Bispecific antibodies that specifically bind to hepatitis B surface antigen and their applications

By designing a bispecific antibody that specifically binds to hepatitis B surface antigen, targeting the PreS1 region of the large surface antigen and the AGL region of the small surface antigen, the problem of existing hepatitis B drugs being unable to clear HBV cccDNA and integrated DNA has been solved, achieving significant hepatitis B treatment effects, including seroconversion of hepatitis B surface antigen and e antigen, HBV DNA levels below the detection limit, and clearance of intrahepatic HBV cccDNA.

CN121159708BActive Publication Date: 2026-07-31SYNO MINICIRCLE BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SYNO MINICIRCLE BIOTECH CO LTD
Filing Date
2025-09-26
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing hepatitis B drugs, such as nucleoside (acid) analogs and alpha interferon, cannot clear HBV cccDNA and integrated DNA. Existing monoclonal antibodies are not effective enough to achieve the goal of virological cure or functional cure.

Method used

A bispecific antibody that specifically binds to hepatitis B surface antigen was designed. By targeting the variable region sequences of monoclonal antibodies 2H5 and 125S that target the PreS1 region of the large surface antigen and the AGL region of the small surface antigen, a bispecific antibody was constructed, which enhances the virus neutralization ability and the ability to kill infected cells.

Benefits of technology

It significantly improves the efficacy of hepatitis B treatment, clears infected cells, prevents immune escape, provides long-term protection, achieves seroconversion of hepatitis B surface antigen and e antigen, reduces HBV DNA to below the detection limit, and clears HBV cccDNA in the liver.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121159708B_ABST
    Figure CN121159708B_ABST
Patent Text Reader

Abstract

This invention provides a bispecific antibody that specifically binds to hepatitis B surface antigen and its application, belonging to the field of chronic hepatitis B treatment and prevention technology. The bispecific antibody provided by this invention comprises: a first antibody, which is obtained by linking the variable regions of the heavy chain and light chain of a humanized anti-HBsAg antibody 2H5 to the constant regions of the heavy chain and light chain of human IgG1, respectively, and by mutating the Fc segment of the constant region of the heavy chain of human IgG1; and a second antibody, which is obtained by linking the variable region of the 125S heavy chain of a humanized anti-HBsAg antibody to the Fc segment of the constant region of the heavy chain of human IgG1, and by mutating the Fc segment of the constant region of the heavy chain of human IgG1. This bispecific antibody binds to two viral antigenic epitopes simultaneously, preventing immune escape; it enhances the neutralizing ability against the virus and the killing ability against infected cells, and the two work synergistically to eliminate the infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of chronic hepatitis B treatment and prevention technology, and in particular to a bispecific antibody that specifically binds to hepatitis B surface antigen and its application. Background Technology

[0002] Chronic hepatitis B (CHB) is a major infectious liver disease caused by hepatitis B virus (HBV) infection. HBV mediates viral entry and infection of hepatocytes through the interaction of viral envelope proteins (i.e., hepatitis B surface proteins, HBsAg) with receptors on hepatocytes. In fact, HBV encodes three surface antigens: large HBsAg (L-HBsAg, abbreviated L), middle HBsAg (M-HBsAg, abbreviated M), and small HBsAg (S-HBsAg, abbreviated S). All three have the same C-terminus (i.e., the S region; 226 aa long). Compared to S-HBsAg, M-HBsAg has 55 aa more PreS2 at the N-terminus, while L-HBsAg has 108-119 aa more PreS1 than M-HBsAg. In other words, the small surface antigen only includes the S region, the middle surface antigen is composed of PreS2 / S, and the large surface antigen is composed of PreS1 / PreS2 / S. Figure 1 The process of HBV entering hepatocytes mainly involves two types of surface antigens: large and small. Specifically, the antigenic loop (AGL) of the small surface antigen first binds to the low-affinity receptor HSPG (heparan sulfate proteoglycan), and then the PreS1 region of the large surface antigen binds to the high-affinity receptor NTCP (Na+-taurocholate cotransporting polypeptide).

[0003] After HBV infects hepatocytes, its genome enters the cell nucleus and is repaired into covalently closed circular DNA (cccDNA) under the action of viral proteins and host factors. HBV cccDNA serves as the original template for viral replication, stably existing within the nucleus of infected hepatocytes. It is insensitive to existing drugs and is the key molecular basis for establishing persistent viral infection. Complete cure (or virological cure) of chronic hepatitis B requires the complete eradication of HBV cccDNA. Furthermore, viral DNA may integrate into the host genome, continuously expressing viral gene products (such as hepatitis B surface antigen). This viral DNA integration is an important inducing factor in the development and progression of liver cancer, further complicating the eradication of hepatitis B.

[0004] The latest guidelines for the prevention and treatment of chronic hepatitis B, such as "Update on the treatment navigation for functional cure of chronic hepatitis B: expert consensus 2.0" (Clin Mol Hepatol 2025, 31(Suppl):S134-S164), recommend clinical cure (or functional cure) as the ideal treatment goal. The serological indicators for this are: 1) persistent negative hepatitis B surface antigen (HBsAg); 2) seroconversion of hepatitis B e antigen (HBeAg) (i.e., HBeAg seroconversion and the appearance of HBeAg antibody); and 3) serum HBV DNA levels below the detection limit (10 IU / mL). Among these, HBeAg seroconversion is the most crucial indicator of functional cure.

[0005] Existing hepatitis B drugs, including nucleoside (acid) analogs (NA) and alpha interferon, cannot clear HBV cccDNA and integrated DNA, nor can they make the surface antigen negative, thus failing to achieve the goal of virological cure or functional cure. There is an urgent need to develop new drugs or therapies.

[0006] Antibodies are an important component of specific immunity. On the one hand, they can neutralize viruses and block infection; on the other hand, they can kill infected cells through Fc-mediated ADCC (antibody-dependent cell-mediated cytotoxicity), CDC (complement-dependent cytotoxicity), and ADCP (antibody-dependent cellular phagocytosis). Antibodies play a crucial role in the spontaneous recovery process of acute HBV infection in adults. Antibody-based immunotherapy provides a new option for treating chronic hepatitis B.

[0007] Most therapeutic antibodies for hepatitis B target the PreS1 region of the large hepatitis B surface antigen (HBsAg) or the AGL region of the small hepatitis B surface antigen (HBsAg), as binding to these sites can neutralize the virus. Currently, several related monoclonal antibodies (mAbs) have shown varying degrees of therapeutic potential in clinical trials, such as tobevibart (formerly vir-3434; Vir Biotech) and HH-003 (humanized 2H5; Chinese patent CN201680029377.7). However, the efficacy of existing mAbs (such as HH-003 and vir-3434) remains insufficient; they only reduce, rather than eliminate, HBsAg, and the efficacy is not long-lasting, with rapid viral rebound after discontinuation (indicating failure to clear HBV cccDNA and integrated DNA). They are still far from achieving the ideal goal of clinical cure and require further improvement. Summary of the Invention

[0008] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing a bispecific antibody that specifically binds to hepatitis B surface antigen and its application. Based on the variable region sequences of monoclonal antibody 2H5, which targets the large surface antigen PreS1 region, and monoclonal antibody 125S (Antiviral Res 2022, 199:105265), a bispecific anti-HBV antibody was constructed, which significantly improved the therapeutic effect.

[0009] To achieve the above objectives, the present invention adopts the following technical solution: The first objective of this invention is to provide a bispecific antibody that specifically binds to hepatitis B surface antigen, comprising: The first antibody comprises linking the heavy chain variable region and light chain variable region of humanized anti-HBsAg antibody 2H5 to the heavy chain constant region and light chain constant region of human IgG1, respectively, and mutating the Fc segment of the heavy chain constant region of the human IgG1, and specifically recognizing the PreS1 region of HBV large surface antigen. The second antibody comprises linking the variable region of the humanized anti-HBsAg antibody 125S heavy chain to the Fc segment of the constant region of the human IgG1 heavy chain, and mutating the Fc segment of the constant region of the human IgG1 heavy chain, and specifically recognizing the AGL region of the HBV small surface antigen.

[0010] The mutations in the Fc region of the heavy chain constant region of human IgG1 in the first antibody and the second antibody of the present invention specifically include: G236A, A330L, I332E, M428L and N434S, the specific sequences of which are shown in SEQ ID NO:6.

[0011] Furthermore, in this invention, the heavy chain variable region of the second antibody is linked to the C-terminus or N-terminus of the heavy chain variable region of the first antibody via a linker peptide to obtain the bispecific antibody.

[0012] The linker peptides described in this invention include GGGGGSGGGGSGGGGS.

[0013] The amino acid sequence of the heavy chain variable region of the humanized anti-HBsAg antibody 2H5 described in this invention is shown in SEQ ID NO:1, the amino acid sequence of the light chain variable region is shown in SEQ ID NO:2, the amino acid sequence of the heavy chain constant region of the mutated human IgG1 is shown in SEQ ID NO:3, the amino acid sequence of the light chain constant region is shown in SEQ ID NO:4, and the amino acid sequence of the heavy chain variable region of the humanized anti-HBsAg antibody 125S is shown in SEQ ID NO:5.

[0014] The second objective of this invention is to provide a nucleic acid molecule that encodes a bispecific antibody that specifically recognizes hepatitis B surface antigen, as described in this invention.

[0015] A third objective of this invention is to provide an expression vector containing the nucleic acid molecule described herein. The vector includes: bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors.

[0016] A fourth objective of this invention is to provide a genetically engineered host cell that contains the vector described in this invention, or whose genome integrates the nucleic acid molecules described in this invention.

[0017] A fifth objective of this invention is to provide a pharmaceutical composition comprising one or more of the following: a bispecific antibody that specifically recognizes hepatitis B surface antigen, a nucleic acid molecule, a vector, or genetically engineered host cells. The pharmaceutical composition further comprises pharmaceutically acceptable excipients or vectors. The bispecific antibody, nucleic acid molecule, vector, or genetically engineered host cells that specifically recognize hepatitis B surface antigen are soluble in an aqueous carrier, such as buffered saline. It may also contain pharmaceutically acceptable excipients close to those required under physiological conditions, such as pH adjusters and buffering agents, sodium acetate, sodium chloride, potassium chloride, calcium chloride, and sodium lactate.

[0018] The pharmaceutical excipients described herein are those widely used in the pharmaceutical manufacturing industry. Excipients primarily serve to provide a safe, stable, and functional pharmaceutical composition, and may also provide methods to ensure that the active ingredient dissolves at a desired rate after administration to a subject, or to promote the effective absorption of the active ingredient after administration to a subject. The pharmaceutical excipients may be inert fillers, or provide a function such as stabilizing the overall pH of the composition or preventing the degradation of the active ingredient. The pharmaceutical excipients may include one or more of the following: binders, suspending agents, emulsifiers, diluents, fillers, granulating agents, adhesives, disintegrants, lubricants, anti-adhesion agents, flow aids, wetting agents, gelling agents, absorption delay agents, dissolution inhibitors, enhancers, adsorbents, buffers, chelating agents, preservatives, colorants, flavoring agents, and sweeteners.

[0019] The pharmaceutical compositions of the present invention can be prepared using any method known to those skilled in the art, based on the disclosure. Examples include conventional mixing, dissolving, granulation, emulsification, grinding, encapsulation, embedding, or lyophilization processes.

[0020] The pharmaceutical compositions of this invention can be administered in any form, including by injection (intravenous), oral (solid and liquid formulations), or parenteral (infusion, injection, implantation, subcutaneous, intravenous, intra-arterial, and intramuscular) administration. The pharmaceutical compositions of this invention can also be controlled-release or delayed-release dosage forms (e.g., liposomes or microspheres). Examples of solid oral formulations include, but are not limited to, powders, capsules, tablets, soft capsules, and tablets. Examples of liquid formulations for oral administration include, but are not limited to, suspensions, emulsions, elixirs, and solutions. Examples of parenteral formulations include, but are not limited to, solutions for injection, dry formulations that can be dissolved or suspended in a pharmaceutically acceptable carrier, suspensions for injection, and emulsions for injection.

[0021] As used in this invention, the term "encoding nucleic acid molecule" refers to a polynucleotide that directly specifies the amino acid sequence of a bispecific antibody. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon (such as ATG, GTG, or TTG) and ends with a stop codon (such as TAA, TAG, or TGA). The coding sequence can be genomic DNA, synthetic DNA, or a combination thereof.

[0022] The term “expression” as used in this invention includes any step involved in polypeptide production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0023] The term "pharmaceutical acceptable" as used in this invention refers to compounds, materials, compositions, and / or dosage forms that, within the bounds of reliable medical judgment, are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0024] A sixth objective of this invention is to provide the use of the nucleic acid molecules, expression vectors, host cells, or pharmaceutical compositions described herein in the preparation of medicaments or diagnostic reagents for treating conditions caused by HBV infection.

[0025] The bispecific antibody that specifically recognizes hepatitis B surface antigen provided by this invention can be used for various purposes, such as molecular diagnosis of hepatitis B and colloidal gold reagent kits for treating diseases caused by HBV infection. The sample can be any biological sample, such as tissue sections, for example, frozen sections obtained for histological purposes; or body fluids, such as blood, serum, and plasma. Biological samples are generally obtained from mammals, including humans, non-human primates, and mice. Simultaneously, the bispecific antibody can treat diseases caused by HBV infection, including hepatitis, liver fibrosis, cirrhosis, or liver cancer.

[0026] Compared with the prior art, the beneficial effects of the present invention are: (1) The present invention provides a bispecific antibody that specifically binds to hepatitis B surface antigen, comprising: a first antibody, wherein the first antibody comprises linking the variable region of the heavy chain and the variable region of the light chain of humanized anti-HBsAg antibody 2H5 to the constant region of the heavy chain and the constant region of the light chain of human IgG1, respectively, and mutating the Fc segment of the constant region of the heavy chain of human IgG1, and specifically recognizing the PreS1 region of HBV large surface antigen; and a second antibody, wherein the second antibody comprises linking the variable region of the heavy chain of humanized anti-HBsAg antibody 125S to the Fc segment of the constant region of the heavy chain of human IgG1, and mutating the Fc segment of the constant region of the heavy chain of human IgG1, and specifically recognizing the AGL region of HBV small surface antigen. Simultaneously binding to two viral antigenic epitopes prevents immune escape; enhances the neutralizing ability against the virus and the killing ability against infected cells; the two work synergistically to clear the infection.

[0027] (2) For some people who are vaccinated against hepatitis B, they cannot produce an effective immune response (cannot produce hepatitis B surface antibody or have low antibody titer). The gene vector provided by this invention can be used to continuously express bispecific antibodies in vivo, which can provide long-term protection for these people and replace the role of the vaccine. Attached Figure Description

[0028] Figure 1 This is a schematic diagram of the structure of the bispecific antibody provided by the present invention; Figure 2This is a schematic diagram illustrating the construction of the microcircular DNA expression vector provided by the present invention; Figure 3 This is a graph showing the SDS-PAGE detection results of the bispecific antibody prepared in this invention; Figure 4 The image shows the SEC-HPLC detection results of the bispecific antibody BS1 prepared in this invention. Figure 5 The image shows the SEC-HPLC detection results of the bispecific antibody BS2 prepared in this invention. Figure 6 The image shows the results of flow cytometry detection of bispecific antibody binding function. Figure 7A This is a graph showing the results of hepatitis B surface antigen (HBsAg) inhibition. Figure 7B This is a graph showing the results of hepatitis B e antigen (HBeAg) inhibition. Figure 8A This is a diagram showing the comparison of the in vivo expression of bispecific antibodies BS1 and BS2. Figure 8B This is a graph showing the long-term expression results of the bispecific antibody BS1. Figure 9 Flowchart for the construction and treatment of a mouse model of hepatitis B; Figure 10 This is a graph showing the changes in HBeAg levels in hepatitis B-positive mice. Figure 11 This is a graph showing the changes in HBsAg in hepatitis B mice. Figure 12 This is a diagram showing the changes in HBV-DNA in hepatitis B mice. Figure 13 A graph showing the changes in alanine aminotransferase in hepatitis B mice. Figure 14 Image showing the quantitative results of HBV cccDNA in the liver of hepatitis B-positive mice; Figure 15 This is a diagram showing the immunohistochemical results of viral antigens in the liver. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of the present invention clearer, embodiments of the present invention are described in detail below. Examples of these embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, usually performed under conventional conditions such as those described in "Molecular Cloning: A Laboratory Manual (Fourth Edition)" (Chinese version) published by Science Press, or as recommended by the manufacturer. These are experimental procedures well known to those skilled in the art, and the present invention does not limit them.

[0031] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0032] Example 1 Bispecific antibody design and in vitro expression.

[0033] 2H5 (CN201680029377.7; eLife 2017, 6:e26738) is a conventional IgG antibody targeting the PreS1 region of the HBV large surface antigen. The humanized 2H5 heavy chain variable region (VH) and light chain variable region (VL) were linked to the human IgG1 heavy chain constant region (CH1-hinge-CH2-CH3) and light chain constant region (CL), respectively. Mutations were introduced in the Fc segment (CH2-CH3) of the heavy chain constant region, introducing five point mutations: G236A / A330L / I332E / M428L / N434S, to enhance the antibody's ADCC / ADCP activity and accumulate higher concentrations in vivo. The final antibody was named S0A.

[0034] The specific process of mutating the Fc segment (CH2-CH3) of the heavy chain constant region was achieved by directly synthesizing a full-length coding gene containing the mutated sites and codon-optimized. The synthesized mutated human IgG1 Fc segment gene sequence is as follows (the five underlined sites represent the G236A, A330L, I332E, M428L, and N434S mutations, respectively): Gagcctaagagttgtgacaaaacgcacacttgccctccttgtccggcccctgagctgctg gccgggccctctgtgttcttattccctcccaagcccaaggatactctcatgattagcagaactcctgaggtcacctgtgtggtcgtagacgtgagccatgaagaccctgaagttaaatttaactggtatgtggatggcgtag aagtccacaatgccaaaacgaagcccagagaagagcagcagtacaacagcacataccgggtagtgtcagtcctcacagtgttacaccaggactggctgaacggcaaggagtacaagtgcaaagtcagcaacaaggccctacct ctt cca gaa gagaagacaatctcgaaggcaaagggccagccccgggagccaaagtctacacactgccccccagccgggacgaactaacgaaaaatcaggtgagtctgacctgcctggtgaagggcttctaccctagtgacatcgcagtgg aatgggagtctaatgggcagccggagaataactacaagactactccccctgtcctggattcagacggttccttcttcctctactcgaaactgaccgtggataagtcgcggtggcagcagggcaacgtcttcagctgctccgtg ctg catgaggcactccac agc cactataccccagaaatccctgtctctaagccctggaaagtga.

[0035] 125S (CN116496389; Antiviral Res 2022, 199:105265) is a nanobody targeting the AGL region of the HBV small surface antigen (i.e., a heavy chain antibody lacking the light chain). The variable domain of the humanized 125S heavy chain (VHH) is linked to the Fc segment (CH2-CH3) of the constant region of the human IgG1 heavy chain, and the above five point mutations of G236A / A330L / I332E / M428L / N434S are introduced; the final antibody is named S0B.

[0036] The humanized 125S heavy chain variable region (VHH) was linked to the C-terminus or N-terminus of the S0A heavy chain via a linker to construct bispecific antibodies, named BS1 and BS2, respectively. Figure 1 (As shown).

[0037] Microcircular DNA expression vectors encoding S0A, S0B, BS1, and BS2 were constructed and named MC.S0A, MC.S0B, MC.BS1, and MC.BS2, respectively. The specific construction process is as follows: (1) Synthesize DNA fragments encoding the target genes S0A, S0B, BS1 and BS2 (containing signal peptide sequences; structure as follows) Figure 2 (As shown).

[0038] The nucleotide sequences of S0A, S0B, BS1, and BS2 are shown in SEQ ID NO:7 to SEQ ID NO:10.

[0039] First, a DNA fragment containing CMV promoter / enhancer, chimeric intron, multiple cloning site (MCS), and bovine growth hormone polyA signaling elements was synthesized and inserted between the attB and attP recombination sites of the blank plasmid pMC.BESPX (Nat Biotechnol 2010, 28:1287-1289) used for microcircular DNA production, thus constructing the microcircular DNA cloning vector pMC.CMV-MCS-bpA. Then, the target gene DNA fragments of S0A, S0B, BS1, and BS2 were cloned into the AgeI / EcoRV restriction sites of the vector pMC.CMV-MCS-bpA, respectively, to construct the corresponding microcircular DNA parent plasmids (pMC.S0A, pMC.S0B, pMC.BS1, and pMC.BS2).

[0040] (2) The above parent plasmids were transformed into genetically engineered Escherichia coli ZYCY10P3S2T (Nat Biotechnol 2010, 28:1287-1289).

[0041] (3) Select positive monoclonal colonies and inoculate them into LB medium or TB medium and culture them in a shaker at 37°C for 12 h - 16 h.

[0042] (4) Add L-arabinose to induce (final concentration of L-arabinose 0.2%), the induction temperature is 30℃-32℃, the induction time is 6-8 hours, and the parent plasmid is induced to undergo site-specific DNA recombination to form microcircular DNA and backbone DNA. The backbone DNA is linearized in the bacteria and then degraded.

[0043] (5) Extract the corresponding microcircular DNA vectors MC.S0A, MC.S0B, MC.BS1 and MC.BS2 using a plasmid DNA purification kit (QIAGEN EndoFree Plasmid Mega Kit, Qiagen, Germany).

[0044] Four microcircular DNA vectors (MC.S0A, MC.S0B, MC.BS1, and MC.BS2) were transfected into 293T cells. After 72 hours, the cell culture supernatant was collected, purified with Protein A, and the expression products were identified by SDS-PAGE and SEC-HPLC. SDS-PAGE results showed that under reducing conditions, the BS1 and BS2 bispecific antibodies separated into heavy and light chains of different molecular weights; under non-reducing conditions, they were single molecules. Furthermore, the molecular weights of the light, heavy, and full-length antibodies met theoretical values, indicating that the MC. bispecific antibody expression was normal (e.g., ...). Figure 3 (As shown). SEC-HPLC results showed that BS1 and BS2 were both monomeric molecules, with no antibody aggregation or other mismatched molecules produced (such as...). Figure 4 and Figure 5 (As shown).

[0045] Binding function was identified using flow cytometry (FACS): Equimolar amounts of BS1 and BS2 bispecific antibodies and their parental monoclonal antibodies (S0A, S0B) were incubated with HBV large surface antigen (PreS1 / PreS2 / S) positive 293T cells (293T cells transfected with PreS1 / PreS2 / S plasmids). Binding was detected by FACS, revealing that BS1, BS2, and the parental monoclonal antibodies could all bind to HBV antigen. BS1 showed the highest affinity for HBV antigen, followed by BS2. Both BS1 and BS2 showed significantly higher affinity than the parental monoclonal antibodies (e.g., BS1 + BS2 + BS2). Figure 6 (As shown).

[0046] Example 2 To investigate the virus's neutralizing activity.

[0047] The neutralizing activity of BS1 and BS2 bispecific antibodies against HBV virus (genotype D) was tested using primary human hepatocytes (PHH). The specific procedure was as follows: Serially diluted test antibodies (BS1, BS2 bispecific antibodies, and parental monoclonal antibodies S0A and S0B) were mixed with HBV virus (genotype D), and the mixture was then added to pre-coated PHH cells (equal volume). On day 2, the PHH cells were washed three times with PBS, and the culture medium was replaced with fresh medium. Fresh medium was then replaced every other day. On day 8, the cell supernatant was collected, and HBsAg (…) was detected. Figure 7A ) or HBeAg ( Figure 7BThe inhibition curves were fitted and the inhibition rates were calculated. It was found that the inhibition rates of BS1 and BS2 bispecific antibodies against HBV infection were close to 100% at concentrations as low as 1 nM. Under these concentration conditions, the inhibition rate of the parental monoclonal antibody S0A was only about 60%, while the inhibition rate of the other parental monoclonal antibody S0B was less than 10%. Furthermore, the half-maximal inhibitory concentrations (IC50) of BS1 and BS2 bispecific antibodies were measured to be 0.06-0.08 nM, while the IC50 values ​​of the parental monoclonal antibodies S0A and S0B were approximately 0.6 nM (8-10 times higher than BS1 and BS2 bispecific antibodies) and approximately 12 nM (150-200 times higher than BS1 and BS2 bispecific antibodies), respectively. These results indicate that the neutralizing performance of BS1 and BS2 bispecific antibodies against HBV is comparable and far superior to that of the parental monoclonal antibodies.

[0048] Example 3 Investigate the in vivo expression of bispecific antibodies.

[0049] Equal amounts of anti-HBV bispecific antibodies (MC.BS1 and MC.BS2) encoded by microcircular DNA were intramuscularly injected into mice, and transfection was promoted by a pulsed electric field. Serum antibody levels were measured 5 weeks after injection. The results showed that both MC.BS1 and MC.BS2 were expressed normally in mice, but the in vivo expression of MC.BS1 was significantly superior to that of MC.BS2, with the former's average expression level being approximately twice that of the latter. Figure 8A ). MC.BS1, with higher expression levels, was selected and its long-term expression was observed in another batch of mice. It was found that MC.BS1 could maintain a stable high level of expression. Figure 8B This indicates that the idea of ​​"one injection for long-term treatment" can be realized.

[0050] Example 4 To investigate the in vivo efficacy of bispecific antibodies.

[0051] In immunodeficiency URG (Tet-uPA Rag2) - / - Il2rg - / - Based on the mouse model, Dox-induced hepatocyte necrosis was performed on mice, followed by transplantation of primary human hepatocytes to reconstruct a human-mouse chimeric liver, thus establishing a humanized hepatitis B mouse model (hu-URG). The construction and treatment process of the hepatitis B mouse model are as follows ( Figure 9 Fifteen individuals with serum human albumin ≥2 mg / mL were selected from the above-mentioned hu-URG mice and inoculated with HBV virus (1×10⁻⁶). 715 CHB mice (genotype C) were randomly assigned to three groups (G1-G3) with 5 mice per group based on serum HBsAg and HBV-DNA quantification results before treatment. G1 was the blank control group, G2 was the positive drug group, and G3 was the MC.BS1 treatment group. G1 mice received no treatment; G2 mice received intraperitoneal injections of hepatitis B immunoglobulin (HBIG) (40 IU / kg body weight) every 3 days; and G3 mice received a single intramuscular injection of MC.BS1 (60 μg). After MC injection, blood was collected weekly for quantitative detection of hepatitis B virological markers, including hepatitis B surface antigen (HBsAg), hepatitis B e antigen (HBeAg), and HBV-DNA. Figures 10-12 ), and such Figure 13 The indicator shown is alanine aminotransferase (ALT); there was no difference among the groups. Blood was collected from mice in each group one week before injection of MC for use in detecting baseline values ​​of serum indicators.

[0052] Test results showed that HBIG was not effective. Figures 9-11 This aligns with the clinical use of HBIG, which is only for infection prevention and has no significant therapeutic effect, but MC.BS1 showed very significant efficacy. In the MC.BS1 treatment group, most (4 out of 5 mice) had significantly higher serum HBsAg levels. Figure 11 ) and HBeAg ( Figure 10 The remaining mouse, at the end of treatment (day 140), showed a 1.9 log10 decrease in HBsAg (98.7%) and a 0.66 log10 decrease in HBeAg (78.2%) compared to baseline (day 7). The MC.BS1 treatment group mice showed an average decrease of 2.6 log10 in HBV-DNA (99.7%). Figure 12 ).

[0053] After treatment, liver tissue was harvested and divided into three parts. One part was used to quantify the intrahepatic HBV cccDNA copy number using qPCR, and the other two parts were used for immunohistochemical analysis of intrahepatic hepatitis B surface antigen (HBsAg) and hepatitis B core antigen (HBcAg). The results showed that the intrahepatic HBV cccDNA in the MC.BS1 treatment group was significantly reduced, with a reduction of over 98% compared to the untreated control group. Figure 14 The immunohistochemical results of liver tissue were consistent with the serological indicators. In the MC.BS1 treatment group, HBsAg and HBcAg in the liver of mice were basically cleared or significantly reduced, while the other two groups had a large amount of viral antigen present. Figure 15 ).

[0054] For any points not covered above, existing technologies shall apply.

[0055] Although specific embodiments of the present invention have been described in detail by way of examples, those skilled in the art should understand that the above examples are for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications or additions to the described specific embodiments or use similar methods to replace them, without departing from the direction of the invention or exceeding the scope defined by the appended claims. Those skilled in the art should understand that any modifications, equivalent substitutions, improvements, etc., made to the above embodiments based on the technical essence of the present invention should be included within the protection scope of the present invention.

Claims

1. A bispecific antibody that specifically binds to hepatitis B surface antigen, characterized in that, Include: The first antibody is a humanized antibody 2H5 that specifically recognizes the PreS1 region of the HBV large surface antigen, including: The heavy chain variable region (VH) has the amino acid sequence shown in SEQ ID NO:1; The light chain variable region (VL) has the amino acid sequence shown in SEQ ID NO:2; The heavy chain constant region is a human IgG1 Fc segment containing mutations of G236A, A330L, I332E, M428L and N434S, and its amino acid sequence is shown in SEQ ID NO:3; The light chain constant region (CL) has the amino acid sequence shown in SEQ ID NO:4; The second antibody is the heavy chain variable region of humanized antibody 125S that specifically recognizes the AGL region of HBV small surface antigen, and its amino acid sequence is shown in SEQ ID NO:

5. In this connection method, the variable region of the heavy chain of the second antibody is linked to the C-terminus or N-terminus of the heavy chain of the first antibody via a linker peptide, wherein the amino acid sequence of the linker peptide is GGGGGSGGGGSGGGGS.

2. The bispecific antibody according to claim 1, characterized in that, The heavy chain variable region of the second antibody is attached to the C-terminus of the heavy chain of the first antibody.

3. The bispecific antibody according to claim 1, characterized in that, The variable region of the heavy chain of the second antibody is attached to the N-terminus of the heavy chain of the first antibody.

4. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes a bispecific antibody as described in any one of claims 1 to 3.

5. The nucleic acid molecule according to claim 4, characterized in that, The nucleotide sequence of the bispecific antibody is shown in SEQ ID NO:9 or SEQ ID NO:

10.

6. An expression carrier, characterized in that, It contains the nucleic acid molecule as described in claim 4 or 5.

7. A genetically engineered host cell, characterized in that, The host cell contains the expression vector of claim 6, or has the nucleic acid molecule of claim 4 integrated into its genome.

8. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the bispecific antibody of any one of claims 1 to 3, the nucleic acid molecule of claim 4 or 5, the expression vector of claim 6 or the cell of claim 7, and one or more pharmaceutically acceptable excipients.

9. Use of the bispecific antibody of any one of claims 1 to 3, the nucleic acid molecule of claim 4 or 5, the expression vector of claim 6, the host cell of claim 7, or the pharmaceutical composition of claim 8 in the preparation of a medicament for treating chronic hepatitis B.

10. Use of the bispecific antibody of any one of claims 1 to 3, the nucleic acid molecule of claim 4 or 5, the expression vector of claim 6, the host cell of claim 7, or the pharmaceutical composition of claim 8 in the preparation of a medicament for treating liver fibrosis, cirrhosis, or liver cancer caused by hepatitis B virus infection.