A protac compound, a preparation method thereof and application thereof as a degradation agent targeting ptrf / cavin1
By developing the PROTAC compound EPIC-0726 to target and degrade PTRF/Cavin1, the problem of GBM cell resistance to TMZ was solved, thereby enhancing the efficacy of chemotherapy and prolonging patient survival.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TIANJIN MEDICAL UNIVERSITY GENERAL HOSPITAL
- Filing Date
- 2025-07-25
- Publication Date
- 2026-07-21
AI Technical Summary
Among the current treatment options for glioblastoma (GBM), patient survival rates are low and recurrence rates are high. Furthermore, temozolomide (TMZ) resistance is severe, and existing chemotherapy drugs are ineffective in inhibiting PTRF/Cavin1, resulting in GBM cells being insensitive to chemotherapy.
A PROTAC compound, EPIC-0726, was developed to target and degrade PTRF/Cavin1. By utilizing an E3 ligase ligand, the degradation of PTRF/Cavin1 is induced, thereby inhibiting pitting function and enhancing the sensitivity of GBM cells to TMZ.
EPIC-0726 can effectively inhibit tumor growth in vitro and in vivo, enhance the sensitivity of GBM cells to TMZ, prolong the survival of tumor-bearing nude mice, and its effect is superior to the existing small molecule compound EPIC-1042.
Smart Images

Figure QLYQS_1 
Figure QLYQS_2 
Figure QLYQS_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biopharmaceuticals, and in particular to a PROTAC compound, its preparation method, and its application as a degrading agent targeting PTRF / Cavin1. Background Technology
[0002] Glioblastoma (GBM) is the most common primary malignant tumor of the central nervous system, characterized by rapid malignant progression, insensitivity to radiotherapy and chemotherapy, poor prognosis, and high recurrence and mortality rates. The treatment of GBM has always been a major challenge in the field of neuro-oncology. Although surgery, radiotherapy, and chemotherapy are currently the main treatment methods, patient survival rates remain low, and recurrence rates are high.
[0003] Surgery, radiotherapy, and temozolomide (TMZ) are the gold standard for treating GBM. While temozolomide, as a first-line chemotherapy drug, has prolonged patient survival to some extent, its resistance is becoming increasingly serious, severely limiting its clinical efficacy. Studies have shown that GBM cell resistance to TMZ is related to multiple factors, including activation of DNA repair mechanisms, changes in the tumor microenvironment, and abnormal expression of specific genes.
[0004] Caveolae are nanoscale (60-80 nm) membrane invaginations on the cell membrane, primarily involved in cholesterol and lipid metabolism, endocytosis, and cell signal transduction. One of the key components of caveolae is polymerase-1 and release transcript factor (PTRF / Cavin1). PTRF / Cavin1 is crucial for the formation and maintenance of caveolae function. Studies have shown a positive correlation between PTRF / Cavin1 expression and the malignancy grade of gliomas and TMZ resistance. Therefore, targeting PTRF / Cavin1 degraders holds promise as a novel therapeutic strategy. By reducing PTRF / Cavin1 expression and inhibiting caveolae function, PTRF / Cavin1 can enhance the sensitivity of GBM cells to TMZ and improve patient prognosis. Summary of the Invention
[0005] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a PROTAC compound, its preparation method, and its application as a degrading agent targeting PTRF / Cavin1, in order to solve the problems in the prior art.
[0006] This invention first provides a PROTAC compound with the structure shown in Formula I:
[0007]
[0008] The Linker is a connector, which can be selected from any of the following structures:
[0009] (1) (2) (3)
[0010] (4) (5)
[0011] In some embodiments of the present invention, the PROTAC compound has the structure shown in Formula II:
[0012]
[0013] The present invention also provides a method for preparing the above-mentioned PROTAC compound, the method comprising the following steps:
[0014] 1) Reacting compound 11 and compound 12 yields intermediate compound 13;
[0015] 2) Compound 13 was reacted with a base to give intermediate compound 14;
[0016] 3) Compound 14 and Compound 15 are mixed and undergo an amide condensation reaction to obtain intermediate compound 16; under acidic conditions, compound 16 undergoes an amino protecting group removal reaction to obtain the target product, namely PROTAC compound EPIC-0726.
[0017] In some embodiments of the present invention, in step 1), the molar ratio of compound 11 to compound 12 is 1:(1.2 to 1.8); preferably, the molar ratio of compound 11 to compound 12 is 1:1.5.
[0018] In some embodiments of the present invention, step 1) further includes co-reacting Cs2CO3 with compound 11 and compound 12. Specifically, the molar ratio of compound 11, compound 12 and Cs2CO3 is 1:(1.2-1.8):(1.5-2.5).
[0019] In some embodiments of the present invention, in step 1), the reaction time is 10 to 15 hours; preferably, the reaction time is 12 hours.
[0020] In some embodiments of the present invention, in step 1), the temperature of the reaction is 25 to 80°C; preferably, the reaction time is 80°C.
[0021] In some embodiments of the present invention, in step 1), the solvent for the reaction is an organic solvent, specifically, the organic solvent is MeCN.
[0022] In some embodiments of the present invention, in step 2), the molar ratio of compound 13 to base is 1:(2-4); preferably, the molar ratio of compound 13 to base is 1:3; preferably, the base is sodium hydroxide.
[0023] In some embodiments of the present invention, in step 2), the reaction solvent for compound 13 and the base is an aqueous methanol solution; preferably, the volume fraction of the aqueous methanol solution is 60-75%; preferably, the volume fraction of the aqueous methanol solution is 67%.
[0024] In some embodiments of the present invention, in step 2), the reaction time is 10 to 15 hours; preferably, the reaction time is 12 hours.
[0025] In some embodiments of the present invention, in step 2), the temperature of the reaction is 25-30°C; preferably, the reaction time is 25°C.
[0026] In some embodiments of the present invention, in step 3), the molar ratio of compound 14 to compound 15 is 1:(2-3); preferably, the molar ratio of compound 14 to compound 15 is 1:2.5.
[0027] In some embodiments of the present invention, in step 3), the condensing agents for the amide condensation reaction are TCFH and NMI. Preferably, the molar ratio of compound 14, compound 15, TCFH and NMI is 1:(2-3):(2.2-2.8):(3.5-4.5).
[0028] In some embodiments of the present invention, in step 3), the solvent for the amide condensation reaction is an organic solvent; preferably, the organic solvent is THF.
[0029] In some embodiments of the present invention, in step 3), the amide condensation reaction takes 10 to 15 hours; preferably, the amide condensation reaction takes 12 hours.
[0030] In some embodiments of the present invention, in step 3), the temperature of the amide condensation reaction is 20-30°C; preferably, the time of the amide condensation reaction is 25°C.
[0031] In some embodiments of the present invention, in step 3), the acidic environment for the amino protecting group removal reaction is provided by HCl / dioxane. Preferably, the molar ratio of compound 16 to HCl / dioxane is 1:(2.8-3.2); preferably, the molar ratio of 16 to HCl / dioxane is 1:3.
[0032] In some embodiments of the present invention, in step 3), the amino protecting group removal reaction time is 10 to 15 hours; preferably, the reaction time is 12 hours.
[0033] In some embodiments of the present invention, in step 3), the temperature of the amino protecting group removal reaction is 20-30°C; preferably, the reaction time is 25°C.
[0034] In some embodiments of the present invention, in step 3), the agent for the amino protecting group removal reaction is an organic solvent; preferably, the organic solvent is dichloromethane.
[0035] In some embodiments of the present invention, the intermediate product is further subjected to separation and purification processes, including but not limited to one or more of filtration, concentration, drying, dissolution, extraction, washing, column chromatography or high-performance liquid chromatography purification, which can be flexibly processed according to the characteristics of the intermediate product.
[0036] In this invention, the method for synthesizing compound 11 can be found in patent application CN 117327067 A.
[0037] In some embodiments of the present invention, the synthetic route of the PROTAC compound EPIC-0726 is as follows:
[0038]
[0039] The present invention also provides the use of the above-mentioned PROTAC compound in the preparation of anticancer drugs.
[0040] In some embodiments of the present invention, the PROTAC compound is used as a degrading agent for targeted degradation of PTRF / Cavin 1 in the preparation of anticancer drugs.
[0041] In some embodiments of the present invention, the anticancer drug has one or more of the following effects:
[0042] 1) Inhibit the proliferation of tumor cells; preferably, the tumor cells are tumor cells that highly express PTRF / Cavin1; more preferably, the tumor cells that highly express PTRF / Cavin1 are glioblastoma;
[0043] 2) Degradation of PTRF / Cavin1 in tumor cells;
[0044] 3) Degradation of RBX1 protein;
[0045] 4) Inhibit ERK1 / 2K63 ubiquitination chain modification;
[0046] 5) Inhibit ERK1 / 2 activation;
[0047] 6) Inhibits PGK1 S203 phosphorylation and mitochondrial translocation;
[0048] 7) Promotes pyruvate metabolism and / or inhibits glycolysis;
[0049] 8) Inhibit AKT K63 ubiquitination chain modification and activation and / or p21 K48 ubiquitination chain modification and degradation;
[0050] 9) The efficacy of temozolomide (TMZ) in vitro and in vivo treatment.
[0051] The present invention also provides a medicament comprising the above-described PROTAC compound EPIC-0726 and a pharmaceutically acceptable carrier and / or excipients.
[0052] In some embodiments of the present invention, the PROTAC compound EPIC-0726 is used as the sole active ingredient for the treatment of tumors, or EPIC-0726 may be used as the main active ingredient in combination with other drugs for the treatment of tumors.
[0053] As described above, the PROTAC compound of the present invention, its preparation method, and its application as a degrading agent targeting PTRF / Cavin1 have the following beneficial effects:
[0054] With lenalidomide as an E3 ligand, the PROTAC compound EPIC-0726 can induce PTRF / Cavin1 degradation in a wide range of cell lines, and its target specificity is mediated by lenalidomide and EPIC-1042. Moreover, its inhibitory effect on tumor cells depends on the mechanism of action of its PROTAC, rather than the lenalidomide or EPIC-1042 it contains.
[0055] EPCI-0726 inhibits the assembly of Cullin-RING E3 ligases by decreasing RBX1, suppressing the ubiquitination activation of ERK1 / 2 and AKT, and the ubiquitination degradation of p21, thereby inhibiting the transcription of proteins related to glycolysis and DNA damage repair. Through this mechanism of action, EPCI-0726 inhibits GBM proliferation and increases GBM sensitivity to TMZ. Animal experiments also demonstrate that EPCI-0726 effectively inhibits tumor growth, prolongs the survival of tumor-bearing nude mice, and enhances the efficacy of TMZ, with effects superior to the existing small molecule compound EPIC-1042. Attached Figure Description
[0056] Figure 1 This diagram illustrates the targeted degradation of PTRF / Cavin1 induced by EPIC-0726 in this invention. (A) Western blotting showing the effect of different concentration gradients of EPIC-0726 on PTRF / Cavin1 protein levels in various cell lines. (B) Degradation curves of PTRF / Cavin1 in various cell lines and DC... 50 (C) Changes in PTRF / Cavin1 mRNA levels in GBM cells treated with DMSO or EPIC-0726 for 48 hours; U87-MG treated with DMSO or 7.5 μM EPIC-0726; TBD-0220 treated with DMSO or 10 μM EPIC-0726. (D) Expression levels of PTRF / Cavin1 in different cell lines detected by Western blotting. (E) Expression levels of PTRF / Cavin1 and its DC values in different cell lines. 50 Linear regression fitting.
[0057] Figure 2The following diagrams illustrate the verification of the EPIC-0726 ligand specificity of this invention. (A) Western blotting (WB) Graph showing changes in PTRF / Cavin1 and CAV-1 protein levels under different concentrations of EPIC-1042. (B) Graph showing changes in PTRF / Cavin1 levels in GBM cells after treatment with EPIC-1042 and EPIC-0726 alone or in combination. (C) Western blotting (WB) Graph showing changes in intracellular PTRF / Cavin1 levels in GBM cells after treatment with DMSO, Lenalidomide, and EPIC-0726 alone or in combination for 48 hours. (D) Western blotting (WB) Graph showing the effect of siRNA knockdown of CRBN. (E) Western blotting (WB) Graph showing changes in intracellular PTRF / Cavin1 levels in Ctrl–KD- or CRBN–KD–U87-MG and TBD-0220 cells after treatment with DMSO or EPIC-0726 for 48 hours. (F) After treating GBM cells with DMSO, MG132, and EPIC-0726 alone or in combination for 48 hours, changes in intracellular PTRF / Cavin1 were detected by Western blotting. In (BC, EF), U87-MG cells were treated with 7.5 μM EPIC-0726 for 48 hours; TBD-0220 cells were treated with 10 μM EPIC-0726 for 48 hours.
[0058] Figure 3 The diagram illustrates the inhibition of GBM cell proliferation by EPIC-0726 of the present invention. (A) IC50 of EPIC-0726 and EPIC-1042 in GBM cells. 50 (B) Determination of the inhibitory effect of EPIC-0726 and Lenalidomide alone or in combination on GBM cells. (C) After treating GBM cells with a specified concentration of EPIC-0726 for 48 hours, the change in intracellular caveolin-1 was detected by Western blotting. In (B), U87-MG cells were treated with 7.5 μM EPIC-0726; TBD-0220 cells were treated with 10 μM EPIC-0726.
[0059] Figure 4 This invention demonstrates that EPIC-0726 inhibits GBM proliferation in vivo in a dose-dependent manner. (A) Animal experiment flowchart. (BC) Bioluminescence images of representative mice in each treatment group and quantitative analysis of bioluminescence intensity in each treatment group. P, two-way ANOVA. (D) Kaplan-Meier survival curves of tumor-bearing nude mice in different treatment groups. P, Log-rank test. (E) Ki-67 and PTRF / Cavin1 IHC staining in each treatment group. Scale bar = 40 μm.
[0060] Figure 5This invention demonstrates how EPIC-0726 inhibits GBM tumor proliferation in vivo via a long-term, dose-dependent treatment regimen. (A) Animal experiment flowchart. (BC) Bioluminescent images of representative mice in each treatment group and quantitative analysis of tumor size in each group. P, two-way ANOVA. (D) Kaplan-Meier survival curves of tumor-bearing nude mice. P, Log-rank test. (E) Ki-67 IHC staining in each treatment group. Scale bar = 40 μm.
[0061] Figure 6 The image shows a comparison of the in vivo therapeutic effects of EPIC-0726 and EPIC-1042 of this invention. (A) Median survival of each treatment group in three animal experiments. (B) Relative molecular mass of each fraction of EPIC-0726. (C) Molecular concentration of substances at different dosages.
[0062] Figure 7 The invention demonstrates how EPIC-0726 promotes RBX1 degradation. (A) After treating GBM cells with a specified concentration of EPIC-0726 for 48 hours, changes in intracellular RBX1 were detected by Western blotting. (B) After treating U87-MG cells with DMSO or 7.5 μM EPIC-0726 for 48 hours, or TBD-0220 cells with DMSO or 10 μM EPIC-0726 for 48 hours, changes in intracellular RBX1 mRNA were detected by PCR.
[0063] Figure 8The invention demonstrates how PTRF / Cavin1 binds to RBX1 and inhibits RBX1 ubiquitination. (A) Western blotting verifies the PTRF / Cavin1 knockout effect. (B) Changes in intracellular RBX1 protein levels after PTRF / Cavin1 knockout. (C) Changes in intracellular RBX1 mRNA levels after PTRF / Cavin1 knockout. (DE) Changes in intracellular RBX1 levels and quantitative analysis after 24 hours of treatment with CHX, CQ, or MG132 alone or in combination with Ctrl–KO- and PTRF / Cavin1–KO-U87-MG and TBD-0220. (F) Co-IP assay using anti-RBX1 antibody and Western blotting with ubiquitin to detect changes in ubiquitin bound to RBX1 after PTRF / Cavin1 knockout. (G) Co-IP experiments were performed using PTRF / Cavin1 and RBX1 antibodies, respectively, and Western blotting was performed using RBX1 and PTRF / Cavin1, respectively, to detect the interaction between PTRF / Cavin1 and RBX1. (H) The effect of shRNA knockdown of RBX1 in GBM cell lines was detected by Western blotting. (I) Changes in intracellular PTRF / Cavin1 after RBX1 knockdown were detected by Western blotting. (J) Changes in RBX1 were observed after GBM cells were treated with EPIC-0726, CHX, CQ, or MG132, alone or in combination, for 24 hours. In (J), U87-MG cells were treated with 7.5 μM EPIC-0726; TBD-0220 cells were treated with 10 μM EPIC-0726.
[0064] Figure 9The invention demonstrates that EPIC-0726 inhibits ERK1 / 2 activation by downregulating RBX1 to suppress ERK1 / 2 K63 ubiquitin chain modification. (A) Changes in intracellular ERK1 / 2 and p-ERK1 / 2 protein levels after treating GBM cells with a specified concentration of EPIC-0726 for 48 hours. (B) Effects of RBX1 knockdown on intracellular ERK1 / 2 and p-ERK1 / 2 in GBM cells as detected by Western blotting. (C) Effects of RBX1 knockdown on intracellular MEK1 / 2 and p-MEK1 / 2 in GBM cells as detected by Western blotting. (D) Changes in intracellular ERK1 / 2 and p-ERK1 / 2 after treating Ctrl–KD-, RBX1–KD-U87-MG, and TBD-0220 with DMSO or EPIC-0726 for 48 hours as detected by Western blotting. (EF) After treating Ctrl–KD- and RBX1–KD-U87-MG and TBD-0220 cells with DMSO or EPIC-0726 for 48 hours, Co-IP experiments were performed using anti-ERK1 / 2 antibodies, followed by Western blotting with ubiquitin and K63 ubiquitin, respectively. (DF) U87-MG cells were treated with 7.5 μM EPIC-0726; TBD-0220 cells were treated with 10 μM EPIC-0726.
[0065] Figure 10 The invention illustrates how EPIC-0726 inhibits glycolysis in tumor cells while simultaneously promoting pyruvate metabolism. (A) Changes in intracellular PGK1 and p-PGK1(S203) protein levels in GBM cells treated with a specified concentration of EPIC-0726 for 48 hours under hypoxic conditions. (B) OCR values and basal respiration were measured using a SeahorseXFe24 metabolic analyzer after TBD-0220 cells were treated with DMSO or EPIC-0726 for 48 hours. (C) ECAR values, glycolytic capacity, and glycolytic volume were measured using a SeahorseXFe24 metabolic analyzer after TBD-0220 cells were treated with DMSO or EPIC-0726 for 48 hours. In (AC), U87-MG cells were treated with 7.5 μM EPIC-0726; TBD-0220 cells were treated with 10 μM EPIC-0726.
[0066] Figure 11The invention demonstrates how EPIC-0726 inhibits AKT activation and p21 degradation. (A) Changes in intracellular AKT, p-AKT, and p21 protein levels in GBM cells after treatment with a specified concentration of EPIC-0726 for 48 hours. (BE) Co-IP assays were performed using anti-AKT and p21 antibodies, and Western blotting was performed with ubiquitin, K63 ubiquitin, and K48 ubiquitin to detect the effect of EPIC-0726 on ubiquitin bound to AKT and p21. In (BE), U87-MG cells were treated with 7.5 μM EPIC-0726; TBD-0220 cells were treated with 10 μM EPIC-0726.
[0067] Figure 12 The results show how EPIC-0726 enhances the efficacy of TMZ in MGMT-negative GBM cells. (A) Changes in intracellular Rb and p-Rb protein levels in GBM cells after 48 hours of treatment with a specified concentration of EPIC-0726. (B) Intracellular mRNA levels of Rad50, Rad51, CHK1, CHK2, and MRE11 in GBM cells after 48 hours of treatment with DMSO or EPIC-0726, detected by PCR. (C) Changes in intracellular protein levels of Rad50, Rad51, CHK1, CHK2, and MRE11 in GBM cells after 48 hours of treatment with DMSO, EPIC-0726, and 100 μM TMZ, alone or in combination. (D) Changes in intracellular γ-H2AX in GBM cells after 48 hours of treatment with DMSO, EPIC-0726, and 100 μM TMZ, alone or in combination, detected by IF. Scale bar = 20 μm. In (BD), U87-MG cells were treated with 7.5 μM EPIC-0726; TBD-0220 cells were treated with 10 μM EPIC-0726.
[0068] Figure 13 (AB) shows the cell inhibition rate and synergistic analysis matrix of the combined application of EPIC-0726 and TMZ in U87-MG and TBD-0220, n=3 independent experiments.
[0069] Figure 14This demonstrates the efficacy of EPIC-0726 in enhancing TMZ's effect on MGMT-negative GBM in vivo. Tumor-bearing nude mice were treated by gavage for 6 weeks with DMSO, TMZ (5 mg / kg), EPIC-0726 (15 mg / kg), or TMZ (5 mg / kg) + EPIC-0726 (15 mg / kg). TMZ was administered for 5 days followed by a 2-day break, while EPIC-0726 was administered daily. Each group had n = 8 mice. (AB) Bioluminescence images of representative mice in each treatment group and quantitative analysis of bioluminescence intensity in each treatment group. P, two-way ANOVA. (C) Kaplan-Meier survival curves of tumor-bearing nude mice. P, Log-rank test. (D) Median survival statistics for each treatment group in animal experiments with EPIC-0726-sensitized TMZ and EPIC-1042-sensitized TMZ. Detailed Implementation
[0070] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art to which this invention pertains. Unless otherwise specified, the experimental reagents used in the following embodiments are conventional biochemical reagents; and the experimental methods described are conventional methods.
[0071] I. Synthesis of PROTAC-EPIC-0726
[0072] Compound 11 (29.0 g, 68.6 mmol, 1.00 eq) and compound 12 (28.7 g, 102 mmol, 1.50 eq) were added to MeCN (290 mL), followed by Cs₂CO₃ (44.7 g, 137 mmol, 2.00 eq), and the temperature was maintained at 25 °C. The mixture was then stirred at 80 °C for 12 hours. Thin-layer chromatography showed the reaction was complete. The residue was poured into 200 mL of water, and the aqueous phase was extracted with ethyl acetate (200 mL x 3). The combined organic phase was washed with brine (300 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. Purification was achieved by silica gel chromatography (100-200 mesh silica gel, gradient elution, eluents being petroleum ether and ethyl acetate, with the volume ratio of petroleum ether decreasing from 50 / 1 to 0 / 1 until compound 13 was completely eluted). The intermediate compound 13 was a yellow solid.
[0073] Compound 13 (30 g, 49.4 mmol, 1.00 eq) was dissolved in a mixture of MeOH (100 mL) and H₂O (50.0 mL), and NaOH (5.93 g, 148.32 mmol, 3.00 eq) was added, maintaining the temperature at 25 °C. The mixture was stirred at 25 °C for 12 hours. Thin-layer chromatography showed the reaction was complete. The mixture was adjusted to pH 2 with HCl (2N). The aqueous phase was extracted with ethyl acetate (200 mL × 3). The bound organic phase was washed with brine (200 mL × 2), dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The crude product was used directly in the next step without further purification. The intermediate compound 14 was a yellow solid. Spectral data for compound 14:
[0074] 1H NMR: (400MHz, DMSO-d6)
[0075] δ7.36-7.24(m,5H),7.23-7.17(m,1H),6.79(br s,1H),4.58(br d,J=4.2Hz,2H),3.30-3.22(m,5H),3.03-2.93(m,3H),2.90-2.67(m,3H),2.19(t,J=7.3Hz,2H),1.91(s,1H),1.72(br s,2H),1.54-1.45(m,2H),1.37(s,9H),1.28(br d,J=12.8Hz,12H).
[0076] Compound 14 (23.0 g, 38.8 mmol, 1.00 eq) and compound 15 (25.15 g, 97.0 mmol, 2.50 eq) were dissolved in THF (300 mL), and TCFH (27.2 g, 97.0 mmol, 2.50 eq) and NMI (12.7 g, 155 mmol, 12.37 mL, 4.00 eq) were added respectively, maintaining the temperature at 25 °C. The mixture was stirred at 25 °C for 12 hours. LC-MS showed the reaction was complete. The residue was poured into 200 mL of water, and the aqueous phase was extracted with ethyl acetate (300 mL x 3). The bound organic phase was washed with brine (300 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The crude product was used directly in the next step without further purification. The intermediate compound 16 was a yellow solid.
[0077] Compound 16 (40.0 g, 47.9 mmol, 1.00 eq) was dissolved in dichloromethane (400 mL), and HCl / dioxane (4.00 M, 35.9 mL, 3.00 eq) was added, maintaining the temperature at 25 °C. The mixture was stirred at 25 °C for 12 hours. HPLC showed the reaction was complete, and the reaction mixture was concentrated to dryness. The crude product was purified by reversed-phase high-performance liquid chromatography (RP-HPLC), and the target product EPIC-0726 was a yellow solid. The chromatographic data of the target product EPIC-0726 are as follows:
[0078] 1 HNMR: (400METHANOL-d4)
[0079] δ7.71(d,J=7.6Hz,1H),7.64(d,J=7.2Hz,1H),7.55-7.48(m,1H),7.32-7.28(m,5H),7.26-7.20(m,1 H),5.16(dd,J=5.1,13.3Hz,1H),4.69(s,3H),4.47(d,J=4.4Hz,2H),3.55(t,J=5.7Hz,3H),3.28(br s,2H),3.05(br s,2H),2.94-2.75(m,5H),2.50-2.39(m,4H),2.19(ddd,J=2.4,5.2,10.1Hz,1H),1.85(br s,2H),1.76-1.68(m,2H),1.40(br s,12H).
[0080] In this invention, the method for synthesizing compound 11 can be found in patent application CN 117327067 A.
[0081] II. Target Groups and Methods
[0082] 2.1 Experimental subjects: cells and animals
[0083] BALB / c-nu nude mice were used as experimental animals and purchased from Beijing Huafukang Biotechnology Co., Ltd. The TBD-0220 primary glioblastoma cells used were isolated from fresh tumor samples from the Affiliated Hospital of Hebei University (Baoding, China) that had not undergone radiotherapy or chemotherapy. Standardized human glioma cell lines (U87-MG, LN229, LN-18, T98G) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). In addition, mRNA microarray sequencing data from 1010 glioma patients and 649 GBM patients from the Chinese Glioma Genome Atlas (CGGA) database, as well as Agilent G4502 mRAN microarray data from 497 GBM patients from the Cancer Genome Atlas (TCGA) database, were used for relevant bioinformatics analysis.
[0084] 2.2 Some experimental reagents
[0085] The synthesis steps of EPIC-1042 are described in patent application CN 117327067 A; TMZ, MG132, puromycin, chloroquine (CQ), cycloheximide (CHX), and rapamycin were all purchased from Selleck, Inc., USA; the CCK8 assay kit was purchased from Dongren Chemical Technology (Shanghai) Co., Ltd.; the universal mouse / rabbit polymer assay kit was purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.; mouse anti-rabbit IgG light chain secondary antibody and goat anti-rabbit IgG heavy chain secondary antibody were both purchased from China Yacoin Biotechnology Co., Ltd.
[0086] 2.3 Cell Culture
[0087] Cell culture system: TBD-0220 cells were expanded in vitro using a DMEM / F12 mixed medium (Gibco; 1:1 ratio) supplemented with 10% FBS. U87-MG, LN229, LN-18, and T98G cell lines were all cultured in DMEM basal medium (Gibco) containing 10% FBS. All cell lines were routinely maintained in a constant temperature incubator at 37°C with 5% CO2 saturated humidity.
[0088] 2.4 Lentiviral transfection
[0089] 1) First, conduct a transfection pre-experiment: Calculate the reinfection index according to the formula MOI = (number of virus particles) / (number of cells), and screen for the optimal MOI value that enables 80% of cells to be infected and the survival rate to be >90%.
[0090] 2) Formal transfection experiment: Target cells were seeded at a density of 2 × 10^5 cells / well in 6-well plates. When the confluence reached 30%, lentiviral suspension with an optimized MOI was added. 72 hours after transfection, the medium was replaced with selective medium containing 2 μg / mL puromycin, and positive cells were selected. Transfection efficiency was assessed by qPCR, Western blotting, or flow cytometry. Cells with the best transfection performance were selected for passage and subsequent experiments.
[0091] 3) The Cas9-sgRNA-Puro lentiviral vector targeting PTRF / Cavin1, the Cas9-sgRNA-Puro lentiviral vector targeting caveolin-1, the shRNA lentiviral vector targeting RBX1, the RBX1 overexpression lentiviral vector, and the control virus used in the experiment were purchased from Shanghai Jikai Gene Medical Technology Co., Ltd.
[0092] The knockdown and knockout lentiviral transfection sequences are as follows:
[0093] Table 1. Knockdown and knockout lentiviral transfection sequences
[0094] PTRF / Cavin1-sgRNA1 CCGCTCGACAATATAGAGCG NO.1 PTRF / Cavin1-sgRNA2 GTCAACGTGAAGACCGTGCG NO.2 PTRF / Cavin1-sgRNA3 GCACCAGCACGCCGTTCACC NO.3 caveolin-1-sgRNA1 AGTGTACGACGCGCACACCA NO.4 caveolin-1-sgRNA2 TAAACACCTCAACGATGACG NO.5 caveolin-1-sgRNA3 ATCTCTACACCGTTCCCATC NO.6 RBX1-shRNA1 CTGCATCTCTCGCTGGCTCAA NO.7 RBX1-shRNA2 ATGTCAAGCTAACCAGGCGTC NO.8 RBX1-shRNA3 GGGCAAGAAGCGCTTTGAAGT NO.9
[0095] 2.5 Plasmid and siRNA transfection
[0096] 1) Transfection experiments should begin when cell confluence reaches 70-90%. For specific transfection dosage, please refer to the corresponding instruction manual for standardized operation.
[0097] 2) Experimental Procedure:
[0098] ① Transfection complex preparation system (6-well plate): Prepare liposome working solution. In a separate centrifuge tube, add 125 μL of Opti-MEM and incorporate plasmid DNA or siRNA (concentration as per instructions). For plasmid transfection, additional P3000 enhancer is required. Vortex to mix, then mix with the liposome working solution at a 1:1 volume ratio. Incubate at room temperature for 15 min to form the nucleic acid-liposome complex.
[0099] ② Cell transfection procedure: The complex was uniformly added to the culture system. After 6 hours, the plasmid-transfected group was replaced with complete culture medium (containing 10% FBS) to reduce cytotoxicity. The transfected cells were then incubated at 37°C in a 5% CO2 incubator for 48 hours for subsequent functional verification.
[0100] 3) The HA-ubiquitin-wild, HA-ubiquitin-K6, HA-ubiquitin-K11, HA-ubiquitin-K27, HA-ubiquitin-K29, HA-ubiquitin-K33, HA-ubiquitin-K48, HA-ubiquitin-K63, HA-ubiquitin-K48R, HA-ubiquitin-K63R, and control plasmids used in the experiment were all purchased from Shanghai Jikai Gene Medical Technology Co., Ltd. ERK1-Flag and siCRBN were purchased from Shanghai Aibosi Biotechnology Co., Ltd., and their sequences are as follows:
[0101] Table 2 lists the siRNA targets and their sequences.
[0102]
[0103] 2.6 Total protein extraction and Western blotting
[0104] 1) Total Protein Extraction and Quantification: After washing the cells with cold PBS, transfer the culture dishes to ice. Prepare RIPA lysis buffer containing 1× protease inhibitor and 1 mM benzyl fluoride (PMSF). Add the lysis buffer at a ratio of 300 μL / 10 cm culture dish and lyse on ice for 30 min. Scrape the cells off with a cell scraper and transfer the mixture to a 1.5 mL centrifuge tube using a pipette. Sonicate the mixture on ice. Centrifuge at 12,000×g for 15 min at 4℃ and collect the supernatant for BCA quantification. Mix the protein supernatant and 5× loading buffer at a ratio of 4:1, then heat the mixture at 100℃ with shaking for 15 min. After cooling to room temperature, load the protein.
[0105] 2) BCA Quantitative Analysis: Constructing a Standard Curve: BSA was serially diluted (0-2000 μg / mL). The test sample was diluted 1:10 and reacted with BCA working solution at 37℃ for 30 min. The A562 value was detected using a microplate reader, and the protein concentration was calculated by fitting the standard curve using four parameters.
[0106] 3) SDS-PAGE electrophoresis system: Prepare a gradient separating gel (8-15%) according to the target protein molecular weight: Mix 30% acrylamide mixture, 1.5M Tris-HCl (pH 8.8), 10% AP, 10% SDS, and TEMED in a specific ratio. Pour the separating gel evenly along the inner wall of the glass plate using a Pasteur pipette. Use dd water for the liquid seal layer. Polymerize at room temperature for 20 min, confirming solidification. Discard the liquid seal layer, absorb residual liquid with filter paper, and then pour in a 5% stacking gel (containing 1.0M Tris-HCl, pH 6.8). Insert the comb and solidify at room temperature for 15 min. Prepare the electrophoresis buffer: Mix 6.06g TRIS powder, 28.8g glycine powder, 2g SDS powder, and 2L dd water until fully dissolved. Remove the comb, and then prepare the sample containing the loading buffer, heated and cooled to room temperature. Load 20μg total protein / well. Electrophoresis parameter settings: Concentration stage: 80V constant voltage (30min); Separation stage: 120V constant voltage (terminated when bromophenol blue migrates to 1cm below the colloid edge).
[0107] 4) Wet Electrotransfer Technology: Preparation of Transfer Solution: Mix 6.06g TRIS powder, 28.8g glycine powder, 400ml methanol, and 2L dd water until fully dissolved. Activate the marked 6cm × 8.5cm PVDF membrane with methanol. Spread the extracted gel evenly on filter paper, then cover the gel with the PVDF membrane, gently pushing with a glass rod to remove air bubbles between the membrane and gel. Insert the prepared sandwich clamp into the transfer clamp, pour in the transfer solution, place an ice pack, and double-check the electrode alignment. Transfer Conditions: Place the transfer tank in an ice box, connect the power supply, and maintain a constant voltage of 80V for 90 minutes.
[0108] 5) Immunoassay Procedure: Soak the PVDF membrane in 5% skim milk powder TBST solution and agitate at room temperature for 2 hours. Add the target antibody (optimized concentration according to instructions) and agitate at 4°C for 16 hours. Wash the membrane with TBST. Add the HRP-labeled secondary antibody (prepared concentration according to instructions) and agitate at room temperature for 1.5 hours. Wash the membrane with PBST at room temperature. Perform ECL chemiluminescence and detect the signal using a Protein Sample exposure instrument.
[0109] 2.7 RNA extraction and PCR
[0110] 1) RNA isolation and quality control: Aspirate the culture medium, wash the cells with PBS, and add 1 mL of TRIzol. -The reagents were lysed and then transferred to a 1.5 mL centrifuge tube, incubated at room temperature for 5 minutes. Phase separation: 200 μL of chloroform was added, vortexed, allowed to stand at room temperature, and then centrifuged. The aqueous phase was transferred to a new tube, an equal volume of isopropanol was added, the tube was inverted to mix, and then centrifuged. RNA purification: The precipitate was washed with 1 mL of 75% ethanol and centrifuged at 7,500 × g for 5 minutes. The supernatant was discarded, the precipitate was air-dried at room temperature for 5 minutes, and then dissolved in 30 μL of Nase-free water. Quantitative analysis: The A260 / A280 ratio was measured using NanoDrop (1.8-2.1 is acceptable).
[0111] 2) Reverse transcription reaction system: Prepare a 20 μL reaction system using a reverse transcription kit, as follows:
[0112] Table 3 Reverse Transcription Reaction System
[0113]
[0114]
[0115] Reaction procedure: 50℃ for 15 minutes → 85℃ for 5 seconds.
[0116] 3) Real-time quantitative PCR analysis: A 20 μL reaction system was constructed using a PCR kit, as follows:
[0117] Table 4 PCR System
[0118] cDNA template 2μL forward primer 0.5μL reverse primer 0.5μL 2×ChamQ Universal SYBR qPCR Master Mix 10μL Enzyme-free water 7μL
[0119] Amplification procedure:
[0120] Table 5. Setting the qPCR reaction program
[0121]
[0122] Data analysis: Three replicates were set up for each sample, with GAPDH as the internal reference. Gene expression levels were calculated using the 2^(-ΔΔCt) method.
[0123] qPCR primers used in the experiment:
[0124] Primers used for the target gene (Table 6)
[0125]
[0126]
[0127] 2.8 Co-immunoprecipitation (Co-IP)
[0128] Cell preparation: 3-5 10cm culture dishes per group, then aspirate the culture medium, wash with PBS, add NP40:PMSF = 100:1 according to cell volume, incubate on ice for 30 minutes, scrape cells and transfer to 1.5mL centrifuge tubes, sonicate on ice. Centrifuge at 12000×g for 15 minutes, retain 80μL for input, retain 5μL for BCA protein concentration measurement, and pre-clean the remaining supernatant (add 20μL magnetic beads to the remaining supernatant, incubate at 4℃ on a shaking invert for 30 minutes, then discard the magnetic beads and keep the supernatant). Take 1mg of total protein from the pre-cleaned supernatant, add 5μL of antibody, add the corresponding mouse or rabbit primary antibody to the IgG group, and then place on a shaking invert (25 rpm, 4℃ overnight). Add 20μL magnetic beads to each sample tube, place on a shaking invert at 4℃, and mix for 2 hours. After thoroughly mixing, place the sample on a magnetic rack, discard the supernatant, and retain the precipitate. Wash the magnetic beads four times with a PBST+PMFS (100:1) mixture, 1 mL each time. Add 30 μL of 2.5× loading buffer to the washed magnetic beads, heat at 100 °C for 10 minutes, place on a magnetic rack, and separate the magnetic beads. Then, load 15 μL of supernatant into each well, and load 20 μg of total protein into the Input group.
[0129] 2.9 Cell proliferation inhibition assay
[0130] 1) Cell seeding: The exponential growth phase cell suspension was seeded at a density of 5 × 10^3 cells / well in 96-well plates, with a final volume of 100 μL of complete medium containing 10% FBS per well. The cells were pre-cultured at 37°C and 5% CO2 for 24 hours, and microscopic examination confirmed an adhesion rate >95%.
[0131] 2) Drug treatment: Serially dilute the test compound, adding 100 μL of drug-containing culture medium to each well. Three control groups were established: Experimental group (As):
[0132] Contains cells + compound; Negative control group (Ac): contains cells; Background correction group (Ab): cell-free culture medium.
[0133] 3) Detection procedure: After 48 hours of drug treatment, CCK-8 and culture medium were mixed at a ratio of 1:10. The original culture medium was removed, and 100 μL of the mixture was added to each well. After culturing for another 2 hours, the optical density value at 450 nm of each well was measured using a multi-mode microplate reader.
[0134] 4) Calculation
[0135] ① Cell viability: [(OD As –OD Ab ) / (OD Ac –OD Ab)]×100%;
[0136] ② Cell inhibition rate: [1-(OD As –OD Ab ) / (OD Ac –OD Ab )]×100%.
[0137] 2.10 Immunofluorescence (IF)
[0138] 1) Sample preparation: Cell slides: Place sterile 14mm round slides into a 12-well plate, and then spread cells at a rate of 5×10^4 / cm. 2 Inoculate at high density onto discs and incubate for 24 hours. Drug treatment: After adhesion, replace with culture medium containing the appropriate concentration of the compound, and treat for 48 hours.
[0139] 2) Fixation and permeabilization: Remove the culture medium and gently wash three times with PBS; add 4% paraformaldehyde and fix at room temperature for 15 minutes; remove the paraformaldehyde and wash the cells three times with pre-cooled PBS. Add 0.2% Triton X-100 / PBS solution and incubate at room temperature for 10 minutes; remove the Triton X-100 / PBS solution and wash the cells three times on a shaker with PBS.
[0140] 3) Immunolabeling: Blocking: Treat with 10% BSA / PBS blocking buffer at room temperature for 1 hour. Dilute the anti-target protein antibody according to the instructions, aspirate the blocking buffer, add the primary antibody, and incubate overnight in a humidified chamber at 4°C. Incubate the wells at room temperature for 10 minutes, remove the primary antibody, and wash the cells 3 times with PBS on a shaker. Add the mixture of secondary antibody diluted in PBS and phalloidin to the wells and incubate at room temperature in the dark for 1 hour.
[0141] 4) Image acquisition: After secondary antibody incubation and washing cells three times with pre-cooled PBS, the cells were mounted with mounting medium containing DAPI and cured at 4°C in the dark for 24 hours. Confocal microscopy was then performed.
[0142] 2.11 Immunohistochemistry (IHC)
[0143] 1) Sample pretreatment: Paraffin sections of mouse brain tissue were dried at 65°C for 1 hour before being used for gradient dewaxing and rehydration.
[0144] 2) Antigen retrieval and blocking: Prepare sodium citrate buffer (10mM, pH 6.0), completely immerse the paraffin sections in the retrieval solution, and perform microwave thermal retrieval (800W, 4×5 minutes cycles), then cool to room temperature. Wash with PBS. Block with endogenous peroxidase, treat at room temperature for 10 minutes, then wash with PBS.
[0145] 3) Immunolabeling procedure: Dilute the antibody with antibody diluent according to the instructions and incubate overnight in a humidified chamber at 4°C. Incubate at room temperature for 15 minutes, wash with PBS, then add HRP-labeled secondary antibody and incubate at 37°C for 30 minutes. Add 1 drop of concentrated DAB to 1 mL of substrate solution to prepare the chromogenic solution (prepare fresh before use). Incubate for 5 minutes, monitoring under a microscope in real time. Rinse with tap water afterwards.
[0146] 4) Counterstaining and mounting: Counterstain with hematoxylin for 2 minutes, rinse with tap water → differentiate with 0.5% hydrochloric acid alcohol for 1 second → reverse blue with 1% ammonia water, and observe the staining effect under a microscope. Gradient ethanol dehydration (50%, 75%, 85%, and 95% for 7 minutes each) → anhydrous ethanol II treatment (7-15 minutes) → anhydrous ethanol I (7-15 minutes) → xylene II (20 minutes) → xylene III (15 minutes) → mount with neutral resin and air dry at room temperature. Microscopic photography.
[0147] 2.12 H&E staining
[0148] 1) Sample pretreatment: Baking slides: Same as 1.12 immunohistochemistry. Gradient dewaxing and rehydration: Same as 1.12 immunohistochemistry.
[0149] 2) Staining procedure: Hematoxylin staining: Routine staining: hematoxylin 4 minutes; Deep staining: hematoxylin 12 minutes. Differentiation control: 0.5% hydrochloric acid ethanol (1 second) → running water bluening (5 minutes). Eosin staining: 0.5% eosin (containing 0.1% glacial acetic acid) 15 minutes.
[0150] 3) Mounting: The dehydration, clearing and mounting procedures are the same as in 1.12 immunohistochemistry.
[0151] 2.13 Construction of an in situ intracranial GBM model
[0152] 1) Cell construction: A stable luciferase expression line was established by transfecting TBD-0220 cells with luciferase lentivirus. Screening conditions: After continuous screening with 2 μg / mL puromycin for 14 days, normal passage was performed.
[0153] 2) Cell transplantation surgery: Cell preparation: After trypsin digestion of cells, centrifugation was performed to obtain cell pellet. Cells were then washed twice with sterile PBS, resuspended in PBS, and counted. Animal preparation: 4-week-old female BALB / c nude mice (SPF grade). Stereotactic parameters (Stoelting 51700): Anterior fontanelle coordinates: AP-2.0mm, ML±2.0mm, DV-3.0mm. Cell injection volume: 1×10^5 cells / 3μL PBS (cell viability >95%). The mice were observed after injection.
[0154] 3) Bioluminescence imaging: Imaging and MRI time windows: 7 / 14 / 21 days post-transplantation. Substrate injection: D-fluorescein (150 mg / kg, intraperitoneal injection).
[0155] 4) Treatment Intervention and Endpoint Analysis: Group Design: After the initial imaging, mice were randomly assigned to groups using a stratified randomization method and administered medication via gavage. Survival Analysis: Mice survival time was recorded, and the median survival was calculated using the Kaplan-Meier method. Histopathology: At the experimental endpoint, mice were humanely euthanized, and brain tissue was extracted for subsequent immunohistochemistry, H&E staining, and drug concentration determination.
[0156] 2.14 Independent Data Acquisition (DIA) Proteomics
[0157] 1) Cell preparation, protein extraction, and enzymatic digestion: Cells from both the control and treatment groups were digested with trypsin, centrifuged to obtain cell pellets, washed with sterile PBS, and centrifuged again to remove as much sterile PBS as possible. The cell pellets were then flash-frozen in liquid nitrogen for 5 minutes and stored at -80°C. After adding 8M urea lysis buffer (containing 1× protease inhibitor), the cells were sonicated (30% amplitude, 5-second pulse, total duration 2 minutes). Reductive alkylation: 5mM DTT (56°C, 30 minutes) → 15mM iodoacetamide (room temperature, protected from light for 30 minutes). Trypsin digestion: Trypsin Gold was used with a 1:50 enzyme-to-protein ratio, incubated at 37°C for 16 hours. Digestion termination: Digestion was terminated by acidification with 0.1% formic acid.
[0158] 2) Peptide purification: Desalting was performed using a StageTip C18 column. The concentrate was then concentrated to 0.5 μg / μL by vacuum centrifugation.
[0159] 3) Chromatographic conditions: Column: Thermo Accucore 150C18 (2.1mm × 150mm, 2.6μm). Mobile phase: Phase A: 0.1% formic acid aqueous solution; Phase B: 0.1% formic acid acetonitrile solution. Gradient program: 0-5 min: 3% B → 5-105 min: 3-35% B → 105-115 min: 35-80% B → 115–120 min: 80% B. Flow rate: 300 nL / min, column temperature: 45℃.
[0160] 4) DIA mass spectrometry acquisition: Scan mode: Full scan (MS1): Resolution 120,000 (m / z 200), scan range 350-1500 m / z; DIA window: 24 variable windows (window design based on sample library); MS2 resolution: 30,000, HCD fragmentation energy 28%. Dynamic exclusion: 30s.
[0161] 5) Library Construction: The Uniprot database was searched using MaxQuant (v2.2.0) with DDA data (same batch of samples). Search parameters: precursor mass tolerance: 10 ppm; fragment ion tolerance: 0.02 Da; modifications: methionine oxidation (dynamic), cysteine alkylation (static).
[0162] 6) DIA Data Analysis: Software Platform: Spectronaut 17. Key Parameters: Quantification Strategy: MS2-LevelTop3; Cross-batch Correction: iRT Normalization; FDR Control: 1% (peptide and protein levels).
[0163] 7) Bioinformatics analysis: Differential protein screening: Threshold: |log2(Fold Change)|>0.585, p<0.05 (t-test + Benjamini correction), and volcano plots and heatmaps were generated. Functional enrichment: KEGG / GO analysis was performed using Metascape (q<0.05); a PPI network was constructed using the STRING database.
[0164] 2.15 Seahorse Glycolytic Stress Experiment Procedure
[0165] 1) Cell Preparation: Culture cells normally until they are in good condition, then digest and count them. Take an appropriate number of cells and dilute them with culture medium to a suitable concentration: based on experience, 15,000 TBD-0220 cells per well (15,000 cells per 100 μL). Open the Seahorse cell plate, label it, as the plate has 24 wells, but 4 blank wells are needed for the experiment. Add 100 μL of cell suspension to each well and incubate on the cell culture tray for 1 hour. After 1 hour, add 150 μL of culture medium to each well (250 μL for blank wells), making the final volume of each well 250 μL, and place it in an incubator. Once the cells have adhered, drug treatment can be performed.
[0166] 2) Probe plate preparation: One day before the test, remove the probe plate, add 1 mL of hydration solution to each air pocket, and place it in an incubator at 37°C without CO2 overnight.
[0167] 3) Preparation of test solution: Weigh 14.625 mg of glutamine into two 50 mL centrifuge tubes. Add 50 mL of Seahorse XF test medium to each tube to prepare 2 mM glutamine. Mix well and incubate overnight in a cell culture incubator.
[0168] 4) Drug dissolution and instrument loading: Take out one packet of the reagent kit, which contains one vial each of glucose, oligomycin, and 2-DG. Open the package with the drug opener, add the test solution according to the table below, and mix well.
[0169] Table 7 Preparation of Drug Storage Solution
[0170] Glucose 3mL 100mM Oligomycin 720μL 100μM 2-DG 3mL 500mM
[0171] Dilute oligomycin to the working concentration: Take 400 μL of oligomycin and add it to 3.6 mL of test solution, mix well; the other two drugs do not need to be diluted. After loading the probe plate, cell plate, test solution, drugs, and 1 mL and 100 μL pipettes and sterile tips, proceed to the instrument. Place the probe plate, cell plate, test solution, and drugs in a 37°C CO2-free incubator for later use. Remove the cells, remove the culture medium, and wash the cells with 500 μL of test solution. Discard the wash medium, add 500 μL of test solution to each well, and incubate at 37°C CO2-free for 45 minutes to equilibrate. Open the software program and set the experimental parameters. When there are 30-40 minutes remaining until equilibration, remove the probe plate and add the drugs according to the table below:
[0172] Table 8. Schematic diagram of added drugs
[0173] C D
[0174] In this configuration, well A contains 56 μL of glucose; well B contains 62 μL of oligomycin; well C contains 69 μL of 2-DG; and well D is a blank well.
[0175] Remove the pink partition in the middle of the probe plate, place the probe plate with added drugs onto the instrument tray (remove the cap), and click "run" to calibrate, which takes approximately 20 minutes. After calibration, the hydration plate will pop out. Remove the cell plate and replace it (remove the cap), then click "start" to begin the assay, which takes approximately 2 hours.
[0176] 5) Data Processing: Quantitative analysis of each well sample in the culture plate was performed using cell counting or protein concentration determination for data normalization. Experimental results were analyzed and plotted using the professional software Seahorse Wave.
[0177] 2.16 Seahorse Mitochondrial Stress Experiment:
[0178] 1) Cell preparation: Same as 1.16 Seahorse glycolysis stress experiment.
[0179] 2) Probe plate preparation: Same as 1.16 Seahorse glycolysis stress experiment.
[0180] 3) Preparation of test solution: Prepare two 50mL tubes, weigh 14.625mg of glutamine into each 50mL centrifuge tube; add 200μL of glucose (stock solution concentration of 450g / L) and 500μL of pyruvate (stock solution concentration of 100mM) to each tube, and bring the volume to 50mL with Seahorse XF test medium to prepare the working solution concentration: glucose 10mM, pyruvate 1mM, glutamine 2mM. Mix well and incubate overnight in a cell culture incubator for later use.
[0181] 4) Drug Dissolution and Instrumentation: Take out one kit packet containing one vial each of oligomycin, FCCP, and rotenone / antimycin A. Use the decapping tool to open the package, add the detection solution according to the table below, and mix well:
[0182] Table 9 Preparation of Drug Storage Solution
[0183] Oligomycin 630 100 FCCP 720 100 Rotenone / Antimycin A Rot / AA 540 50
[0184] Dilute the drug to the working solution concentration:
[0185] Oligomycin: Take 600 μL and add it to 2.4 mL of test solution;
[0186] FCCP: Take 650 μL and add 2.6 mL of detection solution;
[0187] Rot / AA: Take 400 μL and add 3.6 mL of detection solution.
[0188] Prepare experimental equipment: Same as in the 1.16 Seahorse glycolysis stress experiment. Place the probe plate, cell plate, test solution, and drugs in a 37°C CO2-free incubator. Remove the cells, aspirate the culture medium, and add 500 μL of test solution to wash the cells. Discard the test solution, add 500 μL of test solution to each well, and incubate at 37°C CO2-free for 45 minutes to equilibrate. Open the instrument software and set the program. 40 minutes after equilibration, remove the probe plate and add drugs according to the table below:
[0189] Table 10: Schematic diagram of added drugs
[0190] C D
[0191] For well A: add 56 μL oligomycin; for well B: add 62 μL FCCP; for well C: add 69 μL Rot / AA.
[0192] Remove the pink partition in the middle, place the probe plate with added medicine onto the instrument tray (remove the cap), and click "run" to calibrate, which takes approximately 20 minutes. After calibration, the hydration plate will be ejected by the machine. Remove the cell plate and replace it (remove the cap), then click "start" to begin the detection program, which takes approximately 2 hours.
[0193] 5) Data processing: Same as 1.16 Seahorse glycolysis stress experiment.
[0194] 2.17 Data Statistics and Analysis
[0195] 1) Analysis platform: Main statistical tool: GraphPad Prism 8.4 (GraphPad Software).
[0196] 2) Hypothesis testing methods: Two-group comparison: Two-tailed Student's t-test (for normally distributed data). Multiple-group comparison: Analysis of variance (ANOVA).
[0197] 3) Synergy effect assessment: The SynergyFinder 2.0 platform uses the Bliss independent model to calculate the synergy index (SI).
[0198] 4) Graphical Specifications: Error Bar Definition: Mean ± Standard Deviation (sd), ≥3 independent biological replicates. Significance Markers: P < 0.05 indicates statistical significance, ns indicates no statistical significance, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, **** indicates p < 0.0001.
[0199] III. Results
[0200] 3.1 PROTAC-EPIC-0726 can effectively degrade PTRF / Cavin1 in GBM cells.
[0201] To verify the targeting ability of EPIC-0726, GBM cells, pancreatic cancer cell line PANC-1, liver cancer cell line HepG2, lung cancer cell line A459, and breast cancer cell line MDA-MB-231 were treated with different concentration gradients of EPIC-0726 for 48 hours. Western blotting was used to detect changes in PTRF / Cavin1 protein levels, and PCR was used to detect PTRF / Cavin1 mRNA levels. The results showed that EPIC-0726 efficiently degraded PTRF / Cavin1 in GBM cells at different concentration gradients, without affecting PTRF / Cavin1 mRNA levels. Figure 1 A, C). Its half-maximal degradation concentration (DC) in U87-MG and TBD-0220. 50 The concentrations were 5.12 μM and 8.12 μM, respectively; the maximum degradation amount (D) max The percentages were 90.07% (EPIC-0726 15μM) and 85.37% (EPIC-0726 15μM). Figure 1 B). By Figure 2A and 2B demonstrate that EPIC-0726 has broad applicability, efficiently degrading PTRF / Cavin1 in GBM, PANC-1, HepG2, A459, and MDA-MB-231 cells. Further analysis of PTRF / Cavin1 protein expression levels in these cell lines revealed a correlation between PTRF / Cavin1 protein levels and DC expression levels in different cell lines. 50 There is a linear correlation, that is, the higher the PTRF / Cavin1 content, the higher the DC content. 50 The larger ( Figure 1 D,1E).
[0202] 3.2 EPIC-0726 degradation of PTRF / Cavin1 depends on specific binding of the ligand and receptor, and UPS.
[0203] To verify that EPIC-0726's degradation of PTRF / Cavin1 depends on specific binding of the ligand and receptor and the ubiquitin-proteasome system (UPS), Western blotting was used to detect the effects of different concentration gradients of EPIC-1042 on the protein levels of PTRF / Cavin1 and caveolin-1 (CAV1) in GBM cells after 48 hours. The Western blotting results showed that EPIC-1042 had no effect on either PTRF / Cavin1 or CAV1 protein levels, indicating that EPIC-1042 cannot degrade PTRF / Cavin1 and CAV1. Figure 2 A).
[0204] Then, GBM cells were treated with DMSO, 20 μM EPIC-1042, and EPIC-0726 alone or in combination for 48 hours. Changes in intracellular PTRF / Cavin1 were then detected. Western blotting showed that co-treatment of GBM cells with EPIC-1042 and EPIC-0726 weakened PTRF / Cavin1 degradation compared to the EPIC-0726 monotherapy group, indicating that EPIC-1042 could inhibit EPIC-0726-induced degradation. Figure 2 B).
[0205] Next, GBM cells were treated with lenalidomide (a CRBN ligand) and EPIC-0726, alone or in combination, for 48 hours. Changes in intracellular PTRF / Cavin1 levels were then detected. Western blotting results showed that lenalidomide did not affect PTRF / Cavin1 protein levels; however, compared to the EPIC-0726 monotherapy group, the degradation of PTRF / Cavin1 was inhibited in the combined treatment group. This indicates that PTRF / Cavin1 is not degraded via CRBN via UPS, and that lenalidomide can inhibit the ability of EPIC-0726 to induce PTRF / Cavin1 degradation. Figure 2 C).
[0206] Furthermore, CRBN was knocked down in GBM cells using small interfering RNA. Western blotting results showed that EPIC-0726 had no significant effect on PTRF / Cavin1 protein levels in CRBN-KD cells. Figure 2 The results (D, 2E) indicate that EPIC-0726-induced PTRF / Cavin1 degradation is CRBN-dependent.
[0207] Finally, after inhibiting UPS with MG132, the Western blot results showed that the inhibition of UPS eliminated the EPIC-0726-induced degradation of PTRF / Cavin1, further demonstrating that EPIC-0726-mediated PTRF / Cavin1 degradation is dependent on UPS. Figure 2 F).
[0208] 2.3 Verification of the inhibitory effect of EPIC-0726 on GBM cell proliferation
[0209] To verify the inhibitory effect of EPIC-0726 on GBM cell proliferation, GBM cells were treated with EPIC-0726 and EPIC-1042, respectively. The proliferation assay results showed that EPIC-0726 (U87-MG, IC50) inhibited GBM cell proliferation. 50 =8.95μM; TBD-0220, IC 50 =12.40μM) has an inhibitory effect on GBM cell proliferation that is approximately equal to that of EPIC-1042 (U87-MG, IC50). 50 =25.26μM; TBD-0220, IC 50 =38.00μM) 3 times ( Figure 3 A). Treatment of GBM cells with EPIC-0726 and Lenalidomide, alone or in combination, showed that the effect of EPIC-0726 on GBM cell proliferation also depended on its PROTAC activity. This is because Lenalidomide had weak cytotoxicity against GBM cells and did not synergistically inhibit GBM cell proliferation with EPIC-0726, even weakening the cytotoxic effect of EPIC-0726. Figure 3 B). The above results indicate that the inhibition of GBM cell proliferation by EPIC-0726 depends on EPIC-0726-mediated degradation of PTRF / Cavin1.
[0210] Furthermore, after treating GBM cells with a specified concentration of EPIC-0726 for 48 hours, Western blotting was used to detect changes in intracellular caveolin-1 levels. The results showed that EPIC-0726 reduced CAV1 protein levels in a concentration gradient-dependent manner, while EPIC-1042 had no effect on CAV1 protein levels, indicating that EPIC-0726 was more pharmacodynamically effective than EPIC-1042. Figure 3 C).
[0211] 2.4 EPIC-0726 in vivo treatment efficacy for GBM
[0212] To verify the efficacy of EPIC-0726 in vivo for treating GBM, an in situ GBM model was established in nude mice using TBD-0220. Tumor-bearing nude mice were treated by gavage with DMSO, EPIC-0726 (15 mg / kg), and EPIC-0726 (30 mg / kg) for 2 weeks. EPIC-0726 was administered daily. Each group had n = 8 mice. Figure 4 A) The inhibitory effects of different doses of EPIC-0726 on GBM in vivo were examined. Bioluminescence and overall survival (OS) results showed that, compared with the DMSO treatment group, low-dose EPIC-0726 (15 mg / kg) inhibited tumor growth, reduced tumor burden, and prolonged survival in nude mice, while high-dose EPIC-0726 (30 mg / kg) further inhibited GBM proliferation and further increased overall survival benefit. Figure 4 BD).
[0213] Furthermore, Ki-67 staining showed that the high-dose EPIC-0726 treatment group had the weakest cell proliferation capacity; simultaneously, PTRF / Cavin1 IHC staining results in tumor tissue showed that EPIC-0726 reduced PTRF / Cavin1 levels in tissues in a concentration gradient manner. Figure 4 E).
[0214] Next, the dosing time for different doses was extended to four weeks to further investigate the antitumor effect of EPIC-0726 under long-term dosing. Tumor-bearing nude mice were treated with DMSO, EPIC-0726 (15 mg / kg), and EPIC-0726 (30 mg / kg) by gavage for 4 weeks. EPIC-0726 was administered daily, with n = 8 mice per group. Figure 5 A). Bioluminescence and nude mouse survival results showed that EPIC-0726, under long-term dosing conditions, could reduce tumor burden and prolong the survival of nude mice in a concentration gradient manner. Figure 5 BD). Ki-67 staining further supports this conclusion. Figure 5 E).
[0215] Median survival statistics revealed that, at the same dosage of EPIC-0726, a 4-week dosing period further increased overall survival (OS) benefit compared to a 2-week dosing cycle. Figure 6 A). Furthermore, given similar median survival in the DMSO treatment groups, EPIC-1042 did not improve overall survival (OS) in nude mice, while EPIC-0726 effectively prolonged survival, with further increases in dosage and duration of administration. Additionally, because the molecular weight of EPIC-0726 is larger than that of EPIC-1042, at the same dosage (15 mg / kg), the amount of substance in EPIC-0726 is lower than that in EPIC-1042. Figure 6 (BC). The above results indicate that EPIC-0726 can effectively inhibit the proliferation of GBM in vivo, and its therapeutic effect is superior to that of EPIC-1042.
[0216] 2.5 EPIC-0726 promotes RBX1 degradation
[0217] The level of RBX1 protein in GBM cells was detected by Western blotting. First, GBM cells were treated with different concentrations of EPIC-0726 for 48 hours. Then, changes in intracellular RBX1 levels were detected by Western blotting. The results showed that EPIC-0726 could reduce RBX1 levels in a dose-dependent manner. Figure 7 A). After treating U87-MG cells with DMSO or 7.5 μM EPIC-0726 for 48 hours and TBD-0220 cells with DMSO or 10 μM EPIC-0726 for 48 hours, changes in intracellular RBX1 mRNA were detected by PCR. The results showed that EPIC-0726 had no effect on RBX1 mRNA levels. Figure 7 B) indicates that EPIC-0726 induced the degradation of RBX1 protein.
[0218] 2.6PTRF / Cavin1 binds to RBX1 and inhibits RBX1 ubiquitination.
[0219] To investigate the mechanism by which PTRF / Cavin1 regulates RBX1, PTRF / Cavin1 was knocked out in the GBM cell line using CRISPR-Cas9. Figure 8 A) Western blot (WB) and qPCR results showed that PTRF / Cavin1 knockout affected RBX1 protein levels but had no effect on RBX1 mRNA levels, indicating that PTRF / Cavin1 can regulate RBX1 degradation. Figure 8 B, C).
[0220] Next, Ctrl-KO and PTRF / Cavin1-KO cells were treated with CHX, CQ, or MG132 to further investigate the RBX1 degradation mechanism. Western blot results showed that regardless of the presence or absence of PTRF / Cavin1, RBX1 was significantly degraded in the CHX-treated group alone, and this process could only be reversed by the proteasome inhibitor MG132. This indicates that RBX1 degradation occurs only through the ubiquitin-proteasome pathway, and not through the autophagy-lysosome pathway. Figure 8 Furthermore, Co-IP results showed that PTRF / Cavin1 knockout promoted RBX1 ubiquitination (DE). Figure 8 F). To further demonstrate that PTRF / Cavin1 directly binds to RBX1, a cross-IP experiment was performed in TBD-0220 cells. Figure 8 G). The IP products were incubated with either anti-PTRF / Cavin1 antibody or anti-RBX1 antibody, and then cross-blotted with either anti-RBX1 antibody or anti-PTRF / Cavin1 antibody. Co-IP results using anti-PTRF / Cavin1 antibody showed that it bound not only PTRF / Cavin1 but also RBX1. Similarly, Co-IP results using anti-RBX1 antibody showed that it bound not only RBX1 but also PTRF / Cavin1. Furthermore, knocking down RBX1 with shRNA revealed that RBX1 KD did not affect the protein level of PTRF / Cavin1, indicating that the PTRF / Cavin1-RBX1 interaction did not mediate the degradation of PTRF / Cavin1. Figure 8 In summary, these data indicate that RBX1 is primarily degraded via the UPS pathway rather than the lysosomal pathway. RBX1 is stabilized through interaction with PTRF / Cavin1, thus reducing its ubiquitination level. Conversely, the depletion of PTRF / Cavin1 leads to increased UPS degradation of RBX1. Notably, EPIC-0726 did not alter the degradation pathway of RBX1. Figure 8 Therefore, EPIC-0726 reduces the stability of RBX1 by promoting the degradation of PTRF / Cavin1, thereby increasing the degradation of RBX1 by UPS.
[0221] 2.7 EPIC-0726 inhibits ERK1 / 2K63 ubiquitin chain modification and activation by downregulating RBX1.
[0222] To verify whether EPIC-0726 affects ERK1 / 2 and thus inhibits GBM, Western blotting results first showed that EPIC-0726 had no significant effect on ERK1 / 2 protein levels, but it could reduce p-ERK1 / 2 in a concentration-dependent manner, indicating that EPIC-0726 inhibits ERK1 / 2 activation. Figure 9 A). Next, RBX1 was knocked down in GBM cells, and its effect on ERK1 / 2 activation was examined. Western blotting results showed that RBX1 KD decreased p-ERK1 / 2, but had no effect on MEK1 / 2 and p-MEK1 / 2. Figure 9 BC). The above results indicate that RBX1 promotes ERK1 / 2 activation independently of the upstream kinase MEK1 / 2; EPIC-0726 inhibits ERK1 / 2 activation by promoting RBX1 degradation. To further confirm that EPIC-0726 regulates ERK1 / 2 activation through RBX1, Ctrl–KD and RBX1–KD cells were treated with DMSO or EPIC-0726 for 48 hours. Western blot results showed that both EPIC-0726 and RBX1–KD reduced p-ERK1 / 2 levels, and in RBX1–KD cells, EPIC-0726 did not further reduce p-ERK1 / 2 levels compared to the DMSO group. Figure 9 D). Co-IP results showed that EPIC-0726 and RBX1 KD not only inhibited the overall ubiquitination level of ERK1 / 2, but also inhibited the K63 ubiquitin chain modification level; in RBX1-KD cells, compared with the DMSO group, EPIC-0726 did not further reduce the overall ubiquitination level of ERK1 / 2 and the degree of K63 ubiquitin chain modification. Figure 9 (EF). In summary, the results indicate that EPIC-0726 inhibits ERK1 / 2 activation by downregulating RBX1 to suppress ERK1 / 2 K63 ubiquitin chain modification.
[0223] 2.8 Effects of EPIC-0726 on glycolysis and oxidative phosphorylation in GBM cells
[0224] GBM cells were treated with EPIC-0726 under hypoxic conditions for 48 hours. Western blot results showed that EPIC-0726 downregulated p-PGK1(S203) levels in a concentration-dependent manner, while having no effect on PGK1 levels. Figure 10 A). Glycolytic stress and mitochondrial stress assays were used to further test the effects of EPIC-0726 on glycolysis and oxidative phosphorylation processes in GBM cells, and these two processes were evaluated by detecting the oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of GBM cells after 48 hours of EPIC-0726 treatment. Figure 10(BC). The results showed that under the action of EPIC-0726, the glycolytic capacity and glycolytic ability of TBD-0220 decreased, while pyruvate metabolism was enhanced, thereby increasing the production of reactive oxygen species. Both factors jointly inhibited the proliferation of tumor cells. The above study indicates that EPIC-0726 promotes pyruvate metabolism and inhibits glycolysis by inhibiting the activation of ERK1 / 2, inhibiting the phosphorylation of PGK1 S203 and mitochondrial translocation.
[0225] 2.9 EPIC-0726 inhibits AKT K63 ubiquitin chain modification and activation, as well as p21 K48 ubiquitin chain modification and degradation by downregulating RBX1.
[0226] To verify that EPIC-0726 inhibits SCF function by downregulating RBX1, thereby suppressing AKT activation and p21 degradation, Western blotting results showed that EPIC-0726 could reduce p-AKT in a concentration-dependent manner without affecting AKT levels; and simultaneously, it could increase p21 levels in a concentration gradient. Figure 11 A). Further immunoprecipitation results showed that EPIC-0726 not only reduced the total ubiquitination levels of AKT and p21, but also specifically reduced AKT K63 ubiquitin chain modification and p21 K48 ubiquitin chain modification. Figure 11 BE).
[0227] 2.10EPIC-0726 enhances TMZ treatment efficacy by regulating the DNA damage repair axis via RBX1-p21-Rb.
[0228] p21 can block the activity of the Cyclin-CDK complex and the phosphorylation level of Rb, thereby promoting the formation of the Rb-E2F1 complex and inhibiting the transcriptional activity of E2F1. To verify whether EPIC-0726 has this effect, GBM cells were treated with different concentration gradients of EPIC-0726 for 48 hours, and the protein levels of Rb and p-Rb were detected by Western blotting. The Western blotting results showed that EPIC-0726 could reduce p-Rb levels in a concentration-dependent manner, but had no effect on Rb protein levels. Figure 12 A). E2F1 can transcribe proteins related to the DNA damage repair pathway, so the effect of EPIC-0726 on proteins related to the DDR pathway was investigated. PCR results showed that EPIC-0726 could downregulate the mRNA levels of Rad50, Rad51, CHK1, CHK2, and MRE11. Figure 12 B), WB also reached the same conclusion ( Figure 12 C).
[0229] 2.11 EPIC-0726 can enhance the efficacy of TMZ against GBM.
[0230] To further demonstrate that EPIC-0726 can enhance the efficacy of TMZ against GBM, DMSO, EPIC-0726, TMZ, and EPIC-0726+TMZ were used to treat GBM cells for 48 hours. Western blot results showed that after TMZ treatment, DDR proteins RAD50, RAD51, CHK1, CHK2, and MRE11 were upregulated in both GBM cell lines; the DNA damage marker γ-H2AX also increased accordingly. However, compared to the TMZ monotherapy group, in the combination therapy group, DDR protein levels were decreased, but γ-H2AX was further increased. Figure 12 C), and the subsequent IF further proved this result ( Figure 12 D). Furthermore, the dose-response matrix results also verified the synergistic effect of TMZ and EPIC-0726 in tumor suppression; compared to the single-drug group, the combined treatment with the two drugs significantly inhibited GBM proliferation. Figure 13 AB).
[0231] 2.12 EPIC-0726 Sensitizing TMZ In Vivo Therapeutic Effect
[0232] A glioma orthotopic intracranial model was established by orthotopic injection of TBD-0220 cells into the hippocampus of nude mice. DMSO, EPIC-0726, and TMZ were administered via gavage. Bioluminescence analysis showed that although both EPIC-0726 and TMZ alone inhibited tumor growth compared to DMSO, TMZ showed a superior tumor-suppressing effect compared to EPIC-0726. Furthermore, the combination of EPIC-0726 and TMZ resulted in the highest reduction in tumor burden among the four treatment groups. Figure 14 AB). Furthermore, the survival curves showed the same results: the combination therapy group had the highest overall survival (OS) benefit compared to the single-drug therapy group. Figure 14 C). Analysis of median survival revealed that in animal studies using EPIC-1042 or EPIC-0726 sensitizing TMZ, with similar median survival in the DMSO and TMZ treatment groups, the same dose of EPIC-0726 sensitizing TMZ was more effective than EPIC-1042. Figure 14 D). In summary, the results indicate that EPIC-0726 can enhance the therapeutic effect of TMZ on GBM in vivo, and its efficacy is superior to that of EPIC-1042.
[0233] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.
Claims
1. A PROTAC compound, characterized in that, The PROTAC compound has the structure shown in Formula I: Formula I; The Linker is a connector, which can be selected from any of the following structures: (1) ;(2) ;(3) ; (4) ;(5) 。 2. The PROTAC compound according to claim 1, characterized in that, The PROTAC compound has the structure shown in Formula II: Formula II.
3. The method for preparing the PROTAC compound according to claim 2, characterized in that, The preparation method includes the following steps: 1) Reacting compound 11 and compound 12 yields intermediate compound 13; 2) Compound 13 was reacted with a base to give intermediate compound 14; 3) Compound 14 and Compound 15 are mixed and undergo an amide condensation reaction to obtain intermediate compound 16; under acidic conditions, compound 16 undergoes an amino protecting group removal reaction to obtain the target product, namely PROTAC compound EPIC-0726.
4. The preparation method according to claim 3, characterized in that, Step 1) includes one or more of the following features: 11) The molar ratio of compound 11 to compound 12 is 1:(1.2~1.8). 12) React Cs₂CO₃ with compounds 11 and 12; 13) The reaction time is 10-15 hours; 14) The reaction temperature is 25~80℃; 15) The solvent used in the reaction is an organic solvent.
5. The preparation method according to claim 4, characterized in that, In feature 12), the molar ratio of compound 11, compound 12 and Cs2CO3 is 1:(1.2~1.8):(1.5~2.5).
6. The preparation method according to claim 4, characterized in that, In feature 15), the organic solvent is MeCN.
7. The preparation method according to claim 3, characterized in that, Step 2) includes one or more of the following features: 21) The molar ratio of compound 13 to the base is 1:(2~4); 22) The solvent for the reaction is an aqueous methanol solution; 23) The reaction time is 10-15 hours; 24) The reaction temperature is 25~30℃.
8. The preparation method according to claim 7, characterized in that, In feature 22), the volume fraction of the methanol aqueous solution is 60-75%.
9. The preparation method according to claim 3, characterized in that, Step 3) includes one or more of the following features: 31) The molar ratio of compound 14 to compound 15 is 1:(2~3); 32) The condensing agents for the amide condensation reaction are TCFH and NMI; 33) The solvent for amide condensation reaction is an organic solvent; 34) The amide condensation reaction takes 10-15 hours; 35) The temperature of the amide condensation reaction is 20~30℃; 36) The acidic environment for the amino protecting group removal reaction is provided by HCl / dioxane; 37) The time for the removal of the amino protecting group is 10-15 hours; 38) The temperature for the removal of the amino protecting group is 20~30℃; 39) The agent for the removal of the amino protecting group is an organic solvent.
10. The preparation method according to claim 9, characterized in that, In feature 32), the molar ratio of compound 14, compound 15, TCFH and NMI is 1:(2~3):(2.2~2.8):(3.5~4.5).
11. The preparation method according to claim 9, characterized in that, In feature 33), the organic solvent is THF.
12. The preparation method according to claim 9, characterized in that, In feature 36), the molar ratio of compound 16 to HCl / dioxane is 1:(2.8~3.2).
13. The preparation method according to claim 9, characterized in that, In feature 39), the organic solvent is dichloromethane.
14. Use of the PROTAC compound according to any one of claims 1 to 2 in the preparation of an anticancer drug, wherein the anticancer drug is a drug for treating glioblastoma.
15. The use according to claim 14, characterized in that, The use of the PROTAC compound as a PTRF / Cavin 1 degrader in the preparation of anticancer drugs.
16. The use according to claim 14, characterized in that, The anticancer drug has one or more of the following effects: 1) Inhibit the proliferation of tumor cells; the tumor cells are tumor cells that highly express PTRF / Cavin1; the tumor cells that highly express PTRF / Cavin1 are glioblastoma; 2) Degradation of PTRF / Cavin1 in tumor cells; 3) Degradation of RBX1 protein; 4) Inhibit ERK1 / 2 K63 ubiquitination chain modification; 5) Inhibit ERK1 / 2 activation; 6) Inhibits PGK1 S203 phosphorylation and mitochondrial translocation; 7) Promotes pyruvate metabolism and / or inhibits glycolysis; 8) Inhibit AKT K63 ubiquitination chain modification and activation and / or p21K48 ubiquitination chain modification and degradation; 9) Enhance the efficacy of temozolomide in vivo and in vitro treatment.
17. A drug for degrading PTRF / Cavin1, characterized in that, The drug comprises the PROTAC compound as described in any one of claims 1 to 2, as well as a pharmaceutically acceptable carrier and / or excipient.