A molecular marker related to the Psa8-246 locus of kiwifruit bacterial canker resistance and application thereof

Abstract

This invention belongs to the fields of molecular biology and genetic breeding technology, and discloses a molecular marker associated with the Psa8-246 locus, a resistance site to kiwifruit bacterial canker, and its application. Through genome-wide association analysis, this invention discovered the Psa8-246 resistance site on chromosome 8 of kiwifruit, located at base 2077786 on chromosome 8 of the kiwifruit Red5 reference genome, which can explain 5.3% of the phenotypic variation. Using the KASP marker designed with this SNP, 155 kiwifruit samples were tested, and the results showed that it is simple to operate, provides clear genotyping, and has a good selection effect against kiwifruit bacterial canker.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and genetic breeding technology, specifically relating to a molecular marker and its application related to the Psa8-246 site of resistance to kiwifruit canker. Background Technology

[0002] Bacterial canker of kiwifruit is a disease caused by *Pseudomonas syringae*, a pathogenic species of *Actinidia chinensis*. First reported in 1984 on *Actinidia arguta* var. *sinensis* in Shizuoka, Japan, it has become the biggest constraint on kiwifruit production worldwide, seriously jeopardizing the healthy development of the industry. Currently, the control of kiwifruit canker in production mainly relies on preventative measures, such as rain-sheltered cultivation and the use of chemical agents like copper-based agents and antibiotics such as kasugamycin. However, the use of these measures increases production costs and is not conducive to the green development of the kiwifruit industry. Therefore, screening and identifying resistant kiwifruit materials is crucial for controlling canker and promoting the healthy and sustainable development of my country's kiwifruit industry.

[0003] Studies have shown that plant hormones can respond to plant pathogen infection. The salicylic acid pathway is essential for plant resistance to vivotrophic pathogens, while the jasmonic acid signaling pathway is essential for plant resistance to necrotrophic pathogens. Abscisic acid indirectly affects plant resistance through its interaction with jasmonic acid. Kiwifruit canker resistance is a quantitative trait controlled by multiple genes. Due to the complexity of resistance and its phenotypic identification being easily influenced by environmental conditions, further research is needed on the discovery of kiwifruit canker resistance genes and their molecular mechanisms. Based on kiwifruit genome and transcriptome data, researchers have preliminarily predicted kiwifruit resistance genes, but the functions and mechanisms of these genes require further investigation.

[0004] This invention utilizes association analysis of 220 natural kiwifruit populations with kiwifruit canker to identify loci associated with kiwifruit canker and to develop practical, high-throughput, low-cost molecular markers for the identification and screening of kiwifruit canker resistance. Summary of the Invention

[0005] The purpose of this invention is to provide the application of a reagent for detecting the 2077786th base on chromosome 8 of kiwifruit in the screening and breeding of kiwifruit resistance to bacterial canker.

[0006] Another objective of this invention is to provide the application of primers for detecting base position 2077786 on chromosome 8 of kiwifruit in the screening and breeding of kiwifruit resistance to bacterial canker.

[0007] The final objective of this invention is to provide a method for screening and breeding kiwifruit to resist bacterial canker.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] Acquisition of molecular markers associated with the Psa8-246 site of kiwifruit resistance to bacterial canker:

[0010] The applicant collected single leaves from natural kiwifruit populations and extracted total DNA. Genomic DNA was randomly fragmented using a sonic disruptor, and the DNA fragments underwent end repair, followed by the addition of sequencing adapters and purification. The final library was obtained through PCR amplification. Preliminary quantification was performed using Qubit 2.0, and Q-PCR was used to accurately quantify the effective concentration of the library. PE sequencing was performed using the Illumina high-throughput sequencing platform. Raw reads obtained from sequencing were filtered, low-quality reads were removed, and alignment analysis was performed. By aligning to the reference genome, GATK was used to detect variants in the samples. Hard-filtering criteria were used to filter identified SNPs and Indels, obtaining the final variant file for subsequent association analysis. A strain of the kiwifruit canker pathogen, *Pseudomonas syringaepv. actinidiae*, was cultured. Isolated branches were inoculated with the pathogen, and the resistance level of the samples was classified according to the length of the lesions. Trait association analysis was performed using a mixed linear model, with population genetic structure as a fixed effect and individual kinship as a random effect, adjusting for the influence of population structure and individual kinship. GWAS analysis was performed using GEMMA, and the relatedness matrix between samples was calculated based on genotype data. Association analysis was then conducted using linear mixed models. Finally, the Psa8-246 locus of resistance to kiwifruit canker was obtained. This SNP locus is located at the 2077786th base on chromosome 8 of kiwifruit and can be repeatedly detected, explaining 5.3% of the phenotypic variation.

[0011] The KASP marker primer sequence designed for this site is as follows:

[0012] Primer_Allele

[0013] Primer_Allele Y: GAAGGTCGGAGTCAACGGATTGTCTAGTTGCCTTTCCTGTCGTCA and Primer_Common: CGGATGAGATTTGTGGTTTGATTGA.

[0014] Using the aforementioned molecular markers to detect the resistance to kiwifruit canker can enable early screening of kiwifruit canker resistance and assist in kiwifruit breeding.

[0015] The scope of protection of this invention includes:

[0016] Application of reagents for detecting base position 2077786 on chromosome 8 of kiwifruit in kiwifruit canker resistance screening breeding.

[0017] Application of reagent for detecting base position 2077786 on chromosome 8 of kiwifruit in the preparation of kiwifruit canker disease resistance screening kit.

[0018] The method for determining the above-mentioned application is as follows: if the genotype at position 2077786 on chromosome 8 of the kiwifruit is CA or AA, then the kiwifruit is determined to be a canker-resistant kiwifruit.

[0019] The method for determining the above-mentioned application is as follows: if the genotype at position 2077786 on chromosome 8 of kiwifruit is detected as CC, then the kiwifruit is determined to be susceptible to kiwifruit ulcer disease.

[0020] In the above applications, the preferred reagent is a primer.

[0021] The primers described above are preferably KASP detection primers, and more preferably the primers provided by this invention: Primer_Allele X: GAAGGTGACCAAGTTCATGCTGTCTAGTTGCCTTTCCTGTCGTCC; Primer_AlleleY: GAAGGTCGGAGTCAACGGATTGTCTAGTTGCCTTTCCTGTCGTCA and Primer_Common: CGGATGAGATTTGTGGTTTGATTGA.

[0022] A method for screening and breeding kiwifruit for resistance to bacterial canker includes detecting the 2077786th base on chromosome 8 of kiwifruit using conventional methods in the art. These conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0023] A kiwifruit canker resistance screening kit, the kit comprising a reagent for detecting the 2077786th base on chromosome 8 of kiwifruit.

[0024] The kiwifruit genome referenced in this invention is the kiwifruit red5 genome (http: / / kiwifruitgenome.org / organism / 3).

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The present invention obtained the kiwifruit canker disease site Psa8-246, which can be repeatedly detected and can explain 5.3% of the phenotypic variation rate.

[0027] (2) The present invention obtains the Psa8-246 site to develop the KASP marker, which has a simple detection method and low cost, and can improve the selection efficiency and accuracy of kiwifruit canker resistance screening. Detailed Implementation

[0028] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. The kiwifruit genome referenced in this invention is the kiwifruit red5 genome (http: / / kiwifruitgenome.org / organism / 3, Actinidia chinensis Red5 Genome).

[0029] Example 1:

[0030] Acquisition of molecular markers associated with the Psa8-246 site of kiwifruit resistance to bacterial canker:

[0031] ① Leaf samples from 220 natural kiwifruit populations were collected. Total DNA was extracted using the CTAB method. Agarose gel electrophoresis showed that the main band of genomic DNA was intact and clear, with no degradation or RNA contamination.

[0032] ② Genomic DNA was randomly fragmented using an acoustic disruptor. End repair was performed on the DNA fragments, sequencing adapters were added, and the fragments were purified. The final library was obtained through PCR amplification. Preliminary quantification was performed using Qubit 2.0, and Q-PCR was used to accurately quantify the effective concentration of the library to ensure library quality. PE sequencing was performed using the Illumina high-throughput sequencing platform.

[0033] ③ The raw reads obtained from sequencing were filtered to remove adapter sequences and polyG and polyX sequences at the tail, as well as low-quality reads, resulting in clean reads. BWA alignment analysis was performed on each sample. The filtered clean reads were then aligned to the reference genome. The alignment results were converted from SAM files to sorted BAM files using SAMtools. The alignment rate and coverage were calculated using a Python script. Based on the alignment results file, GATK was used to detect variants in the samples. Hard-filtering criteria were used to filter the identified SNPs and Indels. Finally, vcftools was used to obtain the final variant file for subsequent association analysis.

[0034] ④ The pathogenic strain M228 of *Pseudomonas syringae*, the pathogen of kiwifruit canker, was inoculated onto LB solid medium for activation and culture. After culturing at 25 °C for 36 h, a single colony was picked and transferred to 5 mL of liquid LB medium. The medium was then incubated overnight at 28 °C and 180 rpm on a shaker. After centrifugation at 12000 rpm for 5 min, the precipitate was collected, and the suspension was diluted with sterile water to an OD600 of 1, resulting in a concentration of 10⁹ CFU·mL⁻¹, ready for experimental use.

[0035] ⑤ Select healthy one-year-old branches with a diameter of approximately 0.8 cm and uniform growth. Cut them into 12-14 cm twigs and seal both ends with paraffin wax to prevent moisture loss. Disinfect the branches with 75% alcohol. Make a 3 mm wide, deep cut in the middle of the branch using a punch, reaching the xylem. Add 10 µL of bacterial solution to the cut. Inoculate 6 branches of each material, using sterile water as a control. After the bacterial solution has completely dried, place the branches in a tray with the wound facing upwards, lined with damp filter paper. Cover and seal with plastic wrap to maintain moisture, leaving excess moisture in the tray. Maintain an internal humidity of 80% and incubate at 16 °C under 16 h light / 8 h darkness conditions. After 42 days of incubation, remove the outer bark of the branches with a sterile knife and observe and measure the lesions formed after pathogen infection. Classify the resistance level of the kiwifruit material according to the length of the lesions: resistant: lesion length ≤ 9.0 mm; susceptible: lesion length > 9.0 mm.

[0036] ⑥ A mixed linear model was used for trait association analysis, with population genetic structure as a fixed effect and individual kinship as a random effect, adjusting for the influence of population structure and individual kinship. GWAS analysis was performed using GEMMA, and the relatedness matrix between samples was calculated based on genotype data. Association analysis was then conducted using linear mixed models, ultimately identifying the Psa8-246 locus associated with resistance to kiwifruit canker. This locus is located at base 2077786 on chromosome 8 of kiwifruit, can be repeatedly detected, and explains 5.3% of the phenotypic variation. Specific information is shown in Table 1.

[0037] Table 1. Psa8-246 loci of kiwifruit resistance to bacterial canker.

[0038]

[0039] Example 2:

[0040] Development of a KASP marker for a SNP site associated with resistance to kiwifruit canker:

[0041] Based on the nucleotide sequence before and after Psa8-246, the KASP marker detection primer sequence was obtained according to primer design principles as follows:

[0042] Primer_Allele X: GAAGGTGACCAAGTTCATGC TGTCTAGTTGCCTTTCCTGTCGTCC、

[0043] Primer_Allele Y: GAAGGTCGGAGTCAACGGAT TGTCTAGTTGCCTTTCCTGTCGTCA and

[0044] Primer_Common: CGGATGAGATTTGTGGTTTGATTGA.

[0045] The underlined part is the fluorescent connector.

[0046] The method for detecting the genotype of the Psa8-246 locus in the target kiwifruit using the above-mentioned KASP marker primer set is as follows:

[0047] (1) Extract genomic DNA from the kiwifruit to be tested.

[0048] (2) Preparation of reaction system. KASP labeling detection was performed on 96 samples using the Douglas Scientific ArrayTape system. The PCR system was assembled using NEXAR, with a reaction volume of 0.8 μL for each sample. The specific reaction system is shown in Table 2.

[0049] Table 2. KASP Reaction System

[0050]

[0051] (3) PCR amplification. PCR amplification was performed using SOELLEX. The Touch-down PCR amplification conditions were as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, decreasing by 0.8℃ per cycle until reaching 56℃, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 30 cycles.

[0052] (4) Data reading and genotyping. After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned using ARAYA; then, data analysis and genotyping were performed using INTELLICS.

[0053] Using the primers described above, the genotype of kiwifruit samples was detected. The amplified sequence obtained using these primers in the Xu Xiang variety is as follows (SNP site is C, homozygous):

[0054] TGTCTAGTTGCCTTTCCTGTCGTC C AGTTTTGTTGATCAATCAAACCACAAATCTCATCCG;

[0055] The sequence amplified using this primer in the Moshanxiong No. 1 variety is as follows (SNP site is A, homozygous):

[0056] TGTCTAGTTGCCTTTCCTGTCGTC A AGTTTTGTTGATCAATCAAACCAAAATCTCATCCG.

[0057] Example 3:

[0058] The universality of KASP markers at SNP sites associated with resistance to kiwifruit bacterial canker in the selection of kiwifruit bacterial canker resistance:

[0059] The genotype of the Psa8-246 locus in the kiwifruit was detected using the KASP primer set designed in Example 2. The kiwifruit samples used for testing consisted of 155 domestic and international kiwifruit varieties (lines) or germplasm resources (the applicant collected an additional 55 samples, and the remaining 100 samples were randomly selected from the 220 samples in Example 1). Ulcer disease inoculation and identification were performed according to the method used in Example 1, and the lesions and resistance levels of the ulcer disease were statistically analyzed.

[0060] The results showed that among the 155 kiwifruit samples, 49 samples had the genotype AA, 49 samples had the genotype AC, and 83 samples had the genotype CC (Table 3). This indicates that the Psa8-246 locus is segregated in 143 domestic and international kiwifruit samples.

[0061] If the genotype is AA, it is considered resistant. The number of resistant individuals is 29, and the identification rate is 29 / 37 = 78.3%.

[0062] If the genotype is AC, it is considered resistant. The number of resistant individuals is 64, and the identification rate is 64 / 75 = 85.3%.

[0063] If the genotype is CC, it is considered a susceptible disease, with 37 susceptible individuals, resulting in an identification rate of 37 / 43 = 86.0%.

[0064] Table 3. KASP markers for three genotypes in 143 kiwifruit canker phenotypes.

[0065]

[0066] The above results demonstrate that the prepared KASP molecular marker has a good screening effect on resistance to kiwifruit canker.

Claims

1. The application of a reagent for detecting the 2077786th base on chromosome 8 of kiwifruit in the selection and breeding of kiwifruit resistance to bacterial canker, characterized in that, The reference kiwifruit genome is the kiwifruit red5 genome. If the genotype CA or AA is detected at position 2077786 on chromosome 8 of kiwifruit, the kiwifruit is determined to be resistant to kiwifruit canker. If the genotype CC is detected at position 2077786 on chromosome 8 of kiwifruit, the kiwifruit is determined to be susceptible to kiwifruit canker.

2. The application of a reagent for detecting the 2077786th base on chromosome 8 of kiwifruit in the preparation of a kiwifruit canker resistance screening kit, characterized in that... The reference kiwifruit genome is the kiwifruit red5 genome. If the genotype CA or AA is detected at position 2077786 on chromosome 8 of kiwifruit, the kiwifruit is determined to be resistant to kiwifruit canker. If the genotype CC is detected at position 2077786 on chromosome 8 of kiwifruit, the kiwifruit is determined to be susceptible to kiwifruit canker.

3. The application according to claim 1 or 2, wherein the reagent is a primer.

4. The application according to claim 3, wherein the primer is: Primer_Allele 5. A method for screening and breeding kiwifruit for resistance to bacterial canker, comprising detecting the 2077786th base on chromosome 8 of kiwifruit, characterized in that, The reference kiwifruit genome is the kiwifruit red5 genome. If the genotype CA or AA is detected at position 2077786 on chromosome 8 of kiwifruit, the kiwifruit is determined to be resistant to kiwifruit canker. If the genotype CC is detected at position 2077786 on chromosome 8 of kiwifruit, the kiwifruit is determined to be susceptible to kiwifruit canker.

Images