A genetically engineered yarrowia lipolytica for producing decaprenylphenol and application thereof

Abstract

The application discloses a lipomyces lipoferus gene engineering bacterium for producing decylisoprenol and application, and belongs to the technical field of bioengineering. The lipomyces lipoferus gene engineering bacterium is obtained by cloning decene diphosphate synthase gene into lipomyces lipoferus, overexpressing related genes in the endogenous acetyl coenzyme A synthesis pathway and the mevalonate pathway of the lipomyces lipoferus, weakening the squalene synthesis pathway, and knocking out the endogenous ylCOQ1 enzyme. Experimental results prove that the lipomyces lipoferus gene engineering bacterium can significantly improve the yield of decylisoprenol, and the product can be used as an important precursor for chemical synthesis of coenzyme Q10, so that the engineering bacterium and the product can be applied to biochemical synthesis of coenzyme Q10. The method is green and efficient, and has important industrial application value.

Description

Technical Field

[0001] This invention relates to a genetically engineered *Yarrowia lipolytica* strain that produces decanopentenol and its applications, belonging to the field of bioengineering technology. Background Technology

[0002] Coenzyme Q10 (CoQ10) is a fat-soluble quinone compound that plays a central role in electron transport in the human respiratory chain, ATP synthesis, antioxidation, and immune regulation. Its clinical applications include adjuvant therapy for cardiovascular diseases, hepatitis, and cancer, as well as in health supplements. Global demand is growing at an annual rate of 15%-20%, indicating a significant market gap.

[0003] Currently, the mainstream production methods for Coenzyme Q10 include: bio-extraction, microbial fermentation, semi-chemical synthesis, and total chemical synthesis. Bio-extraction involves extracting from animal hearts or plants, resulting in low product purity, high cost (requiring enrichment and purification), and difficulty in scaling up due to raw material limitations. Microbial fermentation has unstable yields and poor predictability, relying on experience for optimization, and its cost remains high. Semi-chemical synthesis uses solanesol as a raw material to synthesize decaneneol (a Coenzyme Q10 side-chain precursor), which is then coupled to the parent ring. However, solanesol is expensive, and the process involves low raw material utilization and complex steps (requiring bromination, Grignard reactions, etc.), with an overall yield of only 50%-75%. Total chemical synthesis involves complex steps and is difficult to control stereoselectivity.

[0004] The structural formula of decanisopentenol is as follows: .

[0005] In existing semi-chemical synthesis methods, decanopentenol is synthesized from solanesol via bromination to solanesyl bromide, followed by reaction with ethyl acetoacetate to produce solanesylacetone, which is then reduced to decanopentenol. The overall yield is only 54%-67%, and highly toxic reagents (such as phosphorus tribromide) are used, resulting in numerous byproducts. However, through synthetic biology methods, natural microorganisms can synthesize decanopentenol via the mevalonic acid (MVA) or methyl erythritol phosphate (MEP) pathway to generate isopentened diphosphate (IPP / DMAPP), which is then extended by polyisoprene transferase catalysis. However, the synthesis efficiency of long-chain (C50) isoprene alcohols is low, and the regulation of endogenous microbial pathways is complex. How to modify natural microorganisms to efficiently synthesize decanopentenol is a research topic that needs further investigation. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a lipophilic yeast that produces decanopentenol (Yersinia lipolytica). Yarrowia lipolytica Genetically engineered bacteria.

[0007] This invention provides a genetically engineered *Yersinia lipolytica* strain that produces decanoisopentenol, which is achieved by overexpressing the decene diphosphate synthase gene in a *Yersinia lipolytica* starting strain; the decene diphosphate synthase gene is integrated into the *Yersinia lipolytica* genome and overexpressed in the cytoplasm; the starting strain is a leucine and / or uracil auxotrophic *Yersinia lipolytica* strain.

[0008] Preferably, the decene diphosphate synthase gene is derived from the decene diphosphate synthase RsDDSA gene of Rhodotorula globulus, and the expression cassette of the decene diphosphate synthase gene carried by the linearized plasmid is integrated into the genome of Yersinia lipolytica through a non-homologous end joining mechanism.

[0009] Specifically, the nucleotide sequence of the decene diphosphate synthase gene is codon-optimized according to the expression preferences of *Yarrowia lipolytica*. The RsDDSA gene, in particular, has undergone codon optimization based on the expression preferences of *Yarrowia lipolytica*, and its nucleotide sequence is shown in SEQ ID NO. 1.

[0010] In a specific embodiment, the decene diphosphate synthase gene is integrated into the genome of Yersinia lipolytica with 1, 2, 3 or 4 copies.

[0011] Preferably, the *Yersinia lipolytica* is selected from any one of *Yersinia lipolytica* E150 (CLIB122), *Yersinia lipolytica* E129 (CLIB121), *Yersinia lipolytica* po1 series strains (Po1d, Po1e, Po1f, Po1g and Po1h), and *Yersinia lipolytica* w29 (CLIB89, ATCC20460 and CBS7504), or any derivative thereof. Furthermore, one or two of the genes for acetyl-CoA thiolysis enzyme ERG10 and HMG-CoA synthase ERG13 in the endogenous acetyl-CoA synthesis pathway of Yersinia lipolytica are overexpressed, or one or more of the genes for hydroxymethylglutaryl-CoA reductase tHMG1, mevalonate kinase ERG12, phosphate mevalonate kinase ERG8, mevalonate diphosphate decarboxylase ERG19, IPP isomerase IDI, and geranyl / farnesyl diphosphate synthase ERG20 in the endogenous mevalonate pathway of Yersinia lipolytica are overexpressed.

[0012] Specifically, enhanced expression of endogenous genes is achieved through iterative gene integration technology mediated by non-homologous end joining.

[0013] Furthermore, the hydroxymethylglutaryl-CoA reductase tHMG1 gene was overexpressed. Specifically, two copies of the hydroxymethylglutaryl-CoA reductase tHMG1 gene were overexpressed.

[0014] Furthermore, the overexpression of the hydroxymethylglutaryl-CoA reductase tHMG1 gene is a truncated hydroxymethylglutaryl-CoA reductase tHMG1 gene.

[0015] Furthermore, the genes for acetyl-CoA thiolytic enzyme ERG10 and HMG-CoA synthase ERG13 were simultaneously overexpressed.

[0016] Furthermore, the genes for mevalonate kinase ERG12, mevalonate phosphate kinase ERG8, and mevalonate diphosphate decarboxylase ERG19 were simultaneously overexpressed.

[0017] Furthermore, the bifunctional enzyme (gerany diphosphate synthase and farnesyl diphosphate synthase) ERG20 gene and the IPP isomerase IDI gene were simultaneously overexpressed.

[0018] Furthermore, the expression of the squalene synthase ERG9 gene, which is involved in the squalene synthesis pathway, is weakened. Specifically, the squalene synthase ERG9 gene is weakened or knocked out using homologous recombination-mediated gene knockout technology or gene editing methods. More specifically, the weakening method involves truncating the ERG9 promoter to 50 bases, and the nucleotide sequence of the weakened promoter is shown in SEQ ID NO.3. The squalene synthase ERG9 promoter truncated expression cassette used consists of upstream and downstream homologous arms flanking the retained 50bp promoter, with homologous arms ranging from 1000bp to 1500bp.

[0019] In another embodiment, the gene encoding the endogenous ylCOQ1 enzyme is replaced with the gene encoding RsDDSA via homologous recombination-mediated gene substitution, but the mitochondrial localization peptide of the endogenous COQ1 enzyme is retained at the N-terminus. Preferably, the nucleotide sequence of the mitochondrial localization peptide is as shown in SEQ ID NO.4 or SEQ ID NO.5.

[0020] The gene substitution expression cassette encoding the endogenous ylCOQ1 enzyme includes the upstream homologous arm of the ylCOQ1 gene, the mitochondrial localization signal peptide, decene diphosphate synthase RsDDSA, and the downstream homologous arm of the ylCOQ1 gene.

[0021] Preferably, the mitochondrial localization signal peptide is any one of 40bp, 50bp, 105bp, 120bp, 150bp, 165bp, and 180bp from the N-terminus of the ylCOQ1 gene; the upstream and downstream homologous arms are 1000bp to 1500bp. Preferably, the endogenous ylCOQ1 enzyme replacement expression cassette plasmid carries a LEU2 tag, which can compensate for the LEU2 deficiency in the strain.

[0022] In specific examples, the relevant enzyme information is as follows: acetyl-CoA thiolase ERG10 (encoded by the nucleotide sequence shown in Gene ID: 2911520), HMG-CoA synthase ERG13 (encoded by the nucleotide sequence shown in Gene ID: 2907642), truncated hydroxymethylglutaryl-CoA reductase tHMG1 (encoded by the nucleotide sequence shown in SEQ ID NO. 2), mevalonate kinase ERG12 (encoded by the nucleotide sequence shown in Gene ID: 2906793), phosphate mevalonate kinase ERG8 (encoded by the nucleotide sequence shown in Gene ID: 2912386), mevalonate diphosphate decarboxylase ERG19 (encoded by the nucleotide sequence shown in Gene ID: 2907970), IPP isomerase IDI (encoded by the nucleotide sequence shown in Gene ID: 2907710), geraniol / farnesyl diphosphate synthase ERG20 (encoded by Gene ID: 2907642), and methyl hydroxymethylglutaryl-CoA reductase tHMG1 (encoded by the nucleotide sequence shown in SEQ ID: SEQ ID NO. 2). The nucleotide sequences shown in SEQ ID NO. 2912329 encode squalene epoxidase ERG9 (encoded by the nucleotide sequence shown in Gene ID: 2906604), endogenous ylCOQ1 enzyme (encoded by the nucleotide sequence shown in Gene ID: 2909963), and mitochondrial localization peptide nucleotide sequences are shown in SEQ ID NO. 4 or SEQ ID NO. 5.

[0023] The overexpression is controlled by a strong promoter selected from any one of PTEF, Php4d, PTEFI, PFBA, PFBAin, PPOX2, PEXP, PPOT1, or PGPD and PTDH, while the terminator is a terminator from Yersinia lipophila, such as any one of Txpr2t, Tmig1t, Tlip2t, Tcyc1t, Tpex3t, Tpex10t, or Tpex20t.

[0024] In one specific embodiment, the Yersinia lipolyticis genetically engineered strain, with accession number CCTCC NO.M20251154, was deposited on May 22, 2025, at the China Center for Type Culture Collection (CCTCC, address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province), and classified as follows: Yarrowia lipolytica DPP10.

[0025] This invention also provides the application of the described Yersinia lipolytica genetically engineered strain in the preparation of decanterenol or coenzyme Q10.

[0026] This invention further provides a method for preparing decanpentenol, which utilizes the aforementioned *Yarrowia lipolytica* genetically engineered strain to produce decanpentenol through fermentation. The method includes, for example, the following steps: mixing the bacterial culture of the *Yarrowia lipolytica* genetically engineered strain with ethyl acetate, homogenizing, centrifuging, collecting the upper ethyl acetate layer, drying, redissolving in ethanol, and filtering to obtain the product. The method for preparing the bacterial culture of the *Yarrowia lipolytica* genetically engineered strain is as follows: activating the strain of the *Yarrowia lipolytica* genetically engineered strain in a glucose-containing medium to obtain a culture broth; transferring the culture broth to a fermentation medium for further cultivation to obtain the bacterial culture.

[0027] This invention utilizes synthetic biology methods to modify *Yersinia lipolytica*, obtaining a genetically engineered *Yersinia lipolytica* strain that produces decanterenol. Firstly, by overexpressing the decene diphosphate synthase (RDSDDSA) gene, the yield of decanterenol during shake-flask fermentation reached over 5 mg / L, with the highest yield achieved when three copies of the gene were integrated. Further research and optimized gene modification further increased the decanterenol yield of the engineered strain, achieving yields of over 73 mg / L and over 89 mg / L. In one optimal example, the yield of decanterenol produced by the engineered strain of this invention even reached over 180 mg / L after shake-flask fermentation. This invention uses readily available raw materials, employing glucose as the carbon source, eliminating the need for petrochemical raw materials, and provides a novel "biological + chemical" method for the production of coenzyme Q10. Furthermore, the hydroxyl activation of decanterenol in the biological method can achieve efficient coupling with the coenzyme Q10 benzoquinone nucleus through enzymatic catalysis or transition metal catalysis (such as Pd, Cu), reducing costs while increasing yield, demonstrating industrial development potential.

[0028] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0029] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0030] Figure 1 Comparison of the yield of decanoisopentenol produced by the genetically engineered bacteria of this invention.

[0031] Biological material deposit information: The genetically engineered bacterium DPP10 was deposited on May 22, 2025, at the China Center for Type Culture Collection (CCTCC), located at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The accession number is CCTCC No. M 20251154, and the classification name is... Yarrowia lipolytica DPP10. Detailed Implementation

[0032] In the following examples and experimental cases, reagents and raw materials not specifically described are all commercially available products. The relevant gene or nucleotide sequence information involved in this invention is as follows: The optimized nucleotide sequence of the RsDDSA gene codon (SEQ ID No. 1), acetyl-CoA thiolase ERG10 (Gene ID: 2911520), HMG-CoA synthase ERG13 (Gene ID: 2907642), truncated hydroxymethylglutaryl-CoA reductase tHMG1 (nucleotide sequence shown in SEQ ID No. 2), mevalonate kinase ERG12 (Gene ID: 2906793), mevalonate phosphate kinase ERG8 (Gene ID: 2912386), mevalonate diphosphate decarboxylase ERG19 (Gene ID: 2907970), IPP isomerase IDI (Gene ID: 2907710), geraniol / farnesyl diphosphate synthase ERG20 (Gene ID: 2912329), and squalene epoxidase ERG9 of the squalene synthesis pathway (Gene ID: 2907970). 2906604), endogenous ylCOQ1 enzyme (GeneID: 2909963), and mitochondrial localization peptide nucleotide sequences are shown in SEQ ID NO.4 or SEQ ID NO.5.

[0033] The nucleotide sequence of RsDDSA (SEQ ID NO. 1):

[0034] The nucleotide sequence of tHMG1 (SEQ ID NO.2)

[0035] The truncated ERG9 promoter (SEQ ID NO. 3) GGACACAAACTCGCTTGTCACCAACTTCGAACCACCACTTTCAGCCACC.

[0036] The nucleotide sequence of the retained mitochondrial localization peptide 1 of the COQ1 enzyme (SEQ ID NO. 4): atgctgagagtcggacgaattggcaccaagaccctagccagcagcagcctgcgtttcgtggcaggtgctcggcccaaatccacgctcaccgaggccgtgctggagaccacagggctgctg.

[0037] The nucleotide sequence of the retained mitochondrial localization peptide 2 of the COQ1 enzyme (SEQ ID NO. 5): atgctgagagtcggacgaattggcaccaagaccctagccagcagcagcctgcgtttcgtggcaggtgctcggcccaaatccacgctcaccgaggccgtgctggagaccacagggctgctgaaaaccacgccccaaaaccccgagtggtct.

[0038] Example 1

[0039] The recombinant genetically engineered bacteria provided in this embodiment were prepared according to the following method: The HO-hisG-URA3-hisG-poly-HO vector (purchased from Shanghai Newp Biotechnology Co., Ltd.) was double-digested with restriction endonucleases XhoI and SalI, and the 7527bp fragment was recovered by gel extraction to obtain linearized vector 1. Using the *Yersinia lipolytica* genome as a template, the strong promoter TEFin fragment 1 was obtained by PCR with primers F1 and R1. The codon-optimized decene diphosphate synthase (RsDDSA) gene was used to obtain fragment 2 by PCR with primers F2 and R2. Using the *Yersinia lipolytica* genome as a template, the terminator Txpr2t fragment 3 was obtained by PCR with primers F3 and R3. Vector 1 and fragments 1, 2, and 3 were subjected to multi-fragment homologous recombination using the ClonExpressMultiS OneStep Cloning Kit from Novizumi, transformed into *E. coli* DH5α competent cells, and the plasmid pURA containing an RsDDSA expression cassette was verified.

[0040] pURA was linearized with MluI and FastAP enzymes and purified to obtain vector 2. Using plasmid pURA as a template, RsDDSA expression cassette was obtained by PCR with primers F4 and R3. After digestion with DpnI enzyme, fragment 4 was purified. Vector 2 and fragment 4 were cloned in one step using the ClonExpress II One Step Cloning Kit of Novizan to verify that plasmid pURA2 containing two copies of RsDDSA expression cassette was obtained.

[0041] Table 1. Primer sequence information mentioned in this embodiment .

[0042] Similarly, plasmids pURA3 and pURA4, containing three and four copies of the RsDDSA expression cassette, can be constructed respectively.

[0043] After linearization, the plasmid was transformed using the Frozen-EZ Yeast Transformation II Kit™ from Zymo Research. The linearized plasmid was expressed in *Yarrowia lipolytica* po1f, and the expression cassette carried by the linearized plasmid was integrated into the genome via the non-homologous end joining (NHEJ) mechanism of *Yarrowia lipolytica*. After screening by plate and verification by shake-flask fermentation, a series of engineered recombinant strains, DPP1–4, were obtained.

[0044] Strains DPP1-4 were activated on YPD (yeast extract dextrose agar) plates. Single colonies were picked and cultured in YPD test tubes at 30℃ and 220 rpm for 24 h. Then, 2% of the culture was transferred to 30 mL of YPD fermentation medium. After 96 h of culture at 30℃ and 220 rpm, cell growth was assessed by optical density (OD600) at 600 nm. The bacterial culture was mixed with ethyl acetate (1:1 volume ratio), homogenized with zirconium oxide beads, centrifuged, and the supernatant ethyl acetate layer was collected. After drying, the ethyl acetate layer was reconstituted with ethanol, filtered, and the yield of decanterenol was determined by liquid chromatography (LC) (the concentration of the product was calculated based on the volume of the culture medium). The results are shown in Table 2. The recombinant strain DPP3, containing three copies of the RsDDSA expression cassette, showed the highest decanterenol yield, reaching 10.42 mg / L.

[0045] Table 2. Comparison of decanopentenol production by DPP1-4 recombinant genetically engineered bacteria .

[0046] Example 2

[0047] The recombinant genetically engineered bacterium DPP3 constructed in Example 1 lost one HisG tag and one URA3 selection marker under 5-fluoroorotic acid selection pressure. Then, through non-homologous end joining (NHEJ) mediated iterative gene integration technology, endogenous acetyl-CoA thiolase ERG10, HMG-CoA synthase ERG13, truncated hydroxymethylglutaryl-CoA reductase tHMG1, mevalonate kinase ERG12, phosphate mevalonate kinase ERG8, mevalonate diphosphate decarboxylase ERG19, IPP isomerase IDI, geranyl / farnesyl diphosphate synthase ERG20, and squalene epoxidase were integrated. ERG9 Overexpression.

[0048] Specifically, tHMG1 is overexpressed simultaneously with two copies, with PTEFI as the promoter and Txpr2t as the terminator (PTEFin-tHMG1-Txpr2t); the ERG10 expression cassette (PFBAin-ERG10-Tlip2t) and the ERG13 expression cassette (PGPD-ERG13-TCYC1t) are linked and overexpressed simultaneously; the ERG12 expression cassette (PFBAin-ERG12-Tlip2t), the ERG8 expression cassette (PTEFin-ERG8-Txpr2t), and the ERG19 expression cassette (PGPD-ERG19-TCYC1t) are linked and overexpressed simultaneously; and the ERG20 expression cassette (PFBAin-ERG20-Tlip2t) and the IDI expression cassette (PTEFin-IDI-Txpr2t) are linked and overexpressed simultaneously. After screening and verification, a series of engineered recombinant strains, DPP5-8, were obtained. In each round, a HisG tag and a URA3 selection marker were lost under the 5-fluoroorotic acid screening pressure, so that they could be used for the next round of URA screening.

[0049] Taking the simultaneous overexpression of ERG10 and ERG13 as an example, the endogenous ERG10 and ERG13 genes were obtained by genomic PCR of Yersinia lipophila. The pUFERG10 plasmid and pUGERG13 plasmid were constructed by one-step cloning. The pUFERG10 plasmid was digested with SpeI and FastAP to obtain the linearized pUFERG10 vector. The PGPD-ERG13-TCYC1t expression cassette was obtained by PCR using pUGERG13 as a template. The linearized pUFERG10 vector and the PGPD-ERG13-TCYC1t expression cassette were ligated by one-step cloning to obtain an expression plasmid containing two expression cassettes.

[0050] DPP6 was obtained through engineering iterations based on DPP5, and so on. After obtaining DPP5, a HisG tag and a URA3 selection marker were lost under 5-fluoroorotic acid selection pressure. The DPP5 cells without selection markers were then used to create competent yeast cells using the Frozen-EZ Yeast Transformation II Kit™. The aforementioned ERG10 expression cassette (PFBAin-ERG10-Tlip2t) and ERG13 expression cassette (PGPD-ERG13-TCYC1) were then transformed into competent cells using the Frozen-EZ Yeast Transformation II Kit™. The expression cassettes were integrated into the genome of DPP5 via the non-homologous end joining (NHEJ) mechanism of Yeast lipolysis. DPP6 was obtained through selection and verification. Subsequent engineered strains can be obtained in the same manner.

[0051] The cultivation and detection conditions were the same as in Example 1, and the results are shown in Table 3.

[0052] Table 3. Comparison of decanopentenol production by DPP5-8 recombinant engineered bacteria .

[0053] Example 3

[0054] The recombinant genetically engineered strain DPP8 constructed in Example 2 was subjected to 5-fluoroorotic acid selection pressure, resulting in the loss of a HisG tag and a URA3 selection marker. Then, using homologous recombination-mediated gene knockout technology, 477 bp of the N-terminus of the squalene synthase ERG9 promoter was knocked out, leaving only 50 bp to weaken the expression of squalene synthase ERG9 while ensuring the normal growth of the strain was not disrupted. The upstream homologous arm is 1311 bp, the downstream homologous arm is 1359 bp, and a hisG-URA3-hisG marker cassette is connected in the middle. The recombinant strain DPP9 was obtained through colony PCR and fermentation verification.

[0055] The culture and detection conditions were the same as in Example 1. The results are shown in Table 4.

[0056] Table 4. Comparison of decanopentenol production by DPP9 recombinant engineered bacteria .

[0057] Example 4

[0058] The recombinant genetically engineered bacteria constructed in Example 3 lost one HisG tag and one URA3 selection marker under 5-fluoroorotic acid selection pressure. The endogenous ylCOQ1 enzyme was replaced with RsDDSA through homologous recombination-mediated gene substitution, but a 120bp mitochondrial localization peptide of the endogenous COQ1 enzyme was retained at the N-terminus. This included an upstream homologous arm of 1304bp (containing the 120bp mitochondrial localization peptide), a downstream homologous arm of 1300bp, and an RsDDSA and hisG-URA3-hisG marker cassette linked in the middle. After screening and verification, the recombinant strain DPP10 (accession number CCTCC NO. M20251154) was obtained.

[0059] The culture conditions were the same as in Example 1. The results are shown in Table 5.

[0060] Table 5. Decanpentol yield of DPP10 recombinant engineered bacteria .

[0061] As can be seen from the above embodiments and experimental examples (such as...). Figure 1 The invention presents a comparative graph of decanopentenol yield in shake flasks. It describes the construction of a genetically engineered *Yarrowia lipolytica* strain for producing decanopentenol. The raw materials are readily available, and the production route is clear. Decanopentenol is a precursor for coenzyme Q10 production, and the development of this whole-cell transformation strain provides a novel "biological + chemical" method for coenzyme Q10 production. This invention reduces costs while increasing yield, making it suitable for industrial-scale production and showing great application potential.

Claims

1. A lipophilic yeast that produces decanopentenol (Yersinia lipolytica) Yarrowia lipolytica Genetically engineered bacteria, characterized in that, The method involves overexpressing the decene diphosphate synthase gene in the *Yarrowia lipolytica* strain, the sequence of which is shown in SEQ ID NO. 1; the decene diphosphate synthase gene is integrated into the *Yarrowia lipolytica* genome and overexpressed in the cytoplasm; the decene diphosphate synthase gene integrated into the genome has 3 copies. Overexpression of two copies of the tHMG1 gene of hydroxymethylglutaryl-CoA reductase, the sequence of which is shown in SEQ ID NO.2; Simultaneously overexpress the genes of acetyl-CoA thiolase ERG10 and HMG-CoA synthase ERG13; Simultaneously overexpress the genes of mevalonate kinase ERG12, mevalonate phosphate kinase ERG8, and mevalonate diphosphate decarboxylase ERG19; Simultaneously overexpressing the bifunctional enzyme ERG20 gene of gerany diphosphate synthase / farnesyl diphosphate synthase and the IPP isomerase IDI gene; The expression of the squalene synthase ERG9 gene was weakened by homologous recombination-mediated gene editing. The gene encoding the endogenous ylCOQ1 enzyme was replaced with the gene encoding RsDDSA through homologous recombination-mediated gene substitution, but the mitochondrial localization peptide of the endogenous COQ1 enzyme was retained at the N-terminus. The starting strain is *Yersinia lipolytica*, a auxotrophic strain of leucine and uracil.

2. The genetically engineered *Yarrowia lipolytica* strain according to claim 1, characterized in that: The decene diphosphate synthase gene is derived from the decene diphosphate synthase RsDDSA gene of Rhodotorula globulus, and the expression cassette of the decene diphosphate synthase gene carried by the linearized plasmid is integrated into the genome of Yersinia lipolytica through a non-homologous end joining mechanism.

3. The genetically engineered *Yarrowia lipolytica* strain according to claim 2, characterized in that: The nucleotide sequence of the decene diphosphate synthase gene was codon-optimized according to the expression preferences of Yersinia lipolytica.

4. The Yersinia lipolyticis genetically engineered strain according to claim 1, characterized in that: The starting strains are Yersinia lipolyticis E150 / CLIB122, Yersinia lipolyticis E129 / CLIB121, Yersinia lipolyticis Po1d, Yersinia lipolyticis Po1e, Yersinia lipolyticis Po1f, or Yersinia lipolyticis Po1g.

5. The genetically engineered *Yarrowia lipolytica* strain according to any one of claims 1, characterized in that: Overexpression of endogenous genes is achieved through iterative gene integration technology mediated by non-homologous end joining.

6. The genetically engineered *Yarrowia lipolytica* strain according to claim 1, characterized in that: Further overexpression of the hydroxymethylglutaryl-CoA reductase tHMG1 gene resulted in a truncated hydroxymethylglutaryl-CoA reductase tHMG1 gene.

7. The *Yarrowia lipolytica* genetically engineered strain according to any one of claims 1 to 6, characterized in that: The overexpression is controlled by a strong promoter, which is selected from any one of PTEF, Php4d, PTEFI, PFBA, PFBAin, PPOX2, PEXP, PPOT1, or PGPD and PTDH; the terminator is any one of the terminators of Yersinia lipophila, Txpr2t, Tmig1t, Tlip2t, Tcyc1t, Tpex3t, Tpex10t, or Tpex20t.

8. The genetically engineered *Yarrowia lipolytica* strain according to claim 7, characterized in that: Its accession number is: CCTCC NO.M20251154.

9. The use of the genetically engineered *Yersinia lipophila* strain as described in any one of claims 1 to 8 in the preparation of decanterenol or coenzyme Q10.

10. A method for preparing decanoisopentenol, characterized in that, It utilizes the genetically engineered *Yersinia lipophila* strain according to any one of claims 1 to 8 to produce decanpentol.

Images