Combination of molecular markers associated with kiwifruit canker resistance loci and use thereof

CN121109647BActive Publication Date: 2026-09-22WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511534362.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-26
Publication Date
2026-09-22
Estimated Expiration
2045-10-26

AI Technical Summary

Technical Problem

由于抗性的复杂性和其表型鉴定易受环境条件影响,因此,猕猴桃溃疡病抗性基因挖掘和分子机理研究有待深入

Benefits of technology

[0032](1)本发明获得了猕猴桃溃疡病位点Psa11-342,且可被重复检测,可解释4.5%的表型变异率;获得了猕猴桃溃疡病位点Psa12-143,且可被重复检测,可解释4.1%的表型变异率。

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The application belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker combination related to a kiwi fruit canker disease resistance site and application. The application finds, through whole genome association analysis, a canker disease resistance site Psa11-342 located on the 11th chromosome of kiwi fruit and a canker disease resistance site Psa12-143 located on the 12th chromosome of kiwi fruit, which are located at the 2160301th base of the 11th chromosome of the kiwi fruit Red5 reference genome, can explain 4.5% of the phenotypic variation rate, and are located at the 14259955th base of the 12th chromosome of the kiwi fruit Red5 reference genome, can explain 4.1% of the phenotypic variation rate. The KASP marker combination designed by using the SNP is used for detecting 155 kiwi fruit samples, and it is found that the KASP marker combination is simple to operate and clear in typing, and has a good selection effect on the kiwi fruit canker disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically involving the combination and application of molecular markers related to resistance sites of kiwifruit canker disease. Background Technology

[0002] Bacterial canker of kiwifruit is a disease caused by *Pseudomonas syringae*, a pathogenic species of *Actinidia chinensis*. First reported in 1984 on *Actinidia arguta* var. *sinensis* in Shizuoka, Japan, it has become the biggest constraint on kiwifruit production worldwide, seriously jeopardizing the healthy development of the industry. Currently, the control of kiwifruit canker in production mainly relies on preventative measures, such as rain-sheltered cultivation and the use of chemical agents like copper-based agents and antibiotics such as kasugamycin. However, the use of these measures increases production costs and is not conducive to the green development of the kiwifruit industry. Therefore, screening and identifying resistant kiwifruit materials is crucial for controlling canker and promoting the healthy and sustainable development of my country's kiwifruit industry.

[0003] Studies have shown that plant hormones can respond to plant pathogen infection. The salicylic acid pathway is essential for plant resistance to vivotrophic pathogens, while the jasmonic acid signaling pathway is essential for plant resistance to necrotrophic pathogens. Abscisic acid indirectly affects plant resistance through its interaction with jasmonic acid. Kiwifruit canker resistance is a quantitative trait controlled by multiple genes. Due to the complexity of resistance and its phenotypic identification being easily influenced by environmental conditions, further research is needed on the discovery of kiwifruit canker resistance genes and their molecular mechanisms. Based on kiwifruit genome and transcriptome data, researchers have preliminarily predicted kiwifruit resistance genes, but the functions and mechanisms of these genes require further investigation.

[0004] This invention utilizes association analysis of 220 natural kiwifruit populations with kiwifruit canker to identify loci associated with kiwifruit canker and to develop practical, high-throughput, low-cost molecular markers for the identification and screening of kiwifruit canker resistance. Summary of the Invention

[0005] The purpose of this invention is to provide a reagent combination for detecting bases at positions 2160301 on chromosome 11 and 14259955 on chromosome 12 of kiwifruit in the selection and breeding of kiwifruit resistance to bacterial canker.

[0006] Another objective of this invention is to provide the application of primer combinations for detecting bases at positions 2160301 on chromosome 11 and 14259955 on chromosome 12 of kiwifruit in the screening and breeding of kiwifruit resistance to bacterial canker.

[0007] The final objective of this invention is to provide a method for screening and breeding kiwifruit to resist bacterial canker.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] Acquisition of molecular markers associated with resistance sites to kiwifruit canker:

[0010] The applicant collected single leaves from natural kiwifruit populations and extracted total DNA. Genomic DNA was randomly fragmented using a sonic disruptor, and the DNA fragments underwent end repair, followed by the addition of sequencing adapters and purification. The final library was obtained through PCR amplification. Preliminary quantification was performed using Qubit 2.0, and Q-PCR was used to accurately quantify the effective concentration of the library. PE sequencing was performed using the Illumina high-throughput sequencing platform. Raw reads obtained from sequencing were filtered, low-quality reads were removed, and alignment analysis was performed. By aligning to the reference genome, GATK was used to detect variants in the samples. Hard-filtering criteria were used to filter identified SNPs and Indels, obtaining the final variant file for subsequent association analysis. A strain of the kiwifruit canker pathogen, *Pseudomonas syringaepv. actinidiae*, was cultured. Isolated branches were inoculated with the pathogen, and the resistance level of the samples was classified according to the length of the lesions. Trait association analysis was performed using a mixed linear model, with population genetic structure as a fixed effect and individual kinship as a random effect, adjusting for the influence of population structure and individual kinship. GWAS analysis was performed using GEMMA, calculating the relatedness matrix between samples based on genotype data, and association analysis was conducted using linear mixed models. The Psa11-342 locus for kiwifruit canker resistance was identified. This SNP locus, located at base 2160301 on chromosome 11 of kiwifruit, was repeatedly detectable and explained 4.5% of the phenotypic variation. The Psa12-143 locus for kiwifruit canker resistance was also identified. This SNP locus, located at base 14259955 on chromosome 12 of kiwifruit, was repeatedly detectable and explained 4.1% of the phenotypic variation.

[0011] The KASP marker primer sequence designed for two sites is as follows:

[0012] KASP-Psa11-342:

[0013] Primer_Allele

[0014] KASP-Psa12-143:

[0015] Primer_Allele

[0016] Using the aforementioned molecular markers to detect the resistance to kiwifruit canker can enable early screening of kiwifruit canker resistance and assist in kiwifruit breeding.

[0017] The scope of protection of this invention includes:

[0018] Application of reagent combination for detecting base position 2160301 on chromosome 11 and base position 14259955 on chromosome 12 of kiwifruit in kiwifruit canker resistance screening breeding.

[0019] Application of reagent combination for detecting base 2160301 on chromosome 11 and base 14259955 on chromosome 12 of kiwifruit in the preparation of kiwifruit canker resistance screening kit.

[0020] The method for determining the above-mentioned application is as follows: if the genotype at position 2160301 of chromosome 11 of the kiwifruit is GG and the genotype at position 14259955 of chromosome 12 is AA, then the kiwifruit is determined to be a canker-resistant kiwifruit.

[0021] The method for determining the above-mentioned application is as follows: if the genotype at position 2160301 of chromosome 11 of the kiwifruit is GA and the genotype at position 14259955 of chromosome 12 is AG, then the kiwifruit is determined to be a kiwifruit susceptible to ulcer disease.

[0022] In the above applications, the preferred reagent is a primer.

[0023] The primers described above are preferably KASP detection primer combinations, and more preferably the primers provided by this invention:

[0024] KASP-Psa11-342:

[0025] Primer_Allele

[0026] And KASP-Psa12-143:

[0027] Primer_Allele

[0028] A method for screening and breeding kiwifruit for resistance to bacterial canker includes simultaneously detecting base position 2160301 on chromosome 11 and base position 14259955 on chromosome 12 of kiwifruit. The conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0029] A kiwifruit canker resistance screening kit, the kit comprising reagents for detecting base position 2160301 on chromosome 11 and base position 14259955 on chromosome 12 of kiwifruit.

[0030] The kiwifruit genome referenced in this invention is the kiwifruit red5 genome (http: / / kiwifruitgenome.org / organism / 3).

[0031] Compared with the prior art, the present invention has the following advantages:

[0032] (1) The present invention obtained the kiwifruit canker disease site Psa11-342, which can be repeatedly detected and can explain 4.5% of the phenotypic variation rate; and obtained the kiwifruit canker disease site Psa12-143, which can be repeatedly detected and can explain 4.1% of the phenotypic variation rate.

[0033] (2) The present invention uses the Psa11-342 site and Psa12-143 site to develop KASP markers for combined use. The detection method is simple and low cost, which can improve the selection efficiency and accuracy of kiwifruit canker resistance screening. Detailed Implementation

[0034] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. The kiwifruit genome referenced in this invention is the kiwifruit red5 genome (http: / / kiwifruitgenome.org / organism / 3, Actinidia chinensis Red5 Genome).

[0035] Example 1:

[0036] Acquisition of molecular markers associated with resistance sites to kiwifruit canker:

[0037] ① Leaf samples from 220 natural kiwifruit populations were collected. Total DNA was extracted using the CTAB method. Agarose gel electrophoresis showed that the main band of genomic DNA was intact and clear, with no degradation or RNA contamination.

[0038] ② Genomic DNA was randomly fragmented using an acoustic disruptor. End repair was performed on the DNA fragments, sequencing adapters were added, and the fragments were purified. The final library was obtained through PCR amplification. Preliminary quantification was performed using Qubit 2.0, and Q-PCR was used to accurately quantify the effective concentration of the library to ensure library quality. PE sequencing was performed using the Illumina high-throughput sequencing platform.

[0039] ③ The raw reads obtained from sequencing were filtered to remove adapter sequences and polyG and polyX sequences at the tail, as well as low-quality reads, resulting in clean reads. BWA alignment analysis was performed on each sample. The filtered clean reads were then aligned to the reference genome. The alignment results were converted from SAM files to sorted BAM files using SAMtools. The alignment rate and coverage were calculated using a Python script. Based on the alignment results file, GATK was used to detect variants in the samples. Hard-filtering criteria were used to filter the identified SNPs and Indels. Finally, vcftools was used to obtain the final variant file for subsequent association analysis.

[0040] ④ The pathogenic strain M228 of *Pseudomonas syringae*, the pathogen of kiwifruit canker, was inoculated onto LB solid medium for activation and culture. After culturing at 25 °C for 36 h, a single colony was picked and transferred to 5 mL of liquid LB medium. The medium was then incubated overnight at 28 °C and 180 rpm on a shaker. After centrifugation at 12000 rpm for 5 min, the precipitate was collected, and the suspension was diluted with sterile water to an OD600 of 1, resulting in a concentration of 10⁹ CFU·mL⁻¹, ready for experimental use.

[0041] ⑤ Select healthy one-year-old branches with a diameter of approximately 0.8 cm and uniform growth. Cut them into 12-14 cm twigs and seal both ends with paraffin wax to prevent moisture loss. Disinfect the branches with 75% alcohol. Make a 3 mm wide, deep cut in the middle of the branch using a punch, reaching the xylem. Add 10 µL of bacterial solution to the cut. Inoculate 6 branches of each material, using sterile water as a control. After the bacterial solution has completely dried, place the branches in a tray with the wound facing upwards, lined with damp filter paper. Cover and seal with plastic wrap to maintain moisture, leaving excess moisture in the tray. Maintain an internal humidity of 80% and incubate at 16 °C under 16 h light / 8 h darkness conditions. After 42 days of incubation, remove the outer bark of the branches with a sterile knife and observe and measure the lesions formed after pathogen infection. Classify the resistance level of the kiwifruit material according to the length of the lesions: resistant: lesion length ≤ 9.0 mm; susceptible: lesion length > 9.0 mm.

[0042] ⑥ A mixed linear model was used for phenotypic association analysis, with population genetic structure as a fixed effect and individual kinship as a random effect, adjusting for the influence of population structure and individual kinship. GWAS analysis was performed using GEMMA, and the relatedness matrix between samples was calculated based on genotype data. Association analysis was conducted using linear mixed models, revealing the Psa11-342 locus associated with kiwifruit canker resistance. This locus is located at base 2160301 on kiwifruit chromosome 11, can be repeatedly tested, and explains 4.5% of the phenotypic variation. Similarly, the Psa12-143 locus associated with kiwifruit canker resistance was identified. This locus is located at base 14259955 on kiwifruit chromosome 12, can be repeatedly tested, and explains 4.1% of the phenotypic variation.

[0043] Table 1. Resistance sites for kiwifruit canker

[0044] .

[0045] Example 2:

[0046] Development of a KASP marker for a SNP site associated with resistance to kiwifruit canker:

[0047] Based on the nucleotide sequence before and after the Psa11-342 site, the KASP-Psa11-342 marker detection primer sequence was obtained according to primer design principles:

[0048] Primer_Allele X: GAAGGTGACCAAGTTCATGCT GGCGGGTGGAATACACGTTTTTATC, Primer_Allele Y: GAAGGTCGGAGTCAACGGATT GGCGGGTGGAATACACGTTTTATT and Primer_Common: GTCCACTTAGAGGATCCGAACTCT.

[0049] Based on the nucleotide sequences before and after the Psa12-143 site, the KASP-Psa12-143 marker detection primer sequence was obtained according to primer design principles:

[0050] Primer_Allele X: GAAGGTGACCAAGTTCATGCT GTGGCATCAAGTTGTTTGGCATT, Primer_Allele Y: GAAGGTCGGAGTCAACGGATT GTGGCATCAAGTTGTTTGGCATC and Primer_Common: CACTAACAAATCCCTTCCTAATCGA.

[0051] The underlined part is the fluorescent connector.

[0052] The method for detecting the genotypes of the Psa11-342 and Psa12-143 loci in the target kiwifruit using the above-mentioned KASP marker primer set is as follows:

[0053] (1) Extract genomic DNA from the kiwifruit to be tested.

[0054] (2) Preparation of reaction system. KASP labeling detection was performed on 96 samples using the Douglas Scientific ArrayTape system. The PCR system was assembled using NEXAR, with a reaction volume of 0.8 μL for each sample. The specific reaction system is shown in Table 2.

[0055] Table 2. KASP Reaction System

[0056] .

[0057] (3) PCR amplification. PCR amplification was performed using SOELLEX. The Touch-down PCR amplification conditions were as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, decreasing by 0.8℃ per cycle until reaching 56℃, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 30 cycles.

[0058] (4) Data reading and genotyping. After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned using ARAYA; then, data analysis and genotyping were performed using INTELLICS.

[0059] Using the primers described above, the genotype of kiwifruit samples was detected. The amplified sequence obtained using these primers in the Jin Yuan variety is as follows (Psa11-342 is G, Psa12-143 is A, homozygous):

[0060] Psa11-342 site: GTCCACTTAGAGGATCCGAACTCTATGGAGTAACCGTTATACTGAATTTTTACTGGTTTCATAGAGAGGGTG G ATAAAACGTGTATTCCACCCGCC.

[0061] Psa12-143 sites:

[0062] CACTAACAAATCCCTTCCTAATCGAATAATCATAACCGACTTTTCAAAATTAC A ATGCCAAACAACTTGATGCCAC.

[0063] Using the primers described above, the genotype of kiwifruit samples was detected. The amplified sequences obtained from the Huayou variety using these primers are as follows (Psa11-342 is GA, Psa12-143 is AG, heterozygous):

[0064] Psa11-342 site:

[0065] The SNP site is a sequence of G:

[0066] GTCCACTTAGAGGATCCGAACTCTATGGAGTAACCGTTATACTGAATTTTTACTGGTTTCATAGAGAGGGTG G ATAAAACGTGTATTCCACCCGCC.

[0067] The SNP site is sequence A:

[0068] GTCCACTTAGAGGATCCGAACTCTATGGAGTAACCGTTATACTGAATTTTTACTGGTTTCATAGAGAGGGTG A ATAAAACGTGTATTCCACCCGCC.

[0069] Psa12-143 sites:

[0070] The SNP site is sequence A:

[0071] CACTAACAAATCCCTTCCTAATCGAATAATCATAACCGACTTTTCAAAATTAC A ATGCCAAACAACTTGATGCCAC.

[0072] The SNP site is a sequence of G:

[0073] CACTAACAAATCCCTTCCTAATCGAATAATCATAACCGACTTTTCAAAATTAC G ATGCCAAACAACTTGATGCCAC.

[0074] Example 3:

[0075] The universality of molecular marker combinations associated with kiwifruit canker resistance sites in kiwifruit canker resistance selection:

[0076] The KASP primer set designed in Example 2 was used to detect the genotypes of the Psa11-342 and Psa12-143 loci in the kiwifruit to be tested. The kiwifruit to be tested consisted of 155 kiwifruit varieties (lines) or germplasm resources from both domestic and international sources (the applicant collected an additional 55, and the remaining 100 were randomly selected from the 220 in Example 1). Ulcer disease inoculation and identification were performed according to the method used in Example 1, and the lesions and resistance levels of the ulcer disease were statistically analyzed.

[0077] The results showed that among the 155 kiwifruit samples, 63 samples had a genotype of GG at Psa11-342 and a genotype of AA at Psa12-143, and 39 samples had a genotype of GA at Psa11-342 and a genotype of AG at Psa12-143.

[0078] The genotype at Psa11-342 is GG and the genotype at Psa12-143 is AA, indicating resistance. Phenotypic testing showed that 51 samples were resistant, with an identification rate of 51 / 63 = 81.0%.

[0079] The genotype at Psa11-342 is GA and the genotype at Psa12-143 is AG, indicating susceptibility. Phenotypic testing showed that 38 samples were susceptible, with an identification rate of 38 / 39 = 97.4%.

[0080] The above results demonstrate that the prepared KASP molecular marker has a good screening effect on resistance to kiwifruit canker.

Claims

1. The application of a reagent combination for detecting bases at positions 2160301 and 14259955 of chromosome 11 in kiwifruit for screening and breeding against kiwifruit canker disease. The determination method during the application process is as follows: if the genotype at position 2160301 of chromosome 11 is GG and the genotype at position 14259955 of chromosome 12 is AA, then the kiwifruit is determined to be resistant to kiwifruit canker disease; if the genotype at position 2160301 of chromosome 11 is GA and the genotype at position 14259955 of chromosome 12 is AG, then the kiwifruit is determined to be susceptible to kiwifruit canker disease. The reference genome of the kiwifruit is the kiwifruit red5 genome.

2. The application of a reagent combination for detecting base position 2160301 on chromosome 11 and base position 14259955 on chromosome 12 of kiwifruit in the preparation of a kiwifruit canker resistance screening kit. The kit is used to determine the kiwifruit's resistant kiwifruit genotype as follows: if the genotype at position 2160301 on chromosome 11 is GG and the genotype at position 14259955 on chromosome 12 is AA, then the kiwifruit is considered resistant to canker; if the genotype at position 2160301 on chromosome 11 is GA and the genotype at position 14259955 on chromosome 12 is AG, then the kiwifruit is considered susceptible to canker. The reference genome for this kiwifruit is the kiwifruit red5 genome.

3. The application according to claim 1 or 2, wherein the reagent combination is a primer combination.

4. The application according to claim 3, wherein the primer combination is: Primer_Allele and Primer_Allele 5. A method for screening and breeding kiwifruit for resistance to bacterial canker, comprising simultaneously detecting bases at positions 2160301 and 14259955 of kiwifruit chromosome 11, wherein the detection method is: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry. If the kiwifruit chromosome 11 is detected, the method will be selected. If the genotype at position 2160301 on chromosome 1 is GG and the genotype at position 14259955 on chromosome 12 is AA, then the kiwifruit is determined to be resistant to citrus canker. If the genotype at position 2160301 on chromosome 11 is GA and the genotype at position 14259955 on chromosome 12 is AG, then the kiwifruit is determined to be susceptible to citrus canker. The reference genome for the kiwifruit is the kiwifruit red5 genome.

Citation Information

Patent Citations

  • Cotton blight-resistant gene and application thereof

    CN109295074A

  • Method for determining disease resistance or sensitivity with respect to bacterial canker of kiwifruit caused by psa3 strain

    WO2021029344A1