Zbp1 gene, molecular marker and application for influencing goat lambing traits

Abstract

The present application relates to the modern livestock breeding technical field, especially to a ZBP1 gene, molecular marker and application influencing goat lambing traits. A molecular marker related to goat lambing traits exists at the 473bp of the ZBP1 gene nucleotide sequence, and the polymorphism is C / G. When the genotype of the polymorphism site contained in the molecular marker is CG, the corresponding relative advantage of the lambing traits of the goat to be detected; when the genotype of the polymorphism site contained in the molecular marker is CC or GG, the corresponding relative disadvantage of the lambing traits of the goat to be detected. The molecular marker provided by the present application can be applied to the identification or prediction of the goat lambing state, and can also be applied to the field of molecular breeding. Based on the analysis of the goat genotype, the genetic potential of the goat is judged, and the breeding is left. The present application has great significance for the modern livestock breeding of goats.

Description

Technical Field

[0001] This invention relates to the field of modern animal husbandry technology, and in particular to a ZBP1 gene, molecular marker, and application that affects lambing traits in goats. Background Technology

[0002] The rapid development of molecular breeding technology has brought new directions to the field of livestock breeding. Against this backdrop, the search for molecular markers related to livestock reproductive traits has become a prominent research hotspot in livestock breeding. Taking goats as an example, most goat breeds worldwide exhibit uneven litter sizes, with only a few possessing the desirable trait of multiple births (Li Kunyu et al., 2023). This has, to some extent, limited the development of the goat farming industry. It is well known that the fertility level of ewes, especially the litter size trait, has a direct and significant impact on the production efficiency of goat farming enterprises (Gan Shanhua, 2019). Therefore, taking various measures to improve the fertility of ewes is one of the key initiatives to improve the production efficiency of goat farming. Research on goat reproductive traits is of great significance for improving the production efficiency and economic benefits of the goat industry. In recent years, DNA molecular marker technology has developed rapidly and has been widely applied to goat genetic improvement as the goat genome has become more complete (Feng Na et al., 2024).

[0003] The lambing number trait is inherently a low-heritability trait (Wang Baichuan et al., 2014). Traditional breeding methods for this trait are often limited by factors such as relatively long generation intervals and relatively low selection intensity, resulting in slow progress in goat reproductive trait selection. Molecular marker technology is simple to operate and stable in expression (Chen Xiaomin et al., 2023). Therefore, researchers are now turning their attention to the field of molecular biology, attempting to discover genes or molecular markers associated with the prolificacy trait in goats, in order to provide a strong reference for improving the overall reproductive performance of goat populations. Against the backdrop of the continuous integration of modern molecular biology and livestock breeding technology, the development of molecular biology has made a significant contribution to the advancement of livestock selection and genetics.

[0004] Z-DNA binding protein (ZBP1) is a cytoplasmic sensor involved in regulating biological processes such as apoptosis and programmed cell death. ZBP1 can bind to receptor-interacting kinases (RIPKs), inhibiting apoptosis and programmed cell death through kinase-independent function. In the absence of RIPK1, ZBP1 binds to RIPK3, triggering the RIPK3-driven Caspase-8-mediated apoptosis pathway in granulosa cells. Furthermore, the ZBP1 gene also plays a role in assisting the cellular localization of β-actin mRNA. Currently, there are few studies using the ZBP1 gene as a candidate gene for screening molecular markers related to lambing performance in goats. Therefore, this invention is proposed. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a ZBP1 gene, molecular marker, and application that influences lambing traits in goats.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides the application of the ZBP1 gene in detecting lambing traits in goats, the ZBP1 gene comprising the nucleotide sequence shown in SEQ ID NO. 01.

[0008] Preferably, the lambing trait includes at least one of the following: number of lambs born in a first litter, number of lambs born in a second litter, number of lambs born in a third litter, number of lambs born multiparously, and average number of lambs born; particularly including the number of lambs born in a first litter and the average number of lambs born, which are significantly different in expression due to the influence of the genotype of the polymorphic site C473G on the nucleotide sequence shown in SEQ ID NO.01.

[0009] Secondly, the present invention provides a molecular marker associated with lambing traits in goats, the molecular marker being located at position g.57864317C>G of the nucleotide sequence shown in SEQ ID NO.01, with a polymorphism of C / G.

[0010] Preferably, the genotype of the polymorphic site contained in the molecular marker is CG, which corresponds to the relative advantage of the lambing trait in the goat to be tested.

[0011] Preferably, the genotype of the polymorphic site contained in the molecular marker is CC or GG, corresponding to a relative disadvantage in lambing traits of the goat being tested.

[0012] Preferably, the primer sequences for amplifying the molecular marker are shown in SEQ ID NO.02 and SEQ ID NO.03.

[0013] Thirdly, the present invention provides specific primer pairs for the molecular markers described above.

[0014] Preferably, the primer sequences of the specific primer pair are shown in SEQ ID NO.02 and SEQ ID NO.03.

[0015] Fourthly, the present invention provides a reagent or kit for detecting lambing traits in goats, which contains the specific primer pairs described above.

[0016] Fifthly, the present invention provides the use of the aforementioned molecular markers or the specific primer pairs or the reagents or kits in at least one of the following:

[0017] (1) Application in identifying lambing traits in goats;

[0018] (2) Application in predicting lambing traits in goats;

[0019] (3) Application in goat resource identification, improvement or molecular marker-assisted breeding.

[0020] Sixthly, the present invention provides a molecular breeding method for high-quality goats, comprising:

[0021] (1) Extract total DNA from the goats to be tested;

[0022] (2) Using DNA as a template, detect the genotype of the molecular markers mentioned above;

[0023] (3) Analyze the genotype to determine the genetic potential of goats for breeding and propagation.

[0024] Preferably, step (3) includes: performing allele detection on the amplification product and determining the genotype based on the genotyping results: the genotype of the polymorphic site contained in the molecular marker is CG, which corresponds to the relative advantage of the lambing trait of the goat to be tested; and / or, the genotype of the polymorphic site contained in the molecular marker is CC or GG, which corresponds to the relative disadvantage of the lambing trait of the goat to be tested.

[0025] Beneficial effects:

[0026] This invention provides the ZBP1 gene, molecular marker, and applications that influence lambing traits in goats. A molecular marker associated with lambing traits in goats exists at position 473 bp of the ZBP1 gene nucleotide sequence, exhibiting a polymorphism of C / G. When the genotype of the polymorphic site on the molecular marker is CG, it corresponds to a relative advantage in lambing traits in the goats being tested; when the genotype of the polymorphic site is CC or GG, it corresponds to a relative disadvantage in lambing traits in the goats being tested. The molecular marker provided by this invention can be applied to the identification or prediction of lambing status in goats, and can also be applied in the field of molecular breeding. Based on the analysis of goat genotypes, it can determine the genetic potential of goats for breeding and propagation. This invention has significant implications for modern goat husbandry. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0028] Figure 1 The results of gel recovery and purification of partial nucleotides of the goat ZBP1 gene (SEQ ID NO:1) in Example 1 are shown.

[0029] Figure 2 This is a SnapGene software reading result of the g.57864317C>G site in the goat ZBP1 gene in Example 1; Figure 2In the diagram, A represents the CC genotype; B represents the CG genotype; and C represents the GG genotype. Detailed Implementation

[0030] This invention has discovered a molecular marker in the goat ZBP1 gene that is associated with goat lambing traits, providing a new molecular marker for goat lambing trait detection or marker-assisted breeding.

[0031] Specifically, the technical solution of the present invention is as follows:

[0032] This invention provides the application of single nucleotide polymorphism (SNP) at a goat SNP site or a substance for detecting SNP at a goat SNP site in the detection or auxiliary detection of the goat litter size trait, wherein the SNP site is a molecular marker of the g.57864317C>G site in the goat ZBP1 gene.

[0033] The molecular marker of the g.57864317C>G site is that there is a C>G base mutation at position 473bp in the sequence shown in SEQ ID NO.1.

[0034] The single nucleotide polymorphisms at the above-mentioned SNP sites in this invention are related to the traits of first-parity lambing number and average lambing number in goats.

[0035] This invention does not limit the breed of goat, but may include breeds such as Chubao Blackhead Goat, Macheng Black Goat, Boer Goat, Yichang White Goat, and Matou Goat.

[0036] The present invention also provides a method for detecting the litter size trait in goats, which detects the base type at position 473bp in the sequence shown in SEQ ID NO:1 of goats. The CG genotype has significantly higher litter size and average litter size than the CC genotype.

[0037] The present invention also provides substances for detecting single nucleotide polymorphisms at goat SNP sites, including PCR primers for amplifying genomic DNA fragments including the SNP sites or kits containing the primers.

[0038] The present invention also provides a molecular marker in the ZBP1 gene associated with the number of goats born, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein there is a C>G base mutation at position 473bp in SEQ ID NO.1.

[0039] The substances for detecting single nucleotide polymorphisms at SNP sites in goats or the molecular markers associated with goat lambing traits described above in this invention can be used in goat genetic breeding to improve the lambing traits of offspring goats.

[0040] This invention provides a genetic breeding method to increase the number of lambs born in goats. The method involves determining the single nucleotide polymorphism (SNP) at the aforementioned SNP site in the core goat population and making corresponding selections based on the SNP at the aforementioned SNP site: in the successive generation selection of breeding goats, individuals with the CG type at the 473bp position of the sequence shown in SEQ ID NO.1 are selected as breeding goats, while CC and GG type individuals are eliminated. This process increases the number of breeding ewes with the CG gene at this site in each generation, thereby increasing the number of lambs born in the first litter and the average number of lambs born.

[0041] Based on the above-mentioned scheme provided by this invention, this invention has discovered molecular markers in the goat ZBP1 gene associated with litter size, wherein the molecular markers contain SNP sites of g.57864317C>G; the haplotypes formed by the above SNP sites can serve as molecular markers for the lambing trait in goats. This invention has verified the effects of the above SNP molecular markers on the first-parity lambing number and average litter size in goats, and can be applied to the genetic improvement of breeding goats to increase the lambing number, thereby improving the lambing performance of offspring and increasing the market competitiveness of breeding enterprises. This invention provides a new molecular marker for marker-assisted breeding of the lambing trait in goats, enabling early selection of the lambing trait in goats and shortening the breeding process; the detection method is rapid, accurate, and unaffected by environmental factors in the breeding environment.

[0042] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0043] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0044] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "specific implementation," or "some specific implementations," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0045] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0046] The sequences involved in the following embodiments include:

[0047] SEQ ID NO.01:

[0048] AGTATTTGGAACTTCCGACCCCTTACAAGGCACAAAGGGATTGAGTGGAATATTATTTTGCAGAAGGTTCTAGAAATCAGTCCACCCCAGTTATTTACCAGCAAAATCCAATCAACATGATCTGTCAGAAGGGACCAAACAGCCACATTTCCATCCAGAACTGTGAAGATATCCAGATTGGACACGGGAATCTCCTAGTGAGACAAATGGGATCTGGGGAAGACGGTGAGTCCTCTGAGATGCCTAGGAGAGGGGTCCTGTCCATCTGGGTGGGGTGAGGAGCCGGGGGTGCACGTCTCCAGGGAGAAAGGGCAGCTATCAGATTTCCAAGGTCCTTTCTGGCTTTCCCCAAAATCAGGCTGTCTCTCCTTGTGCCTGGATCAAACCCTTCCTGCACTCCCTTTGCTCTGCCATCTTTCGCCACATCTTCCACAAGAAACAACTTCCTTCACTCTCTCTTACTAAGATGTCACGAGGTATCGTTGTAACATGTGTTTGTTCCAAGACACTGCTTCTTCCCTGGTGTTAACATTTCATAAACTGGGATCCCTCTTACTGGGTGCATCCTAGCTTTGATGGAATAACAGTAAGCAAGTGAGTACCTACTCCGTGCCAGGCACTGTGGGGAGAGGGGACAGGGCCACCCCTCAGTCCAGCTACGGGACATGAGTGAAAGCATTGACCCCAAACTTGGGATACCCCCTTGACCTCGAGAGAGAGCCCTTCCCCGCTCTGGGCCACAGTTTCCCTAACTGTGAAATGAGGAACTTTGTTCTAGAATCTAAATCAACCTTTCCCCACCTTCAGTCCTCTGAGCTCCACCTTCCATAATTTTGGCTGAGTCCCTGGCTAACTGTTTACTCAGTGTTGCTAAATGGTTTACCTTTTATTCTACTCAAATTCACTTTAAAGTAAACTTTTACAGCATTACCTTGAA。

[0049] Sequence listing SEQ ID NO:1 is a partial sequence of the ZBP1 gene of Chubao black-headed sheep, which is the DNA sequence used as the molecular marker of this invention. At position 473 bp of this sequence, there is an allele mutation, specifically a mutation from base "C" to base "G".

[0050] Example 1

[0051] Obtaining SNP fragments of the goat ZBP1 gene and establishing a method for detecting polymorphic sites.

[0052] 1. Extraction of goat genomic DNA

[0053] The Chubao Blackhead Goat, a breed of meat goat improved from Macheng Black Goat, was selected as the experimental animal. Samples were obtained from the breeding farm of the Animal Husbandry and Veterinary Research Institute of the Hubei Academy of Agricultural Sciences. Whole-genome DNA was extracted from the goats using a blood genomic DNA extraction kit (manufactured by Beijing Tiangen Biotech Co., Ltd.), following the kit's instructions. The obtained genomic DNA was tested for concentration and quality, labeled, and stored at -80℃ for later use.

[0054] 2. Obtaining SNP genetic marker fragments:

[0055] (1) PCR amplification:

[0056] Primers were designed based on the goat ZBP1 genome sequence. The primer sequence information is as follows:

[0057] Upstream primer (SEQ ID NO.02): GGGACCAAACAGCCACATT (5'→3');

[0058] Downstream primer (SEQ ID NO.03): GCCAGGGACTCAGCCAAAA (5'→3').

[0059] The above primers were used to amplify the genomic DNA of Chubao black-headed sheep by PCR. The reaction system is shown in Table 1.

[0060] Table 1 PCR reaction system

[0061]

[0062] The PCR reaction program was set as follows: 98℃ pre-denaturation for 45s; 98℃ denaturation for 10s; annealing temperature set at 66℃ for 30s; extension at 72℃ for 25s; cycle number fixed at 34×; final extension at 72℃ for 5 min; 12℃ for 1 min.

[0063] Store PCR amplification products at 4°C.

[0064] (2) Purification of PCR products:

[0065] The PCR products were purified using a gel extraction kit (Shanghai Sangon Biotech Co., Ltd.). For specific steps, please refer to the instruction manual.

[0066] 3. SNaPshot method for detecting molecular markers:

[0067] Design SNaPshot extension primers for the g.57864317C>G site based on the goat ZBP1 gene genome sequence:

[0068] Add 5 U SAP and 2 U Exo I to 15 μL of purified PCR product, vortex to mix, incubate at 37℃ for 1 h, then incubate at 75℃ for 15 min to inactivate SAP and ExoI enzymes; use the SNaPshot Multiplex Kit (Applied Biosystems) to aspirate 3 μL of the treated 15 μL PCR product for SNaPshot detection. The PCR reaction system is 10 μL, containing 5 μL Reaction Mix reagent, 3 μL of PCR product treated with SAP and ExoI enzymes, 0.5 μL each of extension primers, and 1 μL of deionized water. The PCR amplification program is 96℃ denaturation for 10 s, 50℃ annealing for 5 s, 60℃ extension for 30 s, 25 cycles, and storage at 4℃; dilute the SNaPshot product 20-fold in the following dilution system: 9.25 μL Hi-Di Formamide, GS-120 LIZ. 0.25 μL of SNaPshot product and 0.5 μL of sNaPshot product were added to the reaction mixture, which was denatured at 95 °C for 5 min followed by an ice bath for 4 min. A mixture containing 350 μL of Hi-Di formamide and 50 μL of Matrix standard was prepared, denatured at 95 °C for 5 min, and rapidly cooled for 5 min. The mixture was then divided into two equal tubes, aliquoted onto an instrument plate, and the 3730XL DNA Analyzer was spectrally calibrated. The prepared samples were then subjected to capillary electrophoresis using the 3730XL DNA Analyzer, and the signals were collected. Finally, the experimental results were analyzed using SnapGene software. The results are as follows: Figure 2 As shown.

[0069] Example 2

[0070] The polymorphism distribution of the molecular markers prepared in this invention was detected in a goat population.

[0071] In this embodiment, the polymorphism of the g.57864317C>G site in the goat ZBP1 gene was detected in a black-headed sheep population. The detection results are shown in Table 2.

[0072] Table 2. Genotype and gene frequencies of the goat ZBP1 gene at the g.57864317C>G locus.

[0073]

[0074] Table 2 shows that the ZBP1 gene g.57864317C>G locus in the Chubao black-headed sheep population exhibits three genotypes: CC, CG, and GG. The heterozygous CG genotype is the dominant genotype, with a base frequency of 0.87 for allele C. Chi-square test indicates that the genotype distribution at this locus does not conform to Hardy-Weinberg equilibrium.

[0075] Example 3

[0076] The present invention relates to the correlation analysis and application of molecular markers with lambing traits in goats.

[0077] To determine whether the SNP of the ZBP1 gene in goats is related to lambing, 500 Chubao black-headed goats were selected as experimental material. Sample collection and relevant lambing information were obtained from the breeding farm of the Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences. Direct sequencing was used to detect the genotypes of different individuals, and the correlation between individuals with different genotypes and their lambing traits was analyzed. The GLM program in SAS statistical analysis software was used to perform association analysis between molecular markers and traits of different genotypes. The model used was:

[0078] Model 1: Y = Population mean + Genotype + Sheep farm environmental effect + Residual;

[0079] Model 2: Y = Population mean + Additive effect + Dominant effect + Sheep farm environmental effect + Residual.

[0080] Where Y represents the phenotypic value. Additive effect = (homozygote 1 - homozygote 2) / 2, with 1, 0, and -1 representing homozygote 1, heterozygote 1, and homozygote 2, respectively; dominant effect = heterozygote - (homozygote 1 + homozygote 2) / 2, with 1, -1, and 1 representing homozygote 1, heterozygote 1, and homozygote 2, respectively. The statistical analysis results are shown in Table 3.

[0081] Table 3 Association analysis of ZBP1 gene SNP sites with lambing traits

[0082]

[0083] Association analysis between the ZBP1 gene SNP locus and lambing traits in Chubao black-headed goats was performed using SAS 9.4 data analysis software. The results are shown in Table 3. The ZBP1 gene g.57864317C>G locus has three genotypes: CC, CG, and GG. Among them, the CG genotype has significantly higher first-litter lambing number and average lambing number than the CC genotype (P<0.05). Therefore, screening for individuals with the CG genotype at the ZBP1 gene g.57864317C>G locus in goats is intended to obtain breeding ewes with higher lambing numbers.

[0084] Finally, it should be noted that the above embodiments are merely preferred embodiments of the present invention, used to illustrate the technical solutions of the present invention, and not to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention. Therefore, any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of reagents for detecting molecular markers associated with lambing traits in goats in the identification or prediction of lambing traits in goats, characterized in that, The lambing traits of the goats are the number of lambs in a first litter and the average number of lambs in a litter; the molecular marker is located at 473 bp of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is C / G; among them, the number of lambs in a first litter and the average number of lambs in a litter are higher for the CG genotype than for the CC genotype; the goats are Chubao Blackhead Goats.

2. The application according to claim 1, characterized in that, The reagent includes primers, the sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. A molecular breeding method for improving lambing traits in goats, characterized in that, The goat lambing traits are the number of lambs in a first litter and the average number of lambs in a litter; the method includes: (1) Extract total DNA from the goats to be tested; (2) Using DNA as a template, the genotype of the molecular marker was detected; the molecular marker is located at the 473 bp of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is C / G; (3) Analyze the genotype to determine the lambing traits of goats, and retain and breed them; Step (3) includes: determining based on the genotyping results: the genotype of the polymorphic site of the molecular marker is CG, corresponding to the relative advantage of the lambing trait of the goat to be tested; the genotype of the polymorphic site of the molecular marker is CC, corresponding to the relative disadvantage of the lambing trait of the goat to be tested; the number of first-parity lambs and the average number of lambs born with the CG genotype are higher than those with the CC genotype; the goat is the Chubao Blackhead Goat.

Images