection primer is GFP-R, the primer sequence is shown in Table 1, and the sequencing results are compared with... GmABHD6The CDS sequences were compared, and plants with completely identical sequences were preliminarily identified as successfully overexpressing plants.

[0045] (2) qRT-PCR detection of overexpressing plants First extract GmABHD6 RNA was extracted from leaves of overexpressing plants and control DN50 plants with similar growth. Then, reverse transcription was performed to convert the extracted RNA into cDNA. Finally, real-time quantitative PCR was performed (using primers q-GmABHD6-F and q-GmABHD6-R). After analyzing the data, plants with an expression fold greater than 20-fold compared to the control DN50 were selected as successfully overexpressing plants for further testing.

[0046] (3) Western Blot detection of overexpressing plants The overexpressing plants ultimately need to be detected by Western blotting. First, control plants with similar growth (DN50) and... GmABHD6 The specific steps for extracting total protein from overexpressing plants are as follows: 1) Cut off tender leaves with sterilized scissors and place them into 1.5 mL EP tubes labeled with the sample name. Quickly place the tubes into a liquid nitrogen tank and use a sample grinder to break up the leaves. 2) Add 100 µL of 2×Sample Buffer to the sample powder, vortex, and immediately place in ice for 10 min; 3) 100℃ metal bath for 5 min; centrifuge at 12000 rpm for 10 min at 4℃.

[0047] 4) Take 50 μL of the supernatant and use it immediately for experiments or store it at -20℃.

[0048] Western blotting experiments were conducted according to the standard method used by Shan Dapeng et al.

[0049] Results: 1. Identification of overexpressing plants using Bar test strips and PCR detection. The obtained transgenic seeds were continuously propagated up to the T3 generation to ensure genetic stability. After planting T3 generation transgenic plants at the Northeast Agricultural University transgenic base, leaf samples from mutant and control plants were collected after the true leaves unfolded. These samples were placed in clean 1.5 mL centrifuge tubes, 400 μL of water was added, and the plants were crushed. The presence of two clear bands on the test strips was observed; the negative control DN50 showed one band. Figure 2As shown in A in the figure. In addition, DNA was extracted from the other half of the fresh leaves, and specific primers were designed for PCR amplification targeting the complete coding sequence (CDS) of the gene and the full-length green fluorescent protein (GFP) on the vector fragment to verify whether the target gene was successfully fused with the expression vector. The experimental results showed that a 1834 bp target band was detected in the transgenic plants, with a size consistent with the positive plasmid band. However, when wild-type plants were used as the negative control, no GFP fragment was found on the vector, and no corresponding target band appeared. See Figure [Figure number missing in original text]. Figure 2 B in the middle.

[0050] 2. Expression level and protein detection in overexpression plants To verify whether the overexpressed gene was highly expressed, leaves from the PCR-tested plants (a total of 12 plants were selected) were placed in 1.5 mL RNase-free centrifuge tubes, and RNA was extracted from the selected plants and reversed into cDNA for further processing. Actin2 and Actin11 As an internal reference gene, it was found that 9 out of 12 plants from the 3 selected lines had significantly higher expression levels than the WT plants (the preliminary calculated value of relative expression was taken as 2). -∆Ct The result is shown in C in 2.

[0051] Western blot analysis was performed on the total protein in the leaves of the selected overexpressing transgenic plants. For example... Figure 2 As shown in D, among the 12 overexpression lines, 8 showed bands with the same molecular weight as the target protein (68 kDa), further verifying the high expression of GmABHD6 protein in the overexpression plants.

[0052] Example 2. gmabhd6 Creation of mutant plants 1. Construction of the knockout vector (1) Knockout vector primer design: Design CRISPR / Cas9 targets on the Target Design website (selected based on the percentage of off-score), and in GmABHD6 The appropriate knockout target sequence was designed from the gene exon region, and the primers were designed as ko- abhd6 -F、ko- abhd6 -R, primer sequences are shown in Table 1.

[0053] (2) Construction of the knockout vector: The target fragment (rDNAt1) was amplified by PCR reaction. The vector was constructed using the Golden Gate one-step method. The reaction system was prepared according to Table 3. After a short centrifugation, the product was placed in the PCR instrument. After the program was completed, the product was directly used for transformation.

[0054] Table 4 Golden Gate Reaction System and Procedure

[0055] (3) Transformation and plaque screening: The sequencing primers for plaque screening are Pbw2-F and Pbw2-R. The sequencing primer sequences are shown in Table 1.

[0056] 2. Soybean genetic transformation (1) Extract the vector plasmid by knocking it out, then transform it with Agrobacterium, and finally detect Agrobacterium.

[0057] (2) Obtained through soybean genetic transformation gmabhd6 Mutant.

[0058] 3. gmabhd6 Detection of homozygous mutant plants When the plant developed its first trifoliate compound leaf, DNA was extracted from the mutant plant. Primers were designed approximately 200 bp upstream and downstream of the target site, named sgRNA-F and sgRNA-R, and their sequences are shown in Table 1. The PCR products were directly sent to Sangon Biotech for sequencing. The obtained sequences were compared and analyzed using DNAMAN and SnapGene software, with a focus on analyzing the target site editing and whether the sequencing peaks were of a single peak type to confirm the editing effect.

[0059] To investigate the effect of knocking out the GmABHD6 gene on the oil content of soybean seeds, four superior sgRNA targets were designed in the CDS region of the GmABHD6 gene, with the following sequences: GATTTGCCGTACAAGCCGGAAGGG (SEQ ID NO.3); GGTACAATTATTGGACATGGAGG (SEQ ID NO.4); CCCAAAACCGAGCAAGTCTAAGG (SEQ ID NO.5); and CTGTTTCCAACTAAAACGGTTGG (SEQ ID NO.6).

[0060] Results: Detection of mutant plants The obtained mutant plants were continuously propagated up to the T3 generation to ensure genetic stability. After planting at the Northeast Agricultural University transgenic base, leaf samples from both mutant and control plants were collected after true leaves unfolded. Genomic DNA was extracted using the CTAB method, and PCR amplification of the target site was performed using specific primers. The products were then sent to Sangon Biotech for sequencing analysis. The sequencing results were analyzed using SnapGene software, and the editing status of the target site was confirmed by comparing the mutant and control sequences. The sequencing results are shown below. Figure 3 As shown in A and B, a total of 3 mutation types were detected. The results after connecting 4 target sites are as follows: Mutation type one ( gmabhd6 ko1): A single base (G) was inserted at target site 1. Sequencing results showed a single peak. Translation using an online amino acid translation website revealed that translation terminated at the 86th amino acid, resulting in the loss of function of the ABHD6 domain.

[0061] ABHD6+1CDS sequence: (SEQ ID NO.7); Mutation type two ( gmabhd6 ko2 The sequence showed a 7-base deletion at target site 1 (CAAGCCG), a 1-base deletion at target site 2 (G), and a 6-base deletion at target site 4 (TAAAAC). Sequencing revealed a single peak. Online amino acid translation revealed translation termination at amino acid 72, resulting in loss of function of the ABHD6 domain. The ABHD6-7, -1, -6 CDS sequence is shown in SEQ ID NO. 8. Mutation type three ( gmabhd6 ko3 The sequencing results showed a single peak at target site 1 (G), target site 2 (A), and target site 4 (AAAC). The results were translated by an online amino acid translation website, which found that the translation terminated at amino acid 85, resulting in the loss of function of the ABHD6 domain.

[0062] ABHD6-1, -1, -4CDS sequence: (SEQ ID NO.9); DNA from the extracted mutant and control DN50 was used for PCR identification using primers designed with the Bar marker gene. Primers were Bar-F and Bar-R. Results are as follows: Figure 3 As shown in C. gmabhd6 ko1 and gmabhd6 ko3 Most of the plants do not contain the marker gene. gmabhd6 ko2 Two of the five plants tested contained the marker gene, and other knockout types may appear in the offspring. To verify that the CRISPR / Cas9 system specifically edits only the target gene, the Target Design online tool (http: / / skl.scau.edu.cn / targetdesign / ) was used to predict and analyze potential off-target sites of the sgRNA. Based on the prediction results ( Figure 3 In the D region of the assay, potential off-target regions were selected for PCR amplification, and high-throughput sequencing was used to detect editing. Data analysis showed that no non-specific editing occurred at any of the detection sites.

[0063] Example 3. 1. Gas chromatography When determining the fatty acid content of genetically modified soybeans using gas chromatography, the ground sample was first mixed with 2.5% sulfuric acid methanol solution, BHT antioxidant, and heptadecanoic acid internal standard, and heated in a water bath at 85°C for 1.5 h (shaking every 10 min during this period). After cooling, NaCl solution and n-hexane were added for extraction, the supernatant was collected by centrifugation and concentrated under nitrogen, and finally redissolved in ethyl acetate before analysis using an Agilent 6890 gas chromatograph.

[0064] Result: 1. GmABHD6 Determination of oil, protein and fatty acid content in genetically modified soybean seeds In 2024, the T2 generation was planted at the Northeast Agricultural University transgenic base under consistent environmental conditions. GmABHD6 The mutant, overexpression, and control plants DN50 were tested after seed maturation. GmABHD6 Transgenic seeds are harvested according to lineage. Mutant plants are divided into three sub-mutant lineages based on different editing types. gmabhd6 ko1 , gmabhd6 ko2 and gmabhd6 ko3 The overexpressing plants were divided into three overexpression lines based on the time of acquisition of T0 generation transgenic plants and the fold increase in expression. GmABHD6 OE1 , GmABHD6 OE2 and GmABHD6 OE3 .

[0065] 2. Near-infrared spectroscopy was used to scan the T2 generation seeds harvested in 2024 and the T3 generation seeds harvested in a greenhouse in 2025 to determine the crude oil content of mature seeds. The results showed that the average total oil content of T2 generation WT seeds was 18.91%, and the three mutant lines (…) gmabhd6 ko1 , gmabhd6 ko2 and gmabhd6 ko3 The average total oil content was 19.61%, 19.78%, and 20.26%, respectively, which increased by 0.70%, 0.87%, and 1.35% compared with the control; the three overexpressed lines ( GmABHD6 OE1 , GmABHD6 OE2 and GmABHD6 OE3 The average fatty acid content was 17.59%, 18.22%, and 17.13%, respectively, which were 1.32%, 0.69%, and 1.78% lower than the control, and the differences were highly significant. Figure 4The average total oil content of seeds from T3 generation WT plants was 19.30%, and the three lines of the mutant (A); gmabhd6 ko1 , gmabhd6 ko2 and gmabhd6 ko3 The average total oil content was 20.51%, 20.79%, and 20.83%, respectively, which increased by 1.21%, 1.49%, and 1.53% compared with the control; the three overexpressed lines ( GmABHD6 OE1 , GmABHD6 OE2 and GmABHD6 OE3 The average fatty acid content was 17.87%, 17.32%, and 17.41%, respectively, which were 1.43%, 1.98%, and 1.89% lower than the control, and the differences were highly significant. Figure 4 (C in the middle).

[0066] 3. After harvest, the crude protein content of mature seeds of both T2 and T3 transgenic soybeans was determined using a near-infrared grain analyzer. The results showed that the average protein content of the T2 generation plants (WT) was 41.63%, while the three mutant lines (…) gmabhd6 ko1 , gmabhd6 ko2 and gmabhd6 ko3 The average protein content was 40.78%, 40.46%, and 39.02%, respectively, which were reduced by 0.85%, 1.17%, and 2.61% compared with the control. Two lines showed extremely significant differences, and one line showed a significant difference. The three overexpressing lines ( GmABHD6 OE1 , GmABHD6 OE2 and GmABHD6 OE3 The average protein content was 46.13%, 44.07%, and 43.98%, respectively, which increased by 4.50%, 2.44%, and 2.35% compared with the control, and all showed highly significant differences. Figure 4 The average protein content of the T3 generation WT plants was 40.82%, and the three lines of the mutant (B); gmabhd6 ko1 , gmabhd6 ko2 and gmabhd6 ko3 The average protein content of the three strains was 38.98%, 39.23%, and 39.03%, respectively, which were reduced by 1.84%, 1.59%, and 1.79% compared with the control, and all three strains showed highly significant differences; the three overexpressed strains (GmABHD6 OE1 , GmABHD6 OE2 and GmABHD6 OE3 The average protein content was 43.11%, 42.93%, and 42.79%, respectively, which increased by 2.29%, 2.11%, and 1.97% compared with the control, and all showed highly significant differences. Figure 4 (D in the middle).

[0067] Meanwhile, the contents of five major fatty acid components in T2 generation transgenic soybean seeds, including palmitic acid, stearic acid, oleic acid, linoleic acid, and linolenic acid, were analyzed by gas chromatography. The results showed that compared with the control, there were no significant changes in the five fatty acid components in the three mutant lines and the three overexpression lines. Figure 4 (E in the text).

[0068] Based on the above results: GmABHD6 Loss of function resulted in a significant increase in seed oil content and a decrease in protein content in mutant seeds; conversely, overexpression... GmABHD6 This resulted in a decrease in seed oil content and a significant increase in protein content. However, the five major fatty acid components in the seeds of transgenic plants did not show significant changes. This suggests that the genes... GmABHD6 It negatively regulates the oil content of soybean seeds, while positively regulating the protein content.

[0069] 4. Transmission electron microscopy section preparation method The preparation process for soybean seed transmission electron microscopy sections is as follows: (1) Mature seeds were fixed in FAA fixative at 4°C in the dark for 12 h. After peeling, they were cut into strips 1 mm long and 1 mm wide and fixed for another 15 days.

[0070] (2) Rinse three times with 0.1 M phosphate buffer (15 min each time) and fix with 1% osmium tetroxide for 3 h.

[0071] (3) Dehydrate with gradient ethanol (50%, 70%, 90% once each, 100% ethanol twice), and let stand at 4℃ for 10-20 min.

[0072] (4) Acetone replacement (1 time with 100% ethanol / acetone mixture, 1 time with pure acetone).

[0073] (5) After gradient permeation (overnight in a mixture of acetone / embedding solution 1:1, 1:2, 1:3), resin embedding, polymerization, ultrathin sectioning, and staining, transmission electron microscopy is performed. The entire process requires strict control of temperature (4℃) and light protection.

[0074] Results: Under the same environmental conditions, T2 generation was taken respectively. gmabhd6 mutant strainsGmABHD6 Seed samples from the overexpression lines and control DN50 plants at the MM and LM stages. Results observed using transmission electron microscopy are shown below. Figure 5 As shown. Under the microscope, the black, round or nearly round irregular solid structures are protein bodies (SSPs), and the small, densely packed, transparent, round and oval vacuoles near the protein bodies within the cell wall are oil bodies (OBs). Observation at 2500× field of view and within a 5 μm range shows that during the MM stage, the oil bodies of DN50 seeds begin to develop, and the protein bodies are fully developed. In mutant plant seeds, oil bodies occupy most of the field of view, and the protein bodies are smaller and sparser; in overexpression plant seeds, there are fewer oil bodies, but the protein bodies are larger and denser; during the LM stage, the oil bodies of all lines mature, and the number of protein bodies begins to increase. Under the microscope, the mutants show more oil bodies than DN50 seeds at the same stage, and the protein bodies are sparsely arranged and significantly fewer than those in DN50 seeds at the same stage; in overexpression line seeds, the number of oil bodies is significantly reduced, and the protein bodies almost fill the entire field of view. Therefore, combined with the transmission electron microscopy observations in the later stages of seed development, the results indicate that compared with the control DN50 plant, the mutant lines have significantly increased oil bodies and significantly reduced protein bodies, while the overexpression lines have significantly reduced oil bodies and significantly increased protein bodies. This result also verifies GmABHD6 It negatively regulates the oil content of soybean seeds.

[0075] Example 4. Identification of agronomic traits in transgenic soybeans This study conducted soybean plant phenotypic analysis experiments at the transgenic base of Northeast Agricultural University from 2023 to 2024. Selection GmABHD6 Overexpression lines, gmabhd6 Mutant lines and wild-type controls (WT) were used as experimental materials, and a randomized block design was employed. GmABHD6 Both transgenic and control lines were configured with three replicates, each containing 10 plants. After the plants reached full maturity, agronomic traits such as plant height, grain length, and 100-grain weight were measured. Phenotypic differences between different genotypes were compared to analyze... GmABHD6 The influence of genes on soybean growth and development.

[0076] Results: Samples were taken from transgenic plants grown at the Northeast Agricultural University's transgenic base in 2024. gmabhd6 mutant ( gmabhd6 ko1 , gmabhd6 ko2 and gmabhd6 ko3 ), overexpression ( GmABHD6 OE1 , GmABHD6 OE2 and GmABHD6 OE3Mature plants (DN50) and control plants were used to investigate agronomic traits such as plant height, grain length, grain width, number of grains per plant, and weight per 100 grains. Plant height statistics are as follows: Figure 6 As shown in A, compared to the control plant WT, gmabhd6 The height of all three lines of the mutant plant was significantly lower than that of the control plant (WT). GmABHD6 The plant height of all three overexpression lines was significantly higher than that of the control plant (WT); the statistical characteristics of seed length and width are as follows: Figure 6 As shown in C, E, and F in section 6: the grain length and width of the three mutant lines were significantly smaller than those of the control plants, while the grain length and width of the three overexpression lines were significantly larger than those of the control plants; the statistical analysis of the 100-seed weight trait is shown in section B of section 6: the 100-seed weight of the two mutant lines was significantly reduced, while the 100-seed weight of one line did not change significantly; the 100-seed weight of the three overexpression lines was significantly higher than that of the control plants; the statistical analysis of the number of seeds per plant is shown in section B of section 6. Figure 6 As shown in D, the number of individual grains in all three mutant lines was significantly reduced, while the number of individual grains in all three overexpression lines was significantly increased. These results collectively indicate that... GmABHD6 Gene expression levels are closely related to important agronomic traits and yield formation in soybean. In mutant materials with gene loss of function, plant height is significantly reduced, and seed size is shown to be reduced in both length and width. Furthermore, the number of pods and seeds per plant in the mutants shows a decreasing trend, and the 100-seed weight is also significantly reduced. The combined effect of these traits ultimately leads to a decrease in soybean yield. However... GmABHD6 In the overexpression transgenic lines, plant height increased, and both grain length and width were also increased. Furthermore, the number of pods and grains per plant were significantly increased in the overexpression lines, and the 100-seed weight was also significantly improved. The synergistic effect of these traits ultimately promoted increased soybean yield. These findings provide a basis for further analysis... GmABHD6 This provides important clues to the molecular mechanisms regulating soybean growth, development, and yield formation.

Claims

1. Application of the GmABHD6 gene in controlling soybean oil content: Knocking out the GmABHD6 gene increases the oil content of soybean seeds, characterized by... The amino acid sequence encoded by the GmABHD6 gene is shown in SEQ ID NO.

2.

2. The application of the GmABHD6 gene in controlling soybean protein content or increasing soybean plant height, grain length and width, number of pods per plant, number of grains per plant, and 100-seed weight. Overexpression of the GmABHD6 gene increases soybean protein content and also increases soybean plant height, grain length and width, number of pods per plant, number of grains per plant, and 100-seed weight. The amino acid sequence encoded by the GmABHD6 gene is shown in SEQ ID NO.

2.

3. The application of the GmABHD6 gene in controlling soybean protein content or increasing soybean plant height, grain length and width, number of pods per plant, number of grains per plant, and 100-seed weight. Overexpression of the GmABHD6 gene increases soybean protein content and also increases soybean plant height, grain length and width, number of pods per plant, number of grains per plant, and 100-seed weight. The GmABHD6 gene is shown in SEQ ID NO.

1.

4. The application of recombinant vectors containing the GmABHD6 gene in increasing soybean protein content or improving soybean plant height, grain length and width, number of pods per plant, number of grains per plant, and 100-seed weight, characterized in that... The GmABHD6 gene is shown in SEQ ID NO.

1.

5. The application of recombinant microbial cells containing the GmABHD6 gene in increasing soybean protein content or improving soybean plant height, grain length and width, number of pods per plant, number of grains per plant, and 100-seed weight, characterized in that... The GmABHD6 gene is shown in SEQ ID NO.

1.

6. The application of soybean plants overexpressing the GmABHD6 gene in increasing soybean protein content or improving soybean plant height, grain length and width, number of pods per plant, number of grains per plant, and 100-seed weight, characterized in that, The GmABHD6 gene is shown in SEQ ID NO.

1.

7. The application of soybean plants containing the mutant GmABHD6 gene in increasing the oil content of soybean seeds, characterized in that, The mutated GmABHD6 gene is a knockout gene, as shown in SEQ ID NO.1, which is the GmABHD6 gene.

8. The application according to claim 7, characterized in that, The mutated GmABHD6 gene is shown in any one of SEQ ID NO.7-9.

9. A breeding method for increasing soybean oil content, characterized in that, The steps are as follows: 1) Amplify the sgRNA of the GmABHD6 gene and insert the sgRNA into the CRISPR vector; the sgRNA of the GmABHD6 gene is shown in any one or more of SEQ ID NO. 3, 4, and 6; 2) The vector obtained in step 1) is introduced into Agrobacterium, and the Agrobacterium is used to transfer it into soybeans to obtain transgenic plants; 3) Identify the transgenic soybeans obtained in step 2) to obtain positive transgenic plants with the GmABHD6 gene knocked out.

10. A breeding method for increasing the protein content of soybeans, characterized in that, The steps are as follows: (1) Amplify the GmABHD6 gene and insert the gene sequence into a plant overexpression vector; the GmABHD6 gene is shown in SEQ ID NO.1; (2) The vector obtained in step (1) is introduced into Agrobacterium, and the Agrobacterium is used to transfer it into soybeans to obtain transgenic plants; (3) Identification step (2) The transgenic soybeans obtained in step (2) yielded positive transgenic plants.

Images