Application of histone H3K4 demethyltransferase VvJMJ14 in promoting H2O2-induced grape fruit ripening

Abstract

The application discloses application of histone H3K4 demethylase VvJMJ14 in promoting H2O2-induced grape fruit ripening and belongs to the technical field of biotechnology.Combining with RNA-seq data, the application finds for the first time that VvJMJ14 is a candidate gene responding to H2O2 signal regulation of fruit ripening.The relationship between VvJMJ14 promoter activity and H2O2 treatment is verified through a GUS staining test; through a subcellular localization test, it is clear that VvJMJ14 is located in the cytoplasm; through PIR system research, it is found that silencing of VvJMJ14 promotes grape fruit ripening, and overexpression delays grape fruit ripening.The application not only helps to improve the economic value of grapes, but also promotes the cultivation of early-maturing grape varieties, and has great significance in the field of grape planting.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to the application of histone H3K4 demethyltransferase VvJMJ14 in promoting H2O2-induced ripening of grapes. Background Technology

[0002] Grapes, as a major global fruit crop, possess high nutritional and economic value and are widely used in fresh food and industrial manufacturing (Dong et al., 2023, Wei et al., 2025). The grape fruit development process, especially the ripening process, largely determines the economic value of grapes. Grape development is a complex biological process regulated by multiple intrinsic factors and influenced by epigenetic modifications (Yang et al., 2025). Elucidating the molecular mechanisms of grape fruit ripening will not only help improve the economic value of grapes but also promote the breeding of early-ripening grape varieties (Peiet et al., 2021, He et al., 2023, Jia et al., 2023).

[0003] Hydrogen peroxide (H2O2) has been reported to participate in stress response, plant development, and fruit ripening (Mittler et al., 2022; Yang et al., 2025). As a reactive oxygen species, H2O2 exhibits moderate reactivity, easy penetration through biofilms, and high stability. Under moderate doses (Winterbourn, 2013; Wei et al., 2025b), it can induce oxidative stress, which is beneficial for fruit ripening. H2O2 can also act as a signaling molecule, interacting with plant hormones and metal ions or inducing post-translational modifications, thus participating in the regulation of fruit ripening (Zhou et al., 2023). In previous studies of this invention, hydrogen peroxide treatment significantly promoted grape fruit ripening and led to differential expression of genes including small heat shock proteins, ubiquitin ligases, and ethylene response factors (Guo et al., 2019; Guo et al., 2020). Some of these genes are believed to be involved in the regulation of fruit development. In grapes, ethylene promotes fruit ripening by increasing the expression of ERF5, ERF75, and ERF104 (Li et al., 2023; Gao et al., 2025). However, the mechanisms by which they respond to H2O2 signaling to regulate fruit development are poorly understood. Furthermore, H2O2 has also been described as a factor influencing methylation, but its relationship with histone H3K4 methyltransferase in regulating grape fruit development remains unclear (Cao et al., 2013).

[0004] Histone methylation, as a histone modification, plays a crucial role in fruit ripening and is dynamically regulated by a series of methyltransferases and demethylases (Feng and Jacobsen, 2011; Ding et al., 2022; Zhu et al., 2023). Based on genome-wide analysis, the expression of senescence-associated genes (SAGs) is positively correlated with H3K4me3 levels during plant development (Brusslan et al., 2015). Overexpression of the histone methyltransferase DcATX1 significantly increases H3K4me3 levels in the promoter region of ethylene synthesis genes, leading to petal senescence (Feng et al., 2023). In tomato, overexpression of the histone demethylase SlJMJ17 delays fruit ripening by reducing H3K4me3 methylation levels (Ding et al., 2022). Previous studies have suggested that H3K4me3 plays a key role in fruit development. However, whether and how it participates in H2O2-induced grape fruit ripening remains unclear. Summary of the Invention

[0005] To address the aforementioned shortcomings in existing technologies, this invention provides the application of histone H3K4 demethyltransferase VvJMJ14 in promoting H2O2-induced grape fruit ripening. Specifically, this invention, combined with RNA-seq data, for the first time discovered that VvJMJ14 is a candidate gene for regulating fruit ripening in response to H2O2 signaling. Furthermore, GUS staining experiments confirmed the relationship between VvJMJ14 promoter activity and H2O2 treatment; subcellular localization experiments clarified that VvJMJ14 is located in the cytoplasm; and PIR system studies revealed that silencing VvJMJ14 promotes grape fruit ripening, while overexpression delays it. This invention not only helps improve the economic value of grapes but also promotes the breeding of early-ripening grape varieties, making it significant in the field of grape cultivation.

[0006] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution:

[0007] One of the objectives of this invention is to provide the application of histone H3K4 demethyltransferase VvJMJ14 in promoting grape fruit ripening, wherein the nucleotide sequence of histone H3K4 demethyltransferase VvJMJ14 is shown in SEQ ID NO.11 and the amino acid sequence is shown in SEQ ID NO.12.

[0008] Furthermore, the histone H3K4 demethyltransferase VvJMJ14 induces grape fruit ripening by promoting H2O2.

[0009] Furthermore, the histone H3K4 demethyltransferase VvJMJ14 plays a negative regulatory role in this application.

[0010] Furthermore, the negative regulation method includes silencing the gene for the histone H3K4 demethyltransferase VvJMJ14.

[0011] A second objective of this invention is to provide a primer combination for silencing the gene of histone H3K4 demethyltransferase VvJMJ14, the nucleotide sequence of which is shown in SEQ ID NO.9-SEQ ID NO.10.

[0012] A third objective of this invention is to provide a kit containing the primer combination.

[0013] The fourth objective of this invention is to provide a recombinant expression vector containing the gene for the histone H3K4 demethyltransferase VvJMJ14.

[0014] The fifth objective of this invention is to provide a host bacterium containing the gene for the histone H3K4 demethyltransferase VvJMJ14 or the recombinant expression vector.

[0015] The sixth objective of this invention is to provide the application of the primer combination, the kit, the recombinant expression vector, and / or the host bacteria in promoting grape fruit ripening.

[0016] Furthermore, the promotion of grape ripening includes promoting grape color change, promoting grape softening, and / or promoting an increase in glucose content.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] This invention, combining RNA-seq data, is the first to discover that VvJMJ14 is a candidate gene for regulating fruit ripening in response to H2O2 signaling. Furthermore, GUS staining experiments confirmed the relationship between VvJMJ14 promoter activity and H2O2 treatment; subcellular localization experiments clarified that VvJMJ14 is located in the cytoplasm; and PIR system studies revealed that silencing VvJMJ14 promotes grape fruit ripening, while overexpression delays it. This invention not only helps improve the economic value of grapes but also promotes the breeding of early-ripening grape varieties, making it of great significance in the field of grape cultivation. Attached Figure Description

[0019] Figure 1The results of sequence feature analysis of VvJMJ14 in Example 1 of this invention are shown. (a) Phylogenetic relationship between VvJMJ14 and AtJMJs. The expansion value is shown at the node. Protein sequences are downloaded from unidirectional transport and listed in Materials and Methods. (b) Multiple sequence alignment of conserved domains of VvJMJ14 and AtJMJ proteins. (c) Analysis of conserved domains of VvJMJ14.

[0020] Figure 2 The results show the activity analysis of the VvJMJJ14 promoter in Example 1 of this invention. The concentration of H2O2 solution used to treat the tobacco leaves was 150 mmol / L.

[0021] Figure 3 This shows the subcellular localization of VvJMJJ14 in Example 1 of the present invention.

[0022] Figure 4 This diagram illustrates the effect of VvJMJ14 on H2O2-induced grape ripening in Example 1 of this invention. (a) Phenotypes of control and VvJMJ14 transgenic grapes. (b) Phenotypes of H2O2-treated control and VvJMJ14 transgenic grapes. D represents the number of days. (c) Relative expression levels of VvJMJ14 in VvJMJ14-OE and VvJMJ14-RNAi grapes. (d) H3K4me3 modification levels in VvJMJ14-OE and VvJMJ14-RNAi grapes.

[0023] Figure 5 In Example 1 of this invention, the fruit firmness and sugar content of control and transgenic grapes were determined under H2O2 treatments. Specifically: (a) the effect of transgenic VvJMJ14 gene on fruit firmness; (b) the effect of transgenic VvJMJ14 gene on fruit sugar content compared to the control. Duncan's multiple range test was used to determine the significance of differences between the means (P < 0.05). D represents the number of days. Detailed Implementation

[0024] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the invention without departing from its spirit and essence are within the scope of the invention. The reagents, kits, and instruments used in the following examples are commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventional methods.

[0025] The technical solution of the present invention will be further described in detail below with reference to the embodiments.

[0026] Example 1

[0027] 1. Materials and Methods

[0028] 1.1 Plant materials

[0029] The plant material used for genetic transformation was 'Kyoho' grape berries grown under natural conditions in the experimental field of Henan University of Science and Technology. The grape berries were treated with H2O2 (150 mmol / L), with a control group included. Additionally, tobacco was used for subcellular localization and promoter activity analysis experiments, cultured in a greenhouse at 24℃ (16 h light / 8 h dark).

[0030] 1.2 Western blotting

[0031] 0.15 g of fruit pulp tissue was lysed using PlantRIPA lysis buffer (Beyotime, Shanghai), with three technical replicates. Denatured proteins were separated by SDS-PAGE gel electrophoresis and then transferred to nitrocellulose membranes (BioRad, UK). The membranes were blocked with 5% skim milk powder in Tris buffer and incubated with anti-H3K4me3 body (ChIPGrade, UK), Tri-MethylHistoneH3(Lys4) RabbitmAb, and anti-trimethylhistoneH3(Lys4) (Millipore, Germany). The bands were visualized and quantified using a Clarity Western ECL Substrate (Bio-Rad, USA) and a fully automated chemiluminescence imaging system (5200 Tanon, Shanghai).

[0032] 1.3 Plasmid Construction and Grape Transformation

[0033] The VvJMJ14 gene was overexpressed and silenced in grape berries using the pIR system, following the same methods as (Jia et al., 2023, Wei et al., 2025). The coding region of VvJMJ14 was cloned into a PIR vector to obtain an overexpression vector, which was then inserted in reverse into the PIR vector to obtain an RNAi vector. Approximately 30 days after full bloom, 200 ng of plasmid was mixed with an equal amount of IL-60-BS helper plasmid, using an empty pIR vector as a control, and grape clusters were transformed via capillary technology. Each plasmid was injected into three grape bunches, and the VvJMJ14-transformed berries were treated with H2O2 (150 μmol / L). Subsequently, berries were harvested every 5 days for phenotypic observation. The reliability of the recombinant plasmid transformation was assessed by qRT-PCR.

[0034] 1.4 Subcellular localization analysis

[0035] Subcellular localization analysis was performed using the method described in previous research (Liu et al., 2021). The CDS region (without a stop codon) of VvJMJ14 was inserted into the pCAMBIA2300 vector carrying the GFP reporter protein, with an empty pCAMBIA2300 vector serving as a control. These vectors were mixed with the tag protein and injected into tobacco leaves. Fluorescence signals were observed after two days of culture.

[0036] 1.5 Analysis of cis-acting elements and GUS staining

[0037] Using a 2kb base upstream of the transcription start site as the promoter, the promoter of VvJMJ14 was inserted into the 0390-GUS vector to obtain the ProVvJMJ14-GUS plasmid. GUS staining was performed by Agrobacterium tumefaciens according to the description in previous studies of this invention (Liu et al., 2021). ProVvJMJ14-GUS and control vectors were transformed into tobacco leaves and treated with H2O2. Subsequently, the tobacco leaves were stained and destained using a GUS staining kit (Huayueyang, Beijing).

[0038] Details of the primers used in the above experiments are as follows (the gene cloning method used in this invention is homologous recombination; lowercase letters in the following sequences represent the base sequence on the vector, i.e., homologous arm information, and uppercase letters represent the base sequence of the target gene):

[0039] VvJMJ14 (Quantitative Fluorescence)

[0040] CCCTGTTGATTGGCTGTCAC(SEQ ID NO.1)

[0041] CCATCCTTCCCACAGACACT(SEQ ID NO.2)

[0042] VvJMJ14-GUS (GUS staining)

[0043] tgggcccggcgcgccaagcttAAGAGAATAGAGCAGAGAAACC(SEQ ID NO.3)

[0044] ggtggactcctcttagaattcTCCATCAAATTTGTCCCCTTG(SEQ ID NO.4)

[0045] VvJMJ14-GFP (subcellular localization)

[0046] acagggtacccggggatccATGGAACAGTCCTCATTGGAACCAG(SEQ ID NO.5)

[0047] cctgcaggtcgactctagaTTTACATGTTTTCCGGATCTCCTCG(SEQ ID NO.6)

[0048] PIR-VvJMJ14-OE (overexpression in transgenic grapes)

[0049] cgagctcggtacccgggatccATGGAACAGTCCTCATTGGAACCAG(SEQ ID NO.7)

[0050] caggtcgacgattgctctagaTACATGTTTTCCGGATCTCCTCG(SEQ ID NO.8)

[0051] PIR-VvJMJ14-RNAi (Silencing of Transgenic Grapes)

[0052] cgagctcggtacccgggatccCGAGGAGATCCGGAAAACATGTA(SEQ ID NO.9)

[0053] caggtcgacgattgctctagaCTGGTTCCAATGAGGACTGTTCCAT(SEQ ID NO.10)

[0054] >JMJ14(Vitvi10g01120) CDS sequence of the JMJ14 gene

[0055]

[0056] >JMJ14(Vitvi10g01120) amino acid sequence

[0057]

[0058] 2. Results

[0059] 2.1 Feature Analysis of VvJMJ14

[0060] Based on RNA-seq data from grape berries treated with H2O2, Vitvi10g01120 was downregulated after H2O2 treatment and annotated as JMJ14 according to Swissport. Previous research has identified JMJ14 as a potential histone H3K4me3 demethyltransferase (Wang et al., 2023). Phylogenetic and sequence analyses indicate that VvJMJ14 is most closely related to AtMJ14 and possesses highly conserved domains, including jmjC and jmjN. Figure 1 a- Figure 1 c).

[0061] 2.2 Promoter activity analysis of VvJMJ14

[0062] To further investigate the response of VvJMJ14 to H2O2 treatment, this invention analyzed the effect of H2O2 treatment on the VvJMJ14 promoter activity. The VvJMJ14 promoter region (containing oxidation-induced related cis-acting elements) was cloned into the 0390-GUS vector and transformed into *Nicotiana benthamiana* leaves using Agrobacterium-mediated transformation. Staining with a GUS kit showed that the VvJMJ14 promoter could transcribe and activate GUS protein expression, but this transcriptional activation was significantly reduced after H2O2 treatment, resulting in a decrease in expression levels. Figure 2 ).

[0063] 2.3 Subcellular localization of VvJMJ14

[0064] To determine the functional location of VvJMJ14, this invention constructed a VvJMJ14-GFP vector and transiently transformed it into *Nicotiana benthamiana* leaves using *Agrobacterium*. After approximately 72 hours of culture, the fluorescence signal was observed using a confocal microscope. Subcellular localization results showed that VvJMJ14 was located in the cytoplasm (…). Figure 3 ).

[0065] 2.4VvJMJ14 negatively regulates fruit color change

[0066] This invention investigated the function of VvJMJ14 using a PIR system to verify its potential role in fruit ripening. The results showed that silencing VvJMJ14 significantly promoted fruit color change compared to the control. Conversely, overexpression of VvJMJ14 produced the opposite result. Figure 4 a, Figure 4c). To investigate whether VvJMJ14 regulates H3K4me3 modification, this invention detected the H3K4 methylation levels in VvJMJ14-silenced and VvJMJ14-overexpressing lines by Western blotting. Notably, compared with the control, the H3K4me3 level in VvJMJ14-silenced plants was significantly increased, while the H3K4me3 level in VvJMJ14-OE plants was significantly lower than that in the control. Figure 4 d).

[0067] To further evaluate the effects of H2O2 treatment on VvJMJ14, this invention simultaneously treated all grape berries with H2O2, including control and transgenic grapes. After H2O2 treatment, the fruit ripening of VvJMJ14-RNAi and control plants was significantly accelerated, but the fruit ripening rate of VvJMJ14-RNAi grapes was still faster than that of the control. Figure 4 b). Furthermore, while H2O2 treatment also promoted fruit ripening in VvJMJ14-OE plants, it was relatively slower compared to the control. H2O2 treatment reduced the expression of VvJMJ14 in both transgenic and control plants. Figure 4 c).

[0068] 2.5VvJMJ14 affects fruit firmness and sugar content.

[0069] Further examination was conducted on changes in fruit firmness and sugar content in VvJMJ14 transgenic fruits. Compared with the control, silencing VvJMJ14 significantly promoted fruit softening and increased sugar content. Conversely, overexpression of VvJMJ14 showed the opposite results. Figure 5 ).

[0070] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of histone H3K4 demethyltransferase VvJMJ14 in regulating grape fruit ripening, characterized in that, The nucleotide sequence of the histone H3K4 demethyltransferase VvJMJ14 is shown in SEQ ID NO.11, and the amino acid sequence is shown in SEQ ID NO.12; the histone H3K4 demethyltransferase VvJMJ14 plays a negative regulatory role in the application.

2. The application according to claim 1, characterized in that, The negative regulation method includes silencing the gene for the histone H3K4 demethyltransferase VvJMJ14.

3. The application according to claim 2, characterized in that, Silencing the histone H3K4 demethyltransferase VvJMJ14 can promote H2O2-induced grape fruit ripening.

4. The application of a primer set for silencing the histone H3K4 demethyltransferase VvJMJ14 gene and a kit containing said primer set in promoting grape fruit ripening, characterized in that... The nucleotide sequence of the histone H3K4 demethyltransferase VvJMJ14 is shown in SEQ ID NO.11, and the amino acid sequence is shown in SEQ ID NO.12; the nucleotide sequences of the primer combination are shown in SEQ ID NO.9-SEQ ID NO.

10.

5. The application according to claim 4, characterized in that, The promotion of grape ripening includes promoting grape color change, promoting grape softening, and / or promoting an increase in glucose content.

Images