Application of functional nucleic acid-based nanomicelles in targeted protein degradation

Abstract

This invention relates to the application of functional nucleic acid-based nanomicelles in targeted protein degradation. Specifically, this invention provides a nucleic acid aptamer-linker-lipid nanostructure, constructing an editable universal platform utilizing two degradation systems: lysosomes and ubiquitin-proteasomes, for the degradation of membrane proteins and cytoplasmic proteins, respectively. This provides a new approach to avoid the overload and safety issues that may arise from traditional targeted protein degradation using a single degradation pathway, and offers technical support for the treatment of diseases such as tumors.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically to the application of functional nucleic acid-based nanomicelles in targeted protein degradation. Background Technology

[0002] Targeted protein degradation technology based on protein degradation systems is an emerging drug discovery and treatment strategy that can target proteins that were traditionally considered undrugable, greatly expanding the scope of protein target drug development. Intracellular protein degradation systems mainly include the ubiquitin-proteasome system and the lysosomal degradation system.

[0003] The first developed targeted protein degradation molecule was a proteolysis-targeting chimera (PROTAC) based on the ubiquitin-proteasome system. PROTAC is also the fastest-growing class of molecules in targeted protein degradation technology. It mainly consists of three parts: a ligand that binds to the target protein, a ligand that recruits E3 ubiquitin ligase, and a flexible linker. PROTAC induces ubiquitination of the target protein and degrades it through the UPS pathway by forming a ternary complex with the E3 ubiquitin ligase.

[0004] Other targeted protein degradation technologies utilizing ubiquitin-proteasomes have also been developed, such as molecular gels that promote the interaction between E3 ubiquitin ligase and target protein, dual-mechanism small molecule degradative agents that combine the advantages of PROTAC and molecular gels, and Trim-Away technology that uses the ubiquitin ligase TRIM21 to recognize the Fc region of an antibody and degrade the antibody-bound target protein.

[0005] Meanwhile, targeted protein degradation technologies utilizing lysosomal degradation systems are gradually emerging, such as lysosomal targeted chimeras and autophagy targeted chimeras, which mediate the internalization of extracellular or cell membrane proteins through endocytosis and are then degraded via the lysosomal pathway.

[0006] Major diseases such as tumors and neurodegenerative diseases have complex and diverse target proteins with different localizations (membrane proteins and cytoplasmic proteins). While targeted protein degradation technology has shown great potential in recent years, it still faces several challenges, including the large molecular weight of antibody-based targeted proteins, high synthesis difficulty, difficulty in editing, low targeting and delivery efficiency, limitations of E3 ubiquitin ligases, restrictions on pre-modification of target proteins, and the difficulty in achieving simultaneous degradation of membrane and cytoplasmic proteins. Furthermore, due to a lack of molecular tools and limited understanding of the interactions between different intracellular degradation systems, current targeted protein degradation technologies mainly rely on single protein degradation systems to target and degrade membrane or cytoplasmic proteins. This may lead to overload and related side effects of specific degradation systems, and affect its application in diseases with abnormal degradation systems (such as aging and neurodegenerative diseases).

[0007] Nucleic acid aptamers are oligonucleotide sequences with specificity and high affinity for targets such as proteins, obtained through in vitro screening methods using exponentially enriched ligand systematic evolution (SELEX) technology. Theoretically, this can expand the target range to all proteins. Compared to traditional antibodies, nucleic acid aptamers offer advantages such as more flexible structures, smaller molecular weights, lower immunogenicity, ease of editing, in vitro chemical synthesis, and lower cost. Therefore, nucleic acid aptamers have unique advantages in the field of targeted protein degradation; however, issues regarding their stability, affinity, and delivery efficiency still need improvement.

[0008] Therefore, there is an urgent need in this field to develop effective and safe universal methods for the targeted degradation of membrane and cytoplasmic proteins based on nucleic acid aptamers. Summary of the Invention

[0009] The purpose of this invention is to provide a universal platform for the targeted degradation of membrane proteins or cytoplasmic proteins based on functional nucleic acids such as nucleic acid aptamers.

[0010] In a first aspect of the invention, a functional nucleic acid-lipid nanomicelle is provided, the nanomicelle comprising a plurality of nanomicelle monomers, the nanomicelle monomer comprising: (a) a targeting nucleic acid, (b) a lipid molecule, (c) a linker connecting the nucleic acid and the lipid, and optionally comprising (d) a functional peptide linked to the nucleic acid; the nanomicelle specifically targets and degrades membrane proteins and / or cytoplasmic proteins.

[0011] In another preferred embodiment, the nanomicelle monomer has a structure as described in Formula I:

[0012] Z n -LAP (Formula I)

[0013] In the formula,

[0014] Z represents a lipid molecule;

[0015] The subscript n represents the number of lipid molecules, where n is 1, 2, or 3, and preferably n is 2.

[0016] L stands for Linker;

[0017] A represents the targeted nucleic acid;

[0018] P represents a non-functional or non-functional peptide.

[0019] In another preferred embodiment, Z is a straight-chain fatty acid chain.

[0020] In another preferred embodiment, Z is a C6-C20 fatty acid chain, preferably a C18 fatty acid chain.

[0021] In another preferred example, A is an aptamer.

[0022] In another preferred example, A is a modified or unmodified nucleic acid aptamer.

[0023] In another preferred embodiment, A is a nucleic acid aptamer with extended 5' and 3' ends, each end extended by 1-20 nt, preferably by 1-8 nt.

[0024] In another preferred embodiment, the 5' and 3' sequence bases of A are complementary to form a stem structure, wherein the complementarity is complete or substantially complementary.

[0025] In another preferred embodiment, the length of the stem structure is 6-20 bp, preferably 7-15 bp, and more preferably 8-12 bp.

[0026] In another preferred embodiment, the 3' end of A is attached with a -DBCO group.

[0027] In another preferred embodiment, A targets proteins selected from the group consisting of membrane proteins, cytoplasmic proteins, or combinations thereof.

[0028] In another preferred embodiment, the membrane protein is selected from the group consisting of c-MET, PTK7, EGFR, PD-L1, EpCAM, FGFR2, or combinations thereof.

[0029] In another preferred embodiment, the cytoplasmic protein is selected from the group consisting of: Tau, RelA, NCL, AR (androgen receptor), E2F1, or combinations thereof.

[0030] In another preferred embodiment, A targets c-Met, and the sequence of A is shown in SEQ ID NO:2.

[0031] In another preferred embodiment, A targets PTK7, and the sequence of A is shown in SEQ ID NO:3.

[0032] In another preferred embodiment, A targets Tau, and the sequence of A is shown in SEQ ID NO:4 or SEQ ID NO:8.

[0033] In another preferred embodiment, A targets RelA, the sequence of which is shown in SEQ ID NO:6 or SEQ ID NO:9.

[0034] In another preferred embodiment, L comprises a trunk and branches.

[0035] In another preferred embodiment, the backbone is covalently linked to the 5' end of the nucleic acid aptamer.

[0036] In another preferred embodiment, each branch of the branch portion is a carbon chain containing amide bonds.

[0037] In another preferred embodiment, each branch of the branch portion contains 4-8 carbon atoms and an amide bond; preferably, each branch of the branch portion contains 6 carbon atoms and an amide bond.

[0038] In another preferred embodiment, each branch end of the branch portion is connected to the lipid molecule.

[0039] In another preferred embodiment, the L has the chemical formula shown in the following formula V:

[0040]

[0041] In the formula, sites a and b are the sites that connect the lipid molecules.

[0042] In another preferred embodiment, P is absent when the nanomicelles target membrane proteins.

[0043] In another preferred embodiment, when the nanomicelles target cytoplasmic proteins, P is a functional peptide.

[0044] In another preferred embodiment, the functional peptide comprises a targeting peptide and a membrane-penetrating peptide.

[0045] In another preferred embodiment, the targeting peptide is a ligand that targets the E3 ubiquitinase VHL.

[0046] In another preferred embodiment, the membrane-penetrating peptide contains 8 arginine residues.

[0047] In another preferred embodiment, the N-terminus of the functional peptide may optionally include a GS linker peptide.

[0048] In another preferred embodiment, the sequence of the functional peptide is GGSSALAPYIPRRRRRRRR (SEQ ID NO:1).

[0049] In another preferred embodiment, the N-terminus of the functional peptide is attached with an -N3 group.

[0050] In another preferred embodiment, the functional peptide is attached to the 3' end of A by reacting the -N3 group with the -DBCO group of A.

[0051] In another preferred embodiment, the monomers self-assemble to form the nanomicelles.

[0052] In another preferred embodiment, the particle size of the nanomicelles is 10-200 nm, preferably 20-100 nm, and more preferably 30-60 nm.

[0053] In another preferred embodiment, the nanomicelles do not contain functional peptides, the nanomicelles target the target membrane protein, and have the function of transporting the target membrane protein into lysosomes for degradation.

[0054] In another preferred embodiment, the nanomicelles contain functional peptides that target a cytosolic protein and have the function of ubiquitinizing the target cytosolic protein and degrading it via a proteasome.

[0055] In another preferred embodiment, the nanomicelles degrade the target membrane protein or cytoplasmic protein within 6 hours, preferably within 3 hours.

[0056] In a second aspect of the invention, a targeted nucleic acid-functional peptide chimera is provided, wherein the targeted nucleic acid targets a cytoplasmic protein, the functional peptide targets a ubiquitinase, and the targeted nucleic acid and the functional peptide are connected by a linker; the chimera targets and degrades the cytoplasmic protein.

[0057] In another preferred embodiment, the targeted nucleic acid is a nucleic acid aptamer.

[0058] In another preferred embodiment, the targeted nucleic acid target is a nucleic acid aptamer that targets Tau or RelA.

[0059] In another preferred embodiment, the functional peptide has a structure as described in Formula II:

[0060] P1-P2-P3 (Equation II)

[0061] In the formula,

[0062] P1 is a linker peptide;

[0063] P2 is a ligand that targets ubiquitinase;

[0064] P3 is a cell-penetrating peptide;

[0065] In another preferred embodiment, the ubiquitinase is E3 ubiquitinase VHL.

[0066] In another preferred embodiment, the linker peptide is a linker peptide containing glycine and serine.

[0067] In another preferred embodiment, the linker peptide sequence is GSGS.

[0068] In another preferred embodiment, the membrane-penetrating peptide contains 8 arginine residues.

[0069] In another preferred embodiment, the sequence of the functional peptide is GGSSALAPYIPRRRRRRRR (SEQ ID NO:1).

[0070] In a third aspect of the invention, a method for preparing functional nucleic acid-lipid nanomicelles as described in the first aspect of the invention is provided, comprising the steps of:

[0071] (a) Providing nanomicelle monomers;

[0072] (b) The nanomicelle monomers self-assemble to form the functional nucleic acid-lipid nanomicelles.

[0073] In another preferred embodiment, the method for synthesizing the functional nucleic acid-lipid nanomicelles in step (a) is a one-step solid-phase synthesis method.

[0074] In another preferred embodiment, the nanomicelle monomer is synthesized by the following steps: using a solid-phase phosphoramidite ester method, nucleic acid aptamers, linkers and lipid molecules are sequentially linked to obtain the nanomicelle monomer.

[0075] In another preferred embodiment, the nucleic acid aptamer is further linked to a functional peptide that has targeting ubiquitinase and membrane-penetrating capabilities.

[0076] In another preferred embodiment, in step (b), the nanomicelle monomer self-assembles in an aqueous solution to form the nanomicelle.

[0077] In a fourth aspect of the invention, the use of functional nucleic acid-lipid nanomicelles as described in the first aspect of the invention is provided for the preparation of a drug that targets and degrades a target membrane protein or a target cytoplasmic protein.

[0078] In another preferred embodiment, the target membrane protein is selected from the group consisting of c-MET, PTK7, or combinations thereof.

[0079] In another preferred embodiment, the target cytoplasmic protein is selected from the group consisting of Tau, RelA, or combinations thereof.

[0080] In another preferred embodiment, the nanomicelles do not contain functional peptides, and the nanomicelles are used to prepare a drug that targets and degrades a specific membrane protein.

[0081] In another preferred embodiment, the nanomicelles contain functional peptides, and the nanomicelles are used to prepare a drug that targets and degrades a specific cytoplasmic protein.

[0082] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0083] Figure 1 The diagram shows the synthesis of membrane protein-targeted nucleic acid aptamer-L-lipid micelles (A), agarose gel electrophoresis analysis (B), and dynamic light scattering (DLS) particle size analysis (C).

[0084] Figure 2 The schematic diagram of the PROTAC structure synthesis of the nucleic acid aptamer-L-VHL ligand short peptide is shown in (A), and the analysis by non-denaturing polyacrylamide gel electrophoresis is shown in (B).

[0085] Figure 3 The diagram shows the synthesis of cytoplasmic protein-targeted nucleic acid aptamer-L-lipid micelles (A), agarose gel electrophoresis analysis (B), and dynamic light scattering (DLS) particle size analysis (C).

[0086] Figure 4 The analysis shows the binding ability of the nucleic acid aptamer-L-lipid micelle target protein to the membrane protein (A), the cell entry ability (B), and the co-localization of the lysosome (C).

[0087] Figure 5 The PROTAC structure of the cytoplasmic protein-targeted nucleic acid aptamer-L-lipid micelles was shown in the analysis of its binding ability to the target protein (A), cell entry ability (B), and lysosomal co-localization (C).

[0088] Figure 6 The following analyses demonstrate the ability of the nucleic acid aptamer-L-lipid micelles targeting membrane proteins to degrade cell membrane proteins (c-MET or PTK7): Western blot analysis (A and B), immunofluorescence analysis (C), target protein signaling pathway analysis, and cell viability assay (D and F).

[0089] Figure 7 The study demonstrated the ability of the PROTAC structures of cytoplasmic protein-targeting nucleic acid aptamer-L-lipid micelles without PROTAC structures, nucleic acid aptamer-L-lipid micelles with PROTAC structures, and short peptides of nucleic acid aptamer-L-VHL ligands to degrade cytoplasmic proteins. Western blot analysis (A, B, C), immunofluorescence analysis (D), signaling pathway protein analysis, and cell viability assays (E and F) were performed.

[0090] Figure 8 The analysis shows the mechanism of nucleic acid aptamer-L-lipid micelle degradation of membrane proteins (A) and the mechanism of degradation of cytoplasmic proteins (B and C). Detailed Implementation

[0091] Through extensive and in-depth research, the inventors have pioneered the provision of nucleic acid aptamer-lipid nanostructures, constructing editable universal platforms utilizing both lysosomes and ubiquitin-proteasome degradation systems for the degradation of membrane and cytoplasmic proteins, respectively. Specifically, this invention provides a nanomicelle targeting membrane proteins, which is self-assembled from monomers formed by linking nucleic acid aptamers and lipid molecules via linkers. This nanomicelle specifically targets the target membrane protein and degrades it via the lysosomal pathway. This invention also provides a nanomicelle targeting cytoplasmic proteins, in which functional peptides are linked to nucleic acid aptamers. After specifically binding to the target cytoplasmic protein, it is degraded via the ubiquitin-proteasome pathway. This invention is based on these findings.

[0092] Nanomicelle monomers targeting membrane proteins

[0093] This invention provides a nanomicelle monomer that targets membrane proteins. This monomer is an amphiphilic molecule composed of a hydrophilic functional nucleic acid and a hydrophobic lipid, with the functional nucleic acid and lipid linked by a linker containing a branched structure. The functional nucleic acid has the function of specifically targeting membrane proteins.

[0094] In one embodiment of the present invention, the targeted functional nucleic acid is a nucleic acid aptamer. Typically, the 5' and 3' ends of a nucleic acid aptamer can be base-complementary to form a stem structure. In this invention, the nucleic acid aptamer is modified to extend its 5' and 3' ends, forming a longer and more stable stem structure for connection with linkers and enhancing the stability of the nucleic acid aptamer. Preferably, the length of the stem structure is 6-20 bp, more preferably 7-15 bp.

[0095] In one embodiment of the present invention, a nucleic acid aptamer targeting c-Met protein is provided, wherein each end is extended by 3 bases to form a stem structure of 11 bp in length, and the sequence of the nucleic acid aptamer targeting c-Met protein is shown in SEQ ID NO:2; the present invention also provides a nucleic acid aptamer targeting PTK-7, wherein the 5' end is extended by 2 bases and the 3' end is extended by 3 bases to form a stem structure of 8 bp in length, and the sequence of the nucleic acid aptamer targeting PTK-7 protein is shown in SEQ ID NO:3.

[0096] Nucleic acid aptamer sequence targeting c-Met in micelles (SEQ ID NO:2):

[0097] 5'-AGA ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT TCT-3'

[0098] Nucleic acid aptamer sequence targeting PTK7-stem in micelles (SEQ ID NO:3):

[0099] 5'-AG ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA TCT-3'

[0100] The bolded part represents the stem structure, and the underlined part represents the structure of the nucleic acid aptamer before elongation.

[0101] In this invention, a nucleic acid aptamer is linked to a lipid molecule. The lipid molecule used in this invention is a straight-chain fatty acid chain, preferably a C6-C20 fatty acid chain. In one embodiment of this invention, two C18 fatty acid chains are linked to one nucleic acid aptamer.

[0102] In this invention, the nucleic acid aptamer and lipid molecule are linked by a linker with a branched structure. One end of the linker's main stem is covalently linked to the 5' end of the nucleic acid aptamer, and each of the two branches of the linker is connected to a C18 chain. In one embodiment of this invention, the chemical structure of the linker is shown in Formula V, where the right side represents two branched structures, each a carbon chain containing an amide bond, and sites a and b are the sites for lipid molecule linkage; the left side represents the main stem structure.

[0103]

[0104] This invention also provides a method for preparing the nanomicelle monomer of the present invention. The method utilizes the solid-phase phosphoramidite triester method, which involves introducing a linker with two branched structures at the end of a nucleic acid aptamer and then connecting one C18 lipid chain to each linker. The nanomicelle monomer of the present invention can be synthesized in one step, and the synthesis method is simple and easy to operate.

[0105] Nanomicelles targeting membrane proteins

[0106] As used herein, the terms "nanomicelles targeting membrane proteins" and "nucleic acid aptamer-L-lipid micelles targeting membrane proteins" are used interchangeably and both refer to nanomicelles formed by the self-assembly of the nanomicelle monomers targeting membrane proteins of the present invention. The nanomicelles of the present invention have a particle size of 10-200 nm, preferably 20-100 nm, and more preferably 30-60 nm.

[0107] The nucleic acid aptamers in the nanomicelles of the present invention have the function of specifically targeting specific membrane proteins. When the nanomicelles of the present invention specifically bind to the target membrane protein, endocytosis occurs on the cell membrane, and the nanomicelles and the target membrane protein are co-encapsulated to form an endosome, which is then degraded by lysosomes.

[0108] In one embodiment of the present invention, nanomicelles targeting c-Met protein are provided. c-Met protein, also known as hepatocyte growth factor receptor (HGFR), is a membrane-bound tyrosine kinase receptor. It is encoded by the proto-oncogene c-met and plays an important role in many biological processes, including cell proliferation, differentiation, migration, and morphogenesis. Its main ligand is hepatocyte growth factor (HGF). When HGF binds to c-Met, it activates the tyrosine kinase activity of c-Met, thereby triggering a series of signal transduction pathways. c-Met protein has been found to be overexpressed or mutated in many types of cancer, which is often closely related to tumor occurrence, development, invasion, and metastasis. The c-Met-targeting nanomicelles of the present invention can specifically degrade c-Met protein on membrane proteins, significantly reducing the phosphorylation level of Met protein, thereby inhibiting the activity of tumor cells.

[0109] In one embodiment of the present invention, nanomicelles targeting the PTK-7 protein are provided. PTK-7 (Protein Tyrosine Kinase 7) is a membrane-bound tyrosine kinase receptor belonging to the tyrosine kinase receptor family and plays a role in various biological processes. It is involved in regulating processes such as nerve cell growth, differentiation, migration, and synapse formation and function. Current research has found that PTK-7 is abnormally expressed in certain types of cancer and is associated with tumor occurrence, development, and metastasis. The PTK-7-targeting nanomicelles of the present invention can specifically degrade the PTK-7 protein on membrane proteins.

[0110] The membrane protein-targeting nanomicelles of this invention can rapidly degrade target membrane proteins. Experiments have shown that the nanomicelles of this invention can degrade membrane proteins within 3 hours, exhibiting high degradation efficiency and a significant concentration gradient. The membrane protein-targeting nanomicelles of this invention can be used in the development of drugs for membrane protein-related diseases.

[0111] The targeted nucleic acid-functional peptide chimera of the present invention

[0112] This invention also provides a targeted nucleic acid-functional peptide chimera, namely a PROTAC chimera targeting cytoplasmic proteins, which is composed of a nucleic acid aptamer and a functional peptide linked together. The functional peptide includes a linker portion, a targeting portion, and a transmembrane portion. The linker portion is a linker peptide containing GS, the targeting portion is a ligand targeting ubiquitinase, and the transmembrane portion is a transmembrane peptide containing 8 arginine residues. Experiments have demonstrated that the chimera of this invention can effectively target the target cytoplasmic protein and cause the target protein to be degraded via the ubiquitin-proteasome pathway.

[0113] In one embodiment of the present invention, a chimera targeting the Tau protein was prepared, wherein the sequence of the nucleic acid aptamer portion is shown in SEQ ID NO:4. In one embodiment of the present invention, a chimera targeting the RelA protein was prepared, wherein the sequence of the nucleic acid aptamer portion is shown in SEQ ID NO:6.

[0114] The nucleic acid aptamer sequence (SEQ ID NO:4) targeting Tau in PROTAC:

[0115] 5'-CTA CTGAATAAGGACTGCTTAGGATTGCGATGATTCAG TAG-DBCO-3'

[0116] The nucleic acid aptamer sequence targeting RelA in PROTAC (SEQ ID NO:6):

[0117] 5'-AGTCA GCGGGACAGGAGAAACACGGCATGTCAGCG CTGACT-DBCO-3'

[0118] The bolded part represents the stem structure, and the underlined part represents the structure of the nucleic acid aptamer before elongation.

[0119] In one embodiment of the present invention, the sequence of the functional peptide is GGSSALAPYIPRRRRRRRR (SEQ ID NO:1), wherein positions 1 to 4 are the linker portion, positions 5 to 11 are the ligand short peptide targeting the E3 ubiquitinase VHL, and positions 12 to 19 are the transmembrane portion. An exemplary chimera structure is shown below. Figure 2 As shown in Figure A, the nucleic acid aptamer has a -DBCO group attached to its 3' end; the functional peptide has a -N3 azide group attached to its N' end, and the nucleic acid aptamer and the functional peptide are linked by a click chemistry reaction.

[0120] Nanomicelle monomers targeting cytoplasmic proteins

[0121] Based on the PROTAC chimera targeting cytoplasmic proteins, a branched linker is used to connect the chimera to lipid molecules, yielding the cytoplasmic protein-targeting nanomicelle monomer of this invention. The structures of the linker and lipid molecules are identical to those in the nanomicelle monomer targeting membrane proteins. Compared to the PROTAC chimera, the nanomicelles and their monomers exhibit further enhanced cell entry ability, target protein binding ability, and degradation ability.

[0122] In one embodiment of the present invention, a nanomicelle monomer targeting Tau protein is provided, wherein the nucleic acid aptamer sequence is as shown in SEQ ID NO:8, with both ends extended, and the 3' end of the nucleic acid aptamer further extended by two unpaired bases, and a -DBCO group is attached to the 3' end; thus forming a stem structure of (12bp+2nt) length. In another embodiment of the present invention, a nanomicelle O monomer targeting RelA protein is provided, wherein the nucleic acid aptamer sequence is as shown in SEQ ID NO:9, with both ends extended, forming a stem structure of (11bp+2nt) length.

[0123] Tau-stem in micelles (SEQ ID NO:8):

[0124] 5'-AGACTA CTGAATAAGGACTGCTTAGGATTGCGATGATTCAG TAGTCTTT-DBCO-3'

[0125] RelA-stem (SEQ ID NO:9) in micelles:

[0126] 5'-AGAAGTCA GCGGGACAGGAGAAACACGGCATGTCAGCG CTGACTTCTTT-DBCO-3'

[0127] The bolded part represents the stem structure, and the underlined part represents the structure of the nucleic acid aptamer before elongation.

[0128] Using the solid-phase phosphoramidite method, a linker with two branches is introduced at the end of a nucleic acid aptamer with a functional peptide, and a C18 lipid chain is connected to each of the two branches of the linker to synthesize the nanomicelle monomer of the present invention targeting cytoplasmic protein in one step.

[0129] Nanomicelles targeting cytoplasmic proteins

[0130] As used herein, the terms "nanomicelles targeting cytoplasmic proteins" and "nucleic acid aptamers-L-lipid micelles targeting cytoplasmic proteins" are used interchangeably and both refer to the nanomicelles formed by the self-assembly of the nanomicelle monomers targeting cytoplasmic proteins of the present invention.

[0131] The nucleic acid aptamers in the nanomicelles of the present invention that target cytoplasmic proteins have the function of specifically targeting specific membrane proteins. The functional peptides therein can cross the cell membrane and target E3 ubiquitinase. When the nanomicelles of the present invention specifically bind to the target cytoplasmic protein, the target cytoplasmic protein is labeled with ubiquitin and then degraded by the proteasome.

[0132] In one embodiment of the present invention, a nanomicelle targeting Tau protein is provided. Tau protein is a microtubule-associated protein (MAP) primarily expressed in neuronal axons, binding to microtubules and participating in maintaining microtubule stability and promoting axonal formation and substance transport. Tau protein has multiple phosphorylation sites, and its phosphorylation state affects its ability to bind to microtubules. Abnormal Tau protein phosphorylation is associated with various neurological diseases, such as Alzheimer's disease and anterior temporal lobe dementia. In these diseases, abnormally phosphorylated Tau protein aggregates to form fibrous structures, leading to neuronal dysfunction and death. The Tau protein-targeting nanomicelle of the present invention can significantly reduce Tau protein phosphorylation levels and enhance the activity of Tau-overexpressing cells.

[0133] In one embodiment of the present invention, nanomicelles targeting the RelA protein are provided. The RelA protein, also known as NF-κB p65, is an important member of the nuclear factor-κB (NF-κB) family. NF-κB is a transcription factor that plays a role in regulating gene expression in cells and participates in various biological processes, such as immune responses, inflammatory responses, cell proliferation, and apoptosis. Under normal conditions, the NF-κB complex is inhibited by the IκB protein and remains in the cytoplasm. When cells are stimulated (e.g., by infection, inflammation, oxidative stress), the IκB protein is phosphorylated and degraded, thereby releasing the NF-κB complex, which enters the nucleus and regulates the expression of related genes. NF-κB is highly expressed in some tumor cells. The nanomicelles targeting the RelA protein of the present invention can significantly reduce the level of RelA protein and inhibit the activity of tumor cells.

[0134] The cytosolic protein-targeting nanomicelles of this invention can rapidly degrade the target cytosolic protein. Experiments have shown that the nanomicelles of this invention can degrade the cytosolic protein within 3 hours, exhibiting high degradation efficiency and a significant concentration gradient. The membrane protein-targeting nanomicelles of this invention can be used in the development of drugs for cytosolic protein-related diseases.

[0135] The main advantages of this invention include:

[0136] (1) The nucleic acid aptamer-L-lipid micelle of the present invention can be used as a universal platform. By selecting a suitable nucleic acid aptamer, it can target a variety of membrane proteins or cytoplasmic proteins and is suitable for the targeted degradation of a variety of target proteins.

[0137] (2) The nucleic acid aptamer-L-lipid micelles of the present invention, which target membrane proteins, have the function of specifically targeting lysosomes and effectively degrading membrane proteins through the lysosomal pathway.

[0138] (3) The nucleic acid aptamer-L-lipid micelles of the present invention that target cytoplasmic proteins do not enter lysosomes, but can directly enter the cytoplasm, thereby binding to the target protein in the cytoplasm and degrading the cytoplasmic protein through the ubiquitin-proteasome pathway.

[0139] (4) The PROTAC structure of the nucleic acid aptamer-L-VHL ligand short peptide of the present invention has a good ability to enter cells and degrade cytoplasmic proteins; the nucleic acid aptamer-L-lipid micelles formed after the addition of lipid chains can further enhance the protein degradation ability and cell entry ability of the corresponding PROTAC structure.

[0140] (5) The nucleic acid aptamer-L-lipid micelles of the present invention can specifically degrade the target protein, and very rapidly (within 6 hours).

[0141] (6) Amphiphilic molecules developed based on functional nucleic acid structures and lipids can be mass-produced and stored for a long time. They can be precisely edited and modified, and have better targeting, cell entry and degradation capabilities. At the same time, they have low immunogenicity and good tissue permeability.

[0142] (7) The nucleic acid aptamer-L-lipid universal platform of the present invention accelerates the drug development of drugs targeting specific proteins and can be used for physiological regulation and disease treatment.

[0143] (8) The method for preparing nucleic acid aptamers-L-lipid micelles of the present invention has simple preparation conditions and steps, is easy to operate and artificially modify, and has the prospect of industrial synthesis.

[0144] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and fractions are weight percentages and weight fractions.

[0145] Example 1: Synthesis and identification of L-lipid micelles, nucleic acid aptamers targeting membrane proteins

[0146] The following elements were linked using a solid-phase phosphoramidite ester method: a nucleic acid aptamer targeting membrane proteins c-Met or PTK7, a linker, and two C18 lipid chains, to obtain a membrane protein-targeting nucleic acid aptamer-L-lipid micelle monomer.

[0147] The synthesized nucleic acid aptamer-L-lipophilic molecule self-assembled into a micelle structure in aqueous solution by pipette tip blowing, as shown in the schematic diagram below. Figure 1 As shown in A, the nucleic acid aptamer-L-lipid micelle targeting c-Met is named Met-aptamer-Micelle (abbreviated as Met-apt-Mic); the nucleic acid aptamer-L-lipid micelle targeting PTK7 is named PTK7-aptamer-Micelle (abbreviated as PTK7-apt-Mic).

[0148] The formation of nucleic acid aptamer-L-lipid micelles was determined by agarose gel electrophoresis, and the results are as follows: Figure 1 As shown in Figure B, the results demonstrate the successful synthesis of two types of nanomicelles: Met-apt-Mic and PTK7-apt-Mic.

[0149] The particle size of the nanomicelles was analyzed by DLS, and the results are as follows: Figure 1 As shown in C, the size of Met-apt-Mic is 42.09nm, and the size of PTK7-apt-Mic is 38.59nm.

[0150] Example 2: Synthesis and Identification of PROTAC Targeting Cytoplasmic Proteins

[0151] To enable the nanomicelles to target cytoplasmic proteins, a -DBCO group was modified at the 3' end of the nucleic acid aptamers targeting Tau or RelA proteins, respectively. These aptamers were then linked to a functional peptide (SEQ ID NO: 1) targeting VHL via click chemistry, forming a PROTAC chimeric molecule that targets and degrades cytoplasmic proteins via a nucleic acid aptamer-L-peptide (see schematic diagram). Figure 2 (As shown in A).

[0152] The nucleic acid aptamer targeting Tau is named LA aptamer, and the PROTAC chimeric molecule targeting Tau is named LA-Peptide (LAP). The LA aptamer mutant that does not bind to Tau is named LS aptamer (SEQ ID NO:5), and the synthesized PROTAC molecule is named LS-Peptide (LSP). The nucleic acid aptamer targeting RelA is named RA aptamer, and the PROTAC chimeric molecule targeting RelA is named RA-Peptide (RAP). The RA aptamer mutant that does not bind to RelA is named RM aptamer (SEQ ID NO:7), and the synthesized PROTAC molecule is named RM-Peptide (RMP).

[0153] The formation of this chimera was confirmed by non-denaturing polyacrylamide gel electrophoresis, and the results are as follows: Figure 2 As shown in B. The results show that the PROTAC chimeric molecule of the nucleic acid aptamer-L-peptide was successfully synthesized.

[0154] Example 3: Synthesis and Identification of L-Lipid Micelles, Nucleic Acid Aptamers Targeting Cytoplasmic Proteins

[0155] The micelle structure targeting the cytoplasmic protein was synthesized in accordance with the method described in Example 1, and the nucleic acid aptamer, linker and two C18 lipid chains of the targeting cytoplasmic protein Tau or RelA were linked by the solid-phase phosphoramidite method.

[0156] The synthesized nucleic acid aptamer-L-lipid amphiphilic molecules self-assembled into micelle structures in aqueous solution by pipetting. The nucleic acid aptamer-L-lipid micelle targeting Tau is named LA-Micelle (LA-Mic), and the nucleic acid aptamer-L-lipid micelle targeting RelA is named RA-Micelle (RA-Mic).

[0157] In the solid-phase synthesis process, two unpaired bases are added to the 3' end of the nucleic acid aptamer, and the terminal is modified with a -DBCO group. It is then linked to a short peptide (SEQ ID NO:1) targeting VHL via click chemistry to form a nucleic acid-L-lipid micelle structure with a PROTAC chimera, as shown in the schematic diagram. Figure 3 As shown in Figure A, the micelles with PROTAC chimeras targeting Tau are named LA-Peptide-Micelle (abbreviated as LAP-Mic), and the micelles with PROTAC chimeras targeting RelA are named RA-Peptide-Micelle (abbreviated as RAP-Mic).

[0158] The formation of micelles was determined by agarose gel electrophoresis, and the results are as follows: Figure 3 As shown in Figure B, the results indicate that LAP-Mic and RAP-Mic micelles were successfully synthesized.

[0159] The micelle size was analyzed by DLS, and the results are as follows: Figure 3 As shown in Figure C, the size of LAP-Mic is 36.48 nm, and the size of RAP-Mic is 32.84 nm.

[0160] Example 4: Analysis of the binding ability, cell entry ability, and lysosomal co-localization of target proteins by nucleic acid aptamers-L-lipid micelles targeting membrane proteins.

[0161] To detect the binding ability of membrane protein-targeting aptamer-L-lipid micelles to cells expressing target proteins, 100 nM of c-Met-targeting aptamer-L-lipid micelles (Met-apt-Mic) or PTK7-targeting aptamer-L-lipid micelles (PTK7-apt-Mic) were incubated with HeLa cells on ice for 30 min, and the binding ability was analyzed by flow cytometry. After incubating 100 nM of these micelles with HeLa cells at 37 °C for 4 h, the cell penetration ability was analyzed by confocal microscopy. After incubating the micelles with HeLa cells at 37 °C for 3 h, lysosomes were stained for 30 min, and co-localization with lysosomes was analyzed by laser confocal microscopy.

[0162] The results of the test of binding ability are as follows Figure 4 As shown in Figure A, the membrane protein-targeted nucleic acid aptamer-L-lipid micelles have a significantly enhanced binding capacity compared to the nucleic acid aptamer itself, with an improvement of approximately two orders of magnitude.

[0163] The results of the cell entry ability test are as follows: Figure 4 As shown in B, the micelles of the present invention have a significantly enhanced cell entry ability compared with the nucleic acid aptamers themselves.

[0164] The detection results of co-localization with lysosomes are as follows Figure 4 As shown in C, the micelles of the present invention exhibit strong co-localization with lysosomes after entering the cell.

[0165] The above results demonstrate that the membrane protein-targeting nucleic acid aptamer-L-lipid micelles of the present invention have better target binding ability and cell entry ability than the nucleic acid aptamer itself, and can rapidly target and enter the lysosome after entering the cell.

[0166] Example 5: Analysis of the binding ability, cell entry ability, and lysosomal co-localization of the PROTAC chimera of nucleic acid aptamers-L-lipid micelles targeting cytoplasmic proteins.

[0167] To detect the binding ability of PROTAC chimeras in cytoplasmic protein-targeted nucleic acid aptamer-L-lipid micelles to target proteins, Tau-targeted PROTAC chimeras were incubated with lysates of 293T cells overexpressing Tau, or RelA-targeted PROTAC chimeras were incubated with lysates of A549 cells. The binding ability to target proteins was detected by pull-down and Western blot experiments.

[0168] LAP or LAP-Mic cells were incubated with SH-SY5Y cells at 37°C for 6 h, and RAP or RAP-Mic cells were incubated with A549 cells at 37°C for 6 h. Cell entry capacity was detected by flow cytometry. After incubating LAP-Mic cells with SH-SY5Y cells, or RAP-Mic cells with A549 cells at 37°C for 3 h, lysosomes were stained for 30 min, and colocalization with lysosomes was detected by laser confocal microscopy.

[0169] Combining ability test results, such as Figure 5 As shown in A, the chimera of the present invention can effectively bind to the target protein and form a ternary complex with Tau or RelA target protein and VHL.

[0170] Cell entry ability test results as follows Figure 5 As shown in B and Table 1, the micelles (LAP-mic or RAP-mic) of the present invention with PROTAC chimeric structure have significantly improved cell entry ability and fluorescence intensity increased by orders of magnitude compared with PROTAC chimera (LAP or RAP).

[0171] Table 1 Results of cell entry ability test

[0172] type Fluorescence intensity (average) type Fluorescence intensity (average) Cellular 28.93 Cellular 232.7 LA 3423 RA 41322 LAP 4373 RAP 57435 LA-mic 19081 RA-mic 432667 LAP-mic 26744 RAP-mic 794667

[0173] Results of lysosomal colocalization experiment as follows Figure 5 As shown in C, the micelles of the present invention that target intracellular proteins do not co-localize with lysosomes.

[0174] The above results show that the PROTAC chimera of the present invention has a good ability to target cytosolic proteins. Furthermore, unexpectedly, the micelles of the PROTAC chimera of the present invention exhibit a significantly enhanced cell entry ability. Moreover, the micelles targeting cytosolic proteins of the present invention are essentially not co-localized with lysosomes, indicating that the micelles targeting cytosolic proteins do not degrade cytosolic proteins via the lysosomal pathway.

[0175] Example 6: Analysis of the ability of L-lipid micelles, nucleic acid aptamers targeting membrane proteins, to target and degrade membrane proteins.

[0176] To investigate the ability of L-lipid micelles targeting membrane proteins to degrade membrane proteins, different concentrations of L-lipid micelles targeting c-Met membrane proteins (Met-apt-Mic) or L-lipid micelles targeting PTK7 membrane proteins (PTK-apt-Mic) were incubated with HeLa cells for 24 h. Western blotting experiments revealed that, compared to the untreated control group (0 nM), these micelles significantly degraded the target membrane proteins at 300 nM, exhibiting a concentration gradient effect. Figure 6 A).

[0177] HeLa cells were incubated with 300 nM of L-lipid micelles (Met-apt-Mic) targeting c-Met membrane protein or L-lipid micelles (PTK-apt-Mic) targeting PTK7 membrane protein for different durations. Western blotting experiments revealed that, compared to untreated control cells (0 h), these micelles rapidly (within 3 h) degraded the target membrane proteins, exhibiting a time-gradient effect. Figure 6 B). Simultaneously, after fixing and staining HeLa cells treated with micelles, the levels of c-Met protein or PTK7 protein on the cell membrane were found to be significantly reduced. Figure 6 C).

[0178] These results demonstrate that the membrane protein-targeting nucleic acid aptamer-L-lipid micelles can significantly reduce membrane protein levels, exhibiting both concentration gradient and time gradient effects.

[0179] Hepatocyte growth factor (HGF) can activate and promote c-Met protein phosphorylation. Treatment of HeLa cells with 300 nM micelle Met-apt-Mic followed by the addition of 40 ng / mL HGF to activate c-Met significantly reduced Met protein phosphorylation (P-Met) levels. Simultaneously, treatment of HeLa cells with 300 nM Met-apt-Mic or PTK-apt-Mic significantly reduced the viability of tumor cells. Figure 6 D, F).

[0180] Example 7: Analysis of the ability of nucleic acid aptamers-L-lipid micelles targeting cytoplasmic proteins to degrade them.

[0181] To investigate the necessity of VHL ligand peptides in the targeted degradation of cytoplasmic proteins by aptamers-L-lipid micelles, the inventors incubated SH-SY5Y cells with 600 nM LA-Mic and LAP-Mic for 24 h. Western blot experiments revealed that, compared to the untreated control group, LA-Mic had no effect on intracellular Tau protein levels, while LAP-Mic significantly reduced intracellular Tau protein levels. This indicates that the synthesis of aptamers-L-lipid micelles for targeted degradation of cytoplasmic proteins requires the addition of VHL ligand peptides. Figure 7 A).

[0182] To analyze the degradation ability of PROTAC chimeras of nucleic acid aptamer-L-VHL ligands and micelles containing PROTAC chimera structures on target cytoplasmic proteins, the inventors incubated SH-SY5Y cells and A549 cells with different concentrations of LAP and LAP-Mic, and RAP and RAP-Mic, respectively, for 24 h. Western blot experiments revealed that these materials significantly reduced the levels of target cytoplasmic proteins, exhibiting a certain concentration gradient effect. Simultaneously, the results showed that, at the same concentrations of LAP and LAP-Mic, and RAP and RAP-Mic, micelle-treated cells had lower levels of target proteins. Figure 7 B).

[0183] Subsequently, SH-SY5Y cells and A549 cells were treated with 600 nM LAP and 300 nM LAP-Mic, and 600 nM RAP and 300 nM RAP-Mic for different durations. Western blot results showed that these materials reduced the levels of target cytosolic proteins in cells with a certain time gradient effect. Figure 7 C).

[0184] After fixing and staining the micelle-treated cells with antibodies, it was found that the intracellular levels of Tau protein or RelA protein were significantly reduced after micelle treatment. Figure 7 D).

[0185] The results above indicate that nucleic acid aptamers-L-lipid micelles containing the PROTAC chimeric structure further enhance the ability of the PROTAC chimeric structure to degrade cytoplasmic proteins, and exhibit both concentration gradient and time gradient effects.

[0186] To further investigate the effects of micelle structure on cell function, a cell model of Tau protein hyperphosphorylation was constructed using okadaic acid (OA). The results showed that LAP-Mic significantly reduced the phosphorylation level of Tau protein in cells treated with okadaic acid and increased the viability of OA-treated cells. Figure 7 E). Similarly, after RAP-Mic treatment of A549 cells, the activity of these tumor cells was significantly reduced ( Figure 7 F). The results show that the micelles targeting cytoplasmic proteins of the present invention can effectively degrade intracellular Tau protein or RelA protein.

[0187] Example 8: Mechanism analysis of nucleic acid aptamer-L-lipid micelle degradation of membrane and cytoplasmic proteins

[0188] To further analyze the mechanism by which nucleic acid aptamer-L-lipid micelles degrade membrane and cytoplasmic proteins, cells were pretreated with 20 μM lysosomal inhibitor (CQ) and 4 μM proteasome inhibitor (MG132) for 2 h, respectively. Then, HeLa cells, SH-SY5Y cells, and A549 cells were incubated with 300 nM membrane protein-targeting nucleic acid aptamer-L-lipid micelles (Met-apt-Mic or PTK7-apt-Mic) and cytoplasmic protein-targeting nucleic acid aptamer-L-lipid micelles containing a PROTAC structure (LAP-Mic or RAP-Mic), respectively, for 24 h. Western blot results showed that, compared with the untreated control group, the lysosomal inhibitors significantly inhibited the degradation of c-Met or PTK7 proteins on the cell membrane by Met-apt-Mic or PTK7-apt-Mic. Figure 8 A), while proteasome inhibitors can significantly inhibit the degradation of Tau or RelA proteins in the cytoplasm by LAP-Mic or RAP-Mic ( Figure 8 B) indicates that micelles targeting membrane proteins degrade membrane proteins via the lysosomal pathway, while micelles targeting cytoplasmic proteins degrade cytoplasmic proteins via the proteasome pathway.

[0189] K48 ubiquitination of proteins is characterized by the formation of a chain-like structure through multiple ubiquitin molecules linked to the Lys48 site of the target protein. The main function of K48 ubiquitination is to promote the degradation of the target protein. To investigate the effect of cytoplasmic protein-targeting micelles on the ubiquitin levels of the target protein, the inventors incubated 300 nM LAP-Mic or RAP-Mic with 293T cells or A549 cells overexpressing Tau protein for 5 h, respectively. Ubiquitination levels were then analyzed by pull-down and Western blotting. The results showed that the K48 ubiquitin levels of Tau or RelA proteins were significantly increased in the micelle-treated groups. Figure 8 C).

[0190] The above results demonstrate that the nucleic acid aptamer-L-lipid micelles of the present invention can serve as a universal platform for editing based on the intracellular localization of target proteins, thereby enabling targeted degradation of membrane proteins and cytoplasmic proteins using two protein degradation systems (lysosomal degradation system and ubiquitin-proteasome degradation system). The inventors discovered that after treatment of cells with micelles targeting cytoplasmic proteins, Tau and RelA proteins were modified by the K48 ubiquitin chain.

[0191] sequence

[0192] Functional peptide (SEQ ID NO:1)

[0193] GSGSALAPYIPRRRRRRRR

[0194] c-MET-stem (SEQ ID NO:2) in micelles:

[0195] 5’-AGAATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGATTCT-3’

[0196] PTK7-stem (SEQ ID NO:3) in micelles:

[0197] 5’-AGATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATCT-3’

[0198] Tau aptamer (LA aptamer) (SEQ ID NO:4) in PROTAC:

[0199] 5’-CTACTGAATAAGGACTGCTTAGGATTGCGATGATTCAGTAG-DBCO-3’

[0200] Tau mut aptamer (LS aptamer) (SEQ ID NO:5) in PROTAC:

[0201] 5’-TTACGGAGTACGGATGTCAGTGGTATAGTAATCCGTACTAA-DBCO-3’

[0202] RelA aptamer (RA aptamer) (SEQ ID NO:6) in PROTAC:

[0203] 5’-AGTCAGCGGGACAGGAGAAACACGGCATGTCAGCGCTGACT-DBCO-3’

[0204] RelA mutant aptamer (RM aptamer) (SEQ ID NO:7) in PROTAC:

[0205] 5’-AGTCAGCGTGACATTTTTTTTTTTTTTTGTCTTCGCTGACT-DBCO-3’

[0206] Tau-stem (SEQ ID NO:8) in micelles:

[0207] 5’-AGACTACTGAATAAGGACTGCTTAGGATTGCGATGATTCAGTAGTCTTT-DBCO-3’

[0208] RelA-stem (SEQ ID NO:9) in micelles:

[0209] 5'-AGAAGTCAGCGGGACAGGAGAAACACGGCATGTCAGCGCTGACTTC TTT-DBCO-3'

[0210] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A functional nucleic acid-lipid nanomicelle, characterized in that, The nanomicelles comprise a plurality of nanomicelle monomers, each nanomicelle monomer comprising: (a) a targeting nucleic acid, (b) a lipid molecule, (c) a linker connecting the nucleic acid and the lipid, and optionally (d) a functional peptide linked to the nucleic acid; the nanomicelles specifically target and degrade membrane proteins or cytoplasmic proteins; the nanomicelle monomers have a structure as shown in Formula I: Z n -L-A-P type I In the formula, Z represents a lipid molecule, which is a C6-C20 straight-chain fatty acid chain; The subscript n represents the number of lipid molecules, where n is 2; L is a linker comprising a trunk and branch portions, each branch of which is a carbon chain containing an amide bond. The trunk is covalently linked to the 5' end of the nucleic acid aptamer. L has the chemical formula shown in V below: Formula V In the formula, sites a and b are the sites that connect the lipid molecules; A is a targeted nucleic acid, which is a nucleic acid aptamer; A is a nucleic acid aptamer with 5' and 3' extended ends, each end extended by 1-20 nt, and the 5' and 3' end sequences of A are complementary to form a stem structure, the length of which is 6-20 bp; P is a non-functional or non-functional peptide; the functional peptide has a structure as shown in Formula II: P1-P2-P3 Formula II In the formula, P1 is a linker peptide; P2 is a ligand that targets ubiquitinase; P3 is a cell-penetrating peptide.

2. The functional nucleic acid-lipid nanomicelles as described in claim 1, characterized in that, Z is a C18 straight-chain fatty acid chain.

3. The functional nucleic acid-lipid nanomicelles as described in claim 1, characterized in that, The A target membrane protein or cytoplasmic protein.

4. The functional nucleic acid-lipid nanomicelles as described in claim 3, characterized in that, The membrane protein is c-MET or PTK7.

5. The functional nucleic acid-lipid nanomicelles as described in claim 3, characterized in that, The cytoplasmic protein is either Tau or RelA.

6. The functional nucleic acid-lipid nanomicelles as described in claim 4, characterized in that, A targets c-Met, and the sequence of A is shown in SEQ ID NO:2; or, A targets PTK7, and the sequence of A is shown in SEQ ID NO:

3.

7. The functional nucleic acid-lipid nanomicelles as described in claim 5, characterized in that, A targets Tau, and the sequence of A is shown in SEQ ID NO:4 or SEQ ID NO:8; or, A targets RelA, and the sequence of A is shown in SEQ ID NO:6 or SEQ ID NO:

9.

8. The functional nucleic acid-lipid nanomicelles as described in claim 1, characterized in that, When the nanomicelles target membrane proteins, P is absent; when the nanomicelles target cytoplasmic proteins, P is a functional peptide.

9. The functional nucleic acid-lipid nanomicelles as described in claim 8, characterized in that, The membrane-penetrating peptide contains 8 arginine residues.

10. The functional nucleic acid-lipid nanomicelles as described in claim 9, characterized in that, P2 is a ligand that targets the E3 ubiquitinase VHL.

11. The functional nucleic acid-lipid nanomicelles as described in claim 8, characterized in that, The sequence of the functional peptide is SEQ ID NO:

1.

12. The functional nucleic acid-lipid nanomicelles as described in claim 2, characterized in that, The particle size of the nanomicelles is 10-200 nm.

13. The functional nucleic acid-lipid nanomicelles as described in claim 1, characterized in that, The monomers self-assemble to form the nanomicelles.

14. The functional nucleic acid-lipid nanomicelles as described in claim 1, characterized in that, The nanomicelles degrade the membrane protein or cytoplasmic protein within 6 hours.

15. A method for preparing the functional nucleic acid-lipid nanomicelles as described in claim 1, characterized in that, Including the following steps: (a) Providing the nanomicelle monomer; (b) The nanomicelle monomers self-assemble to form the functional nucleic acid-lipid nanomicelles.

16. The method as described in claim 15, characterized in that, The nanomicelle monomer is synthesized by the following steps: using a solid-phase phosphoramidite triester method, a targeted nucleic acid, a linker, and a lipid molecule are sequentially linked to obtain the nanomicelle monomer.

Images