Application of ZmCCT protein and related biological materials in regulating maize lodging resistance

CN121160773BActive Publication Date: 2026-08-07CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2025-10-21
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

另一方面,根倒伏至今仍难以量化,与地上部茎秆弯曲或折断不同,目前尚无有效方法来测定根系抗倒伏能力

Benefits of technology

[0049] This invention first constructs ZmCCT Analysis of transgenic maize and its lodging resistance revealed that overexpression of ZmCCT improved lodging resistance. To verify the function of ZmCCT, this invention also constructed... ZmCCT Knockout corn and analysis of its lodging resistance revealed that: ZmCCT It can reduce lodging resistance in maize. Further gene regulatory network analysis revealed that ZmCCT affects lodging resistance by regulating nine key genes, which are the genes that regulate nitrogen transport. nrt5 Genes that regulate stem development Tu1 , dwarf8 and dwarf9 Genes that regulate stem thickening ub2 , ub3 and ch1.2 Genes that regulate lignin deposition in cell walls myb69and bm4 This gene regulatory network works together to enhance stem strength, thereby increasing maize's resistance to lodging. Furthermore, this invention not only discovers that ZmCCT positively regulates maize's aboveground resistance to lodging, but also enhances maize's resistance to underground root lodging by influencing root architecture. This invention is the first to discover that the ZmCCT protein and its related biological materials participate in regulating maize lodging resistance, and will play an important role in breeding lodging-resistant maize varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses application of ZmCCT protein and related biological materials thereof in regulation of maize lodging resistance. ZmCCT Transgenic maize is constructed and its lodging resistance is analyzed, and it is found that overexpression of ZmCCT can improve the lodging resistance of maize. ZmCCT In order to verify the function of ZmCCT, the application further constructs ZmCCT Knockout maize is constructed and its lodging resistance is analyzed, and it is found that knockout of ZmCCT can reduce the lodging resistance of maize. ZmCCT In addition, the application not only finds that ZmCCT positively regulates the stem lodging resistance of the above-ground part of maize, but also can improve the lodging resistance of the underground part of maize to root lodging by affecting the root architecture. The application first finds that ZmCCT protein and related biological materials thereof are involved in regulation of maize lodging resistance, and will play an important role in cultivation of maize varieties with lodging resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of ZmCCT protein and related biomaterials in regulating lodging resistance in maize. Background Technology

[0002] Maize lodging manifests in three main types: stalk bending, stalk breakage, and root lodging. Stalk bending and breakage are related to stalk mechanical strength, which depends on morphological characteristics (such as stalk diameter and epidermal thickness) and biochemical composition (such as cellulose and lignin in cell walls). In contrast, root lodging is more related to root architecture, involving root angle, number of roots, root diameter, and especially aerial roots near the ground surface. These three types of lodging can occur at any stage of the maize growth cycle. In the later stages of growth, as ear weight increases and stalk mechanical strength decreases, the threat of lodging to yield intensifies.

[0003] Stem bending and breakage are closely related to stem strength; however, accurately, non-destructively, and repeatedly assessing stem strength remains a significant challenge. Over the years, researchers have proposed various measurement methods, each with its limitations: natural lodging scores are heavily influenced by weather, and their data are often unreliable in comparative studies; the Rind Penetrometer Resistance (RPR) assessment method uses digital devices to measure the force required to pierce the stem bark, offering quick operation but poor repeatability and difficulty in distinguishing between materials with medium and high stem strength; while the three-point bending test or X-ray scanning tomography offers high accuracy, it requires stem destruction and significant investment. In contrast, the Stalk Bending Strength (SBS) assessment method applies a lateral force to the stem at a fixed height, deviating it from the vertical direction to a set angle, and measures the force using a digital force gauge. This method offers good repeatability and is suitable for large-scale testing. More importantly, SBS is highly correlated with actual lodging rates in the field, making it a reliable predictor of lodging resistance. On the other hand, root lodging is still difficult to quantify. Unlike the bending or breaking of the above-ground stems, there is currently no effective method to measure the root system's resistance to lodging. Summary of the Invention

[0004] One object of the present invention is to provide new uses for the ZmCCT protein.

[0005] This invention provides the use of ZmCCT protein in any of the following A1)-A3): A1) Improve corn's resistance to lodging; A2) Developing transgenic maize with improved lodging resistance; A3) Maize breeding or maize variety improvement; The ZmCCT protein is any one of the proteins described in (a1)-(a4) below: (a1) The protein shown in sequence 3; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) Proteins related to lodging resistance in maize obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1); (a4) is a protein derived from corn and has more than 98% identity with (a1) and is similar to corn in terms of lodging resistance.

[0006] In the protein described in (a2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0007] In the protein described in (a3) ​​above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0008] In the protein described in (a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0009] Another object of the present invention is to provide new uses for biomaterials related to ZmCCT proteins.

[0010] This invention provides the use of biomaterials related to ZmCCT protein in any of the following A1)-A3): A1) Improve corn's resistance to lodging; A2) Developing transgenic maize with improved lodging resistance; A3) Maize breeding or maize variety improvement; The biological materials related to the ZmCCT protein are nucleic acid molecules encoding the ZmCCT protein or expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs containing the nucleic acid molecules.

[0011] The nucleic acid molecule is any one of the DNA molecules described in (b1)-(b2) below: (b1) DNA molecules shown at positions 5136-7682 of sequence 1 or sequence 2; (b2) A DNA molecule derived from corn that has more than 75% identity with (b1) and encodes the aforementioned ZmCCT protein.

[0012] Those skilled in the art can readily mutate the nucleotide sequence encoding the ZmCCT protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the ZmCCT nucleotide sequence isolated according to this invention, as long as they encode the ZmCCT protein and have the same function, are derived from and are equivalent to the nucleotide sequence of this invention.

[0013] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein constituting the amino acid sequence shown in Sequence 3 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0014] The expression cassette refers to DNA capable of expressing the ZmCCT protein in host cells, and this DNA may include, but is not limited to, promoters. ZmCCT The promoter of transcription may also include a terminator. ZmCCT A transcription terminator. Furthermore, the expression cassette may also include an enhancer sequence.

[0015] The vector can be a plasmid, granule, bacteriophage, or viral vector. The recombinant vector can be a vector for expressing the ZmCCT protein. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes).

[0016] The recombinant microorganism may be yeast, bacteria, algae, or fungi containing the above-mentioned nucleic acid molecules, expression cassettes, or recombinant vectors. Specifically, the bacteria may be Agrobacterium.

[0017] In the above applications, the lodging resistance includes resistance to stem lodging and resistance to root lodging.

[0018] The improvement of corn's resistance to lodging is reflected in the fact that when corn... ZmCCT When gene expression levels are increased, the puncture strength and stalk bending strength of corn epidermis increase, stalk diameter increases, and lignin accumulation is stronger.

[0019] The improvement of corn's resistance to root lodging is specifically manifested in when corn... ZmCCT When gene expression levels are increased, maize roots are more numerous and thicker (e.g., aerial roots and / or crown roots and / or nodal roots), root hairs are more numerous (e.g., the number of root hairs in the crown root), root length (e.g., total root length) and root weight (e.g., root dry weight) are increased.

[0020] The indicators for maize breeding or maize variety improvement mentioned above include lodging resistance (such as resistance to stalk lodging and / or resistance to root lodging).

[0021] The purpose of any of the above-mentioned maize breeding or maize variety improvement is to develop lodging-resistant maize varieties.

[0022] Another object of the present invention is to provide the use of a substance that inhibits ZmCCT in any of the following B1)-B3): B1) Reduces corn's resistance to lodging; B2) Developing transgenic maize with reduced lodging resistance; B3) Maize breeding or maize variety improvement; The substance that inhibits ZmCCT may be a substance that reduces the activity and / or content of ZmCCT protein, or inhibits... ZmCCT The substance expressed by the gene, or knockout ZmCCT Genetic material.

[0023] Furthermore, the substance that reduces the activity of ZmCCT protein may be a protein, polypeptide, or small molecule compound that inhibits the function of ZmCCT protein.

[0024] The substance that reduces ZmCCT protein content may be a substance that inhibits ZmCCT protein synthesis, promotes ZmCCT protein degradation, or knocks down (reduces) or eliminates the ZmCCT protein encoding gene.

[0025] The substance that knocks down (reduces) the ZmCCT protein-coding gene can be any nucleic acid molecule that can inhibit or interfere with the expression of the ZmCCT protein-coding gene, such as gRNA (e.g., sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA, antisense RNA, etc.

[0026] The knockout ZmCCT Genetic material can be produced in any way that prevents the host cell from producing it. ZmCCT Gene knockout is the production of functional protein products. Specific methods include removing all or part of the coding gene sequence, introducing mutations to prevent the production of functional proteins, removing or altering regulatory components (e.g., promoter editing) to prevent transcription of the coding gene sequence, and blocking translation through binding to mRNA. Typically, knockout occurs at the genomic DNA level, resulting in the cell's offspring permanently carrying the knockout.

[0027] Furthermore, the knockout ZmCCT The gene material can be a CRISPR / Cas9 gene editing system. This CRISPR / Cas9 gene editing system expresses Cas9 protein and sgRNA.

[0028] In some implementations, the target sequence of the sgRNA is shown in Sequence 4.

[0029] Another objective of this invention is to provide a method for improving the lodging resistance of corn.

[0030] The method for improving lodging resistance of maize provided by the present invention includes the following steps: increasing the content and / or activity of ZmCCT protein in recipient maize.

[0031] Another object of the present invention is to provide a method for breeding transgenic maize with improved lodging resistance.

[0032] The method for cultivating transgenic maize with improved lodging resistance provided by the present invention includes the following steps: increasing the content and / or activity of ZmCCT protein in recipient maize to obtain transgenic maize; the transgenic maize has higher lodging resistance than the recipient maize.

[0033] Furthermore, the method for increasing the content and / or activity of ZmCCT protein in recipient maize is to overexpress the gene encoding ZmCCT protein in recipient maize.

[0034] The overexpression method involves introducing the gene encoding the ZmCCT protein into the recipient maize.

[0035] Furthermore, the gene encoding the ZmCCT protein is shown in sequence 3.

[0036] In the above-mentioned method for cultivating transgenic maize with improved lodging resistance, the lodging resistance includes resistance to stalk lodging and resistance to root lodging.

[0037] In some embodiments, the lodging resistance of the transgenic maize is higher than that of the recipient maize by at least one of the following P1)-P9): P1) the epidermal puncture strength of the transgenic maize is higher than that of the recipient maize; P2) the stem bending strength of the transgenic maize is higher than that of the recipient maize; P3) the stem diameter of the transgenic maize is greater than that of the recipient maize; P4) the lignin accumulation of the transgenic maize is greater than that of the recipient maize; P5) the number of roots of the transgenic maize (e.g., the number of aerial roots and / or crown roots and / or node roots) is greater than that of the recipient maize; P6) the root diameter of the transgenic maize (e.g., the root diameter of aerial roots and / or crown roots and / or node roots) is greater than that of the recipient maize; P7) the number of root hairs of the transgenic maize (e.g., the number of root hairs of crown roots) is greater than that of the recipient maize; P8) the root length of the transgenic maize (e.g., the total root length) is greater than that of the recipient maize; P9) the root weight of the transgenic maize (e.g., the root dry weight) is greater than that of the recipient maize.

[0038] Another objective of this invention is to provide a method for reducing the lodging resistance of corn.

[0039] The method for reducing lodging resistance of maize provided by the present invention includes the following steps: reducing the content and / or activity of ZmCCT protein in recipient maize.

[0040] Furthermore, the method for reducing the content and / or activity of ZmCCT protein in recipient maize is to introduce the aforementioned ZmCCT-inhibiting substance into recipient maize.

[0041] Furthermore, the substance inhibiting ZmCCT can be a CRISPR / Cas9 gene editing system. The CRISPR / Cas9 gene editing system expresses Cas9 protein and sgRNA; the target sequence of the sgRNA is shown in Sequence 4.

[0042] The final objective of this invention is to provide a method for breeding transgenic maize with reduced lodging resistance.

[0043] The method for cultivating transgenic maize with reduced lodging resistance provided by the present invention includes the following steps: reducing the content and / or activity of ZmCCT protein in recipient maize to obtain transgenic maize; the lodging resistance of the transgenic maize is lower than that of the recipient maize.

[0044] Furthermore, the method for reducing the content and / or activity of ZmCCT protein in recipient maize is to introduce the aforementioned ZmCCT-inhibiting substance into recipient maize.

[0045] Furthermore, the substance that inhibits ZmCCT is a CRISPR / Cas9 gene editing system; the CRISPR / Cas9 gene editing system expresses Cas9 protein and sgRNA; the target sequence of the sgRNA is shown in Sequence 4.

[0046] In the above-mentioned method for breeding transgenic maize with reduced lodging resistance, the lodging resistance includes resistance to stalk lodging and resistance to root lodging.

[0047] In some embodiments, the lodging resistance of the transgenic maize is lower than that of the recipient maize, manifested in at least one of the following Q1)-Q9): Q1) The epidermal puncture strength of the transgenic maize is lower than that of the recipient maize; Q2) The stem bending strength of the transgenic maize is lower than that of the recipient maize; Q3) The stem diameter of the transgenic maize is smaller than that of the recipient maize; Q4) The lignin accumulation of the transgenic maize is less than that of the recipient maize; Q5) The number of roots (e.g., the number of aerial roots and / or crown roots and / or node roots) of the transgenic maize is less than that of the recipient maize; Q6) The root diameter of the transgenic maize (e.g., the root diameter of aerial roots and / or crown roots and / or node roots) is less than that of the recipient maize; Q7) The number of root hairs (e.g., the number of root hairs of crown roots) of the transgenic maize is less than that of the recipient maize; Q8) The root length (e.g., the total root length) of the transgenic maize is less than that of the recipient maize; Q9) The root weight (e.g., the root dry weight) of the transgenic maize is less than that of the recipient maize.

[0048] The corn mentioned above can specifically be the corn line HiII or the corn inbred line LH244.

[0049] This invention first constructs ZmCCT Analysis of transgenic maize and its lodging resistance revealed that overexpression of ZmCCT improved lodging resistance. To verify the function of ZmCCT, this invention also constructed... ZmCCT Knockout corn and analysis of its lodging resistance revealed that: ZmCCT It can reduce lodging resistance in maize. Further gene regulatory network analysis revealed that ZmCCT affects lodging resistance by regulating nine key genes, which are the genes that regulate nitrogen transport. nrt5 Genes that regulate stem development Tu1 , dwarf8 and dwarf9 Genes that regulate stem thickening ub2 , ub3 and ch1.2 Genes that regulate lignin deposition in cell walls myb69and bm4 This gene regulatory network works together to enhance stem strength, thereby increasing maize's resistance to lodging. Furthermore, this invention not only discovers that ZmCCT positively regulates maize's aboveground resistance to lodging, but also enhances maize's resistance to underground root lodging by influencing root architecture. This invention is the first to discover that the ZmCCT protein and its related biological materials participate in regulating maize lodging resistance, and will play an important role in breeding lodging-resistant maize varieties. Attached Figure Description

[0050] Figure 1 Pearson correlation coefficients between stalk bending strength (SBS) and other key agronomic traits in maize association mapping populations.

[0051] Figure 2 ZmCCT, controlling SBS, was identified through QTL mapping and association analysis. A shows the QTL controlling SBS located in the B73×Ki11 RIL population. B shows the stem deviation angle of the two NILs when the same lateral force was applied to the stem. C shows the cross-section between the fourth stem node of the two NILs. D and E show the results of phloroglucinol staining of the epidermis between the stem nodes of the two NILs. F shows the individual plant phenotype of the two NILs in the later stages of growth. G shows the overall field performance of the two NILs in the later stages of growth.

[0052] Figure 3 To illustrate the control of flowering time in maize by ZmCCT. A shows the QTL controlling DTT located in the B73×Ki11 RIL population. B shows violin diagrams of SBS, RPR, and DTA for two NILs. C shows the association signal controlling SBS identified on maize chromosome 10. D shows violin diagrams of SBS for two lines with and without transposon insertions in the maize association mapping population.

[0053] Figure 4 To enhance SBS by upregulating ZmCCT expression through transformation. A is... ZmCCT In transgenic maize plants and negative control plants ZmCCT Gene expression patterns, where leaf-V5, leaf-V16, 5-cm IN, 4th IN, and rind of 4th IN represent leaves at stage V5, leaves at stage V16, internodes developing to 5-cm length, the fourth above-ground internode, and its epidermis, respectively. B represents the expression pattern when the same lateral force is applied to the stem. ZmCCT The angle of deviation of the stems of transgenic maize plants and negative control plants. C represents... ZmCCT Cross-section of the fourth stem node above ground in transgenic maize plants and negative control plants. D and E represent... ZmCCT The results of phloroglucinol staining on the internode epidermis of transgenic maize plants and negative control plants. F represents... ZmCCTViolin diagrams of SBS, RPR, and DTA in transgenic maize plants and negative control plants.

[0054] Figure 5 CRISPR-Cas9 knockout of ZmCCT reduces SBS. A shows the editing sites during ZmCCT knockout analysis. B shows... ZmCCT Bar chart of SBS values ​​for corn knockout and wild-type plants. C represents... ZmCCT Bar chart of RPR for knockout maize and wild-type plants. D represents... ZmCCT Individual plant phenotypes during the grain-filling stage in knockout maize and wild-type plants. E represents... ZmCCT Knockout root phenotypes of maize and wild-type plants during the grain-filling stage.

[0055] Figure 6 for ZmCCT Transgenic maize plants (TP-) stiff2 RNA-seq analysis between the negative control plants (NTPs) and the negative control plants. A is... ZmCCT Volcano diagram of differentially expressed genes in transgenic maize plants and negative control plants. B represents... ZmCCT GO analysis results of differentially expressed genes in transgenic maize plants and negative control plants.

[0056] Figure 7 Regulated by ZmCCT ub2 , ub3 and ch1.2 Phenotypic analysis of gene mutants. A is a double mutant. ub2ub3 Individual plant phenotypes of wild-type and wild-type plants. B represents the double mutant when the same lateral force is applied to the stem. ub2ub3 The angle of deviation from the stem of the wild-type plant. C is a double mutant. ub2ub3 Bar chart of SBS in wild-type plants and D is a double mutant. ub2ub3 Bar chart of RPR for wild-type plants and E is a double mutant. ub2ub3 A bar chart showing the stem thickness of the wild-type plant. F represents... ch1.2 Individual plant phenotypes of mutant and wild-type plants. G represents the effect of applying the same lateral force to the stem. ch1.2 The angle of deviation of the stems of mutant and wild-type plants. H is... ch1.2 Bar charts of SBS values ​​for mutant and wild-type plants. I represents... ch1.2 Bar chart of RPR for mutant and wild-type plants. J represents... ch1.2 A bar chart showing the stem thickness of mutant and wild-type plants.

[0057] Figure 8 ZmCCT controls the development of maize root structure. A is... ZmCCT Root structure of transgenic maize plants and negative control plants. B represents... ZmCCTThe number of crown roots per layer and root thickness phenotype in transgenic maize plants and negative control plants. C and D are... ZmCCT Root hair phenotype of transgenic maize plants and negative control plants. E represents... ZmCCT A bar chart showing the number of nodal roots, crown roots, and aerial roots in transgenic maize plants and negative control plants cultured in sandy soil. F represents... ZmCCT Bar graph showing root diameter of transgenic maize plants and negative control plants. G represents... ZmCCT Bar chart of total root length of transgenic maize plants and negative control plants. H represents... ZmCCT A bar chart of root dry weight of transgenic maize plants and negative control plants. I represents... ZmCCT A bar chart showing the number of node roots, crown roots, and aerial roots in transgenic maize plants and negative control plants under field planting conditions. J represents... ZmCCT Comparison of the aerial root structure of transgenic maize plants and negative control plants. Detailed Implementation

[0058] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0060] In the following embodiments ZmCCT The genomic sequence of the gene is shown in positions 5136-7682 of Sequence 1, the CDS sequence is shown in Sequence 2, and the amino acid sequence encoding the ZmCCT protein is shown in Sequence 3. In this invention, ZmCCT Also known as stiff2 Both refer to the same gene.

[0061] The pCAMBIA3301 vector and maize line HiII used in the following examples are described in the literature "CACTA-like transposable element in ZmCCT attenuated photoperiod sensitivity and accelerated the postdomestication spread of maize, PNAS, 2013."

[0062] The pXUE411C vector in the following examples is described in the literature “A CRISPR / Cas9 toolkit for multiple genome editing in plants, BMC Plant Biology, 2014”.

[0063] The maize inbred line LH244 in the following examples is described in the literature " ZmEREB46 , a maize ortholog of Arabidopsis WAX INDUCER1 / SHINE1, is involved in the biosynthesis of leafepicuticular very-long-chain waxes and drought tolerance, Plant Science, 2022."

[0064] Example 1: Relationship between corn stalk bending strength (SBS) and other agronomic traits To investigate the relationship between stem bending strength (SBS) and other agronomic traits in maize, Pearson correlation analysis was performed on 22 agronomic traits in a 282-association panel comprising 260 maize inbred lines. Figure 1). These 22 traits include stem bending strength (SBS), days to tassel (DTT), days to silk (DTS), plant height (PH), ear height (EH), tassel length (TL), main spike length (MSL), tassel branch number (TBN), leaf length (LL), leaf width (LW), upper leaf angle (LA), middle leaf angle (MLA), seed starch content (SSC), seed protein content (SPC), seed oil content (SOC), cob diameter (CD), cob weight (CW), ear diameter (ED), ear length (EL), seed set length (SSL), kernel row number (KRN), and ear weight (…). SBS showed a significant positive correlation with 12 of the other 21 traits (r>0.15, P<0.05), however, no significant correlation was detected with MSL, SPC, CD, CW, ED, EL, SSL, and KRN. SBS showed a weak but significant negative correlation with SSC (r = -0.18, P<0.01), suggesting that distributing more starch from the stalk to the kernel may reduce stalk quality. A strong correlation was detected between SBS and key plant architecture traits (including DTT, DTS, PH, EH, LL, and LA) (r ≥ 0.5), and these six traits also showed strong correlations among themselves, suggesting they may share a common genetic basis. These results indicate that DTT may play a central role in shaping maize plant architecture and SBS.

[0065] Example 2 ZmCCT The discovery of gene control of maize SBS In a population of recombinant inbred lines (RILs) constructed from crosses of maize inbred lines B73 and Ki11, a QTL controlling SBS was identified at 41 centimoles (cM) on chromosome 10. Figure 2 A). Name this QTL... stiff2This can explain 6.4% of the total phenotypic variation. Meanwhile, in this RIL population, a major QTL controlling DTT is associated with... stiff2 Co-located ( Figure 3 A). Furthermore, the known controls for DTT... ZmCCT The gene is located within this DTT major QTL. ZmCCT The gene encodes a protein containing a CCT domain, and a 5-kb transposon insertion in its promoter region induces downregulation of its transcriptional level, leading to earlier flowering in temperate maize. Then, comparisons were made between the two parental lines, B73 and Ki11. ZmCCT Gene sequencing revealed a 5-kb transposon insertion in B73. ZmCCT In the promoter, but not in Ki11 ( Figure 2 A). Aside from a few SNPs and short indels, B73 and Ki11... ZmCCT No major variations were found in the gene region sequence. Two near-isogenic lines (NILs) were constructed to compare phenotypes, compared with NILs containing a 5-kb transposon insertion. stiff2 Compared to -TE+, there is no inserted NIL- stiff2 -TE- exhibits stronger SBS and RPR, thicker stem diameter, and later day-to-anthesis (DTA). Figure 2 B. Figure 2 C and Figure 3 B). Staining the internode epidermis of these two types of NILs with phloroglucinol revealed NIL- stiff2 -TE- showed higher staining intensity, indicating that lignin deposition was higher compared to NIL-. stiff2 -TE+ more ( Figure 2 D and Figure 2 E). The leaves and stems of both NILs wither in the later stages of growth, but NIL- stiff2 -TE+ stems have bent or even broken, while NIL-tiff2-TE- stems remain upright in the field. Figure 2 F and Figure 2 G).

[0066] Next, ZmCCT The presence or absence of a 5-kb transposon insertion in the promoter was used as an indel marker, combined with high-density SNPs on chromosome 10, to perform association analysis of SBSs in a maize association-mapped population. ZmCCT The strongest correlation signal was detected at the 5-kb indel of the promoter. P = 2.03×10 -6 () Figure 3 C). In order to evaluate ZmCCTThe genetic effects of genes in maize association-mapped populations were compared between maize inbred lines with and without 5-kb transposon insertions, and the results showed that... ZmCCT SBS in maize inbred lines without a 5-kb insertion in the promoter was significantly stronger than SBS in inbred lines with a 5-kb insertion. Figure 3 D).

[0067] The results of the above QTL location and association analysis show that stiff2 QTL corresponds to chromosome 10 ZmCCT Genes control SBS in maize.

[0068] Example 3 ZmCCT Preparation of transgenic maize and analysis of its lodging resistance phenotype one, ZmCCT Preparation of genetically modified corn 1. ZmCCT Construction of expression carrier The DNA molecule shown in sequence 1 was ligated into the SacI restriction site of the pCAMBIA3301 vector to obtain... ZmCCT Expression vector. In the DNA molecule shown in Sequence 1, positions 1-5135 are the promoter sequence, and positions 5136-7682 are... ZmCCT The genome sequence, positions 7683-8147 are 3' UTR sequences.

[0069] 2. Construction of recombinant bacteria The construction in step 1 ZmCCT The expression vector was introduced into Agrobacterium LBA4404, and after identification, it was found to contain... ZmCCT Recombinant bacteria expressing vectors.

[0070] 3. Preparation of genetically modified corn Agrobacterium-mediated genetic transformation utilizes... ZmCCT The recombinant bacteria expressing the vector genetically transformed the immature embryos of maize line HiII to obtain T0 generation transgenic maize plants. Specific steps can be found in the literature "Agrobacterium-mediated transformation of maize, Nature Protocols, 2007". The T0 generation transgenic maize plants were then subjected to multiple generations of self-pollination to obtain a self-pollinated progeny population.

[0071] 4. ZmCCT PCR identification of genetically modified maize The transgenic maize plants were identified using PCR in a population of self-pollinated progeny from non-homozygous transgenic maize plants. ZmCCT Transgenic positive maize plants (denoted as TP-) stiff2) and negative control plants (denoted as NTP). The PCR identification primer sequences are as follows: TGTCATTCTCTGGGAGCACATTCAC (located in ZmCCT The gene region) and CAGGAAACAGCTATGAC (located on the vector). PCR can amplify a 744bp band in individuals. ZmCCT Transgenic positive maize plants, and individuals that cannot amplify the corresponding band, are negative control plants.

[0072] 5. Real-time quantitative PCR detection ZmCCT Gene expression level Extracted at different times ZmCCT RNA from transgenic positive maize plants and negative control plants was reverse transcribed to obtain cDNA. Then, using the cDNA as a template, qRT-PCR was performed using primers ATGAGAACGACGACCAGCCT and GTGAATGTGCTCCCAGAGAATG. Each genotype sample contained three biological replicates, and each biological replicate contained three technical replicates. ZmGADPH As an internal reference gene, 2 –ΔΔct Calculation by relative quantitative method ZmCCT The relative expression level of genes.

[0073] The results showed that: in TP- stiff2 middle, ZmCCT Expression levels were relatively low in leaves at stages V5 and V16, as well as in internodes developing to 5 cm in length, but higher in the 4th internode and epidermis at stage V16. Figure 4 A). With TP- stiff2 In contrast, in the negative control plants (NTP), all these tissues ZmCCT The expression was lower ( Figure 4 A).

[0074] two, ZmCCT Phenotypic analysis of lodging resistance in transgenic maize plants 1. Tests for epidermal puncture strength (RPR) and stem bending strength (SBS) The epidermal puncture intensity (RPR) was measured using a puncture instrument (ELECALL, YLK-500 model). After the grain filling period (approximately 20 to 30 days after pollen shedding), three punctures were made at the upper 1 / 4, middle, and lower 1 / 4 of the fourth internode above ground on a single plant. The peak value during the puncture process was recorded, and the average of the three peak values ​​was taken as the RPR phenotypic value of a single plant.

[0075] Stem bending strength (SBS) was measured using a homemade stem strength measuring instrument modified from a puncture instrument. After the grain filling period (approximately 20 to 30 days after pollen shedding), the tensile force required to deviate 20° from the ground was measured at 50 cm above the ground, and the peak value was recorded as the SBS phenotypic value of the individual plant.

[0076] The results showed that compared with NTP, it had a higher ZmCCT TP expression stiff2 It exhibits stronger SBS and RPR, and blooms three days later than NTP. Figure 4 F). Under the same applied external force, compared with NTP, TP- stiff2 The stem bends at a small angle from the vertical direction ( Figure 4 B).

[0077] 2. Stem diameter detection Stem diameter was measured using vernier calipers, specifically the short axis stem diameter (shortest diameter of the stem cross-section) at the midpoint of the fourth internode above ground on a single plant. Results showed that compared to NTP, TP- stiff2 The stem diameter increased significantly ( Figure 4 C).

[0078] 3. Lignin accumulation detection After the grain-filling period (approximately 20 to 30 days after pollination), cut the fourth internode of the corn stalk above ground, wrap it with plastic wrap, and store it in a refrigerator at 4°C for a short period. On the cross-section of the stalk, use a single-edged blade to cut a thin slice with a thickness of 0.5-1 mm, keeping the slice thickness basically uniform. Place the materials of both genotypes on the same glass slide and add pure water to keep it moist. Prepare the phloroglucinol working solution: dilute the phloroglucinol stock solution with concentrated hydrochloric acid. Based on the results of multiple preliminary experiments, when finally selecting samples for observing NIL and transgenic materials, dilute the stock solution 5 times and 10 times respectively. Under a dissecting microscope (OLYMPUS SZX10), use absorbent paper to remove the pure water from the slices, quickly add the same volume of phloroglucinol working solution to each slice, stain, and observe and photograph quickly.

[0079] Phloroglucinol staining showed that, compared with NTP, TP- stiff2 Lignin accumulation is stronger in the stem bark. Figure 4 D and E). The above results indicate that overexpression ZmCCT It can improve the lodging resistance of corn.

[0080] Example 4 ZmCCT Preparation of knockout maize and analysis of its lodging resistance phenotype one, ZmCCT Construction of corn knockout 1. ZmCCT Construction of knockout vector 1) ZmCCTDesign of knockout targets On the CRISPR-P v2.0 webpage (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), according to ZmCCT The gene CDS sequence was used to design suitable target sites, and the final target sequence obtained was as follows: TCGGGGTGCCTGCACGAGTTCC (Sequence 4).

[0081] 2) ZmCCT Construction of knockout vector The 22bp sequence shown in sequence 4 ZmCCT The gene target sequence was ligated between the BsaI restriction sites of the pXUE411C vector, while keeping the other sequences of the pXUE411C vector unchanged, to obtain... ZmCCT Knock out the carrier. ZmCCT Knockout vector expresses Cas9 nuclease and target ZmCCT The sgRNA of a gene.

[0082] 2. Obtaining recombinant bacteria Will ZmCCT The knockout vector was introduced into Agrobacterium EHA105, and after identification, it was found to contain... ZmCCT Agrobacterium EHA105 with knockout vector.

[0083] 3. Obtaining genetically modified corn Agrobacterium-mediated genetic transformation utilizes... ZmCCT Agrobacterium EHA105 with the knockout vector was used to genetically transform the immature embryos of the maize inbred line LH244 to obtain T0 generation transgenic maize plants. Specific steps can be found in the literature "Agrobacterium-mediated transformation of maize, Nature Protocols, 2007".

[0084] 4. ZmCCT Identification of knockout corn DNA analysis of T0 generation transgenic maize plants was performed using primers GCTTTTATTTATCTGCTCCTTCC and GTTTTCTTCCATCCATTTCG to determine the editing mode. T1 generation seeds were obtained and sown in a greenhouse. The T1 generation transgenic plants were then amplified and sequenced again to determine the stable inheritance of the editing mode and the homozygosity of the editing sites. Finally, the desired results were obtained. ZmCCT Knockout homozygous edited maize lines (i.e., those with identical mutations on both chromosomes) are named... stiff2-CR .

[0085] Compared with the sequence of wild-type maize inbred line LH244, stiff2-CR The difference lies only in ZmCCT A one-base deletion occurred in the CDS sequence (Sequence 2) of the gene, located at position 186. This caused a frameshift and premature termination of protein translation, resulting in loss of function of the ZmCCT protein. Figure 5 A).

[0086] two, ZmCCT SBS phenotypic analysis of knockout maize Compared to the wild-type plant (LH244), stiff2 -CR showed a significant decrease in SBS and RPR ( Figure 5 B and C), stem diameter decreased ( Figure 5 D). These results indicate that knockout ZmCCT It can reduce the lodging resistance of corn.

[0087] Example 5 ZmCCT Gene network regulating maize SBS In order to determine ZmCCT How to regulate SBS in corn and its effect on TP- stiff2 RNA-seq analysis was performed on the epidermal tissue of the 4th internode of NTP plants. Figure 6 A). RNA-seq results revealed 3672 differentially expressed genes (DEGs), and compared with NTPs, TP- stiff2 Of these 3672 DEGs, 1544 were upregulated and 2128 were downregulated. Based on these DEGs, GO enrichment analysis identified 166 enriched GO terms, which were associated with biological processes, molecular functions, and cellular components, respectively. Figure 6 B). The five enriched GO terms are related to nitrogen biosynthesis and metabolism, including organic nitrogen biosynthesis, organic nitrogen metabolism, nitrogen metabolism, cellular nitrogen metabolism, and cellular nitrogen biosynthesis. Figure 6 B). Among them, the biosynthesis of organic nitrogen compounds, the metabolism of organic nitrogen compounds, and the metabolism of nitrogen compounds ranked among the top ten enriched GO items (B). Figure 6 (B) Nitrogen is crucial for maize growth and development, especially during the jointing stage. Sufficient nitrogen ensures stem elongation and thickening, as well as the transition from vegetative to reproductive growth. In addition to nitrogen-related processes, pathways related to photosynthesis, response to light stimuli, and circadian rhythms were also enriched. These results indicate that nitrogen biosynthesis and metabolic pathways play a vital role in maize stem development.

[0088] In TP- stiff2 Of the 1544 upregulated DEGs compared to NTPs, three are known to be associated with maize stalk development, including Tunicate 1 ( Tu1 , Zm00001d052180 ), dwarf8 ( d8 )and dwarf9 ( d9 () Figure 6 A). Tu1 , d8 and d9 Upregulation of these genes promotes stem development and increases plant height. Genes involved in nitrogen transport... nrt5 ( Zm00001d011679 ), unbranched2 ( ub2 , Zm00001d031451 )and unbranched3 ( ub3 , Zm00001d052890 The expression level of ) was moderately upregulated ( Figure 6 A). ub2 and ub3 These are candidate genes controlling stem thickness, and their orthologous genes... OsSPL14 Controlling tiller thickness in rice significantly improves lodging resistance (Jiao et al., 2010). Photosynthesis-related... ch1.1 ( Zm00001d042026 )and ch1.2 ( Zm0001d011819 ), is Arabidopsis thaliana ch1 The orthologous gene encodes chlorophyll A oxygenase (CAO). Compared to NTPs, these two genes differ in TP- stiff2 The expression level in [the sample] was significantly increased by more than six times. Figure 6 A). Conversely, two known cell wall lignin deposition genes, myb69 ( Zm00001d023282 )and bm4 ( Zm0001d048514 Slightly increased ( Figure 6 A).

[0089] In order to determine ub2 , ub3 and ch1 Whether or not SBS in maize is regulated, mutants of these three genes were obtained. Figure 7 Each contains Mu The rotating connector is inserted ub2 and ub3 Mutants are hybridized to produce double mutants. ub2ub3 . ub2ub3 The mutant exhibits an extremely slender plant type, with weak stems, narrow leaves, and reduced branching of the tassels. Figure 7 A). Under the same external force, ub2ub3 The stems of the mutant are more easily bent than those of the wild-type B73. Figure 7 B). Detailed phenotypic correspondence, compared to wild-type B73, ub2ub3The mutant showed significantly reduced SBS, RPR, and stem diameter. Figure 7 CE). In comparison, ch1.2 The mutant possesses a G-to-T mutation at 478 bp in the coding sequence (CDS), leading to premature termination. Compared to wild-type B73, this... ch1.2 The mutant's leaves are pale green ( Figure 7 F), the stems are also weaker, SBS and RPR are reduced, and the stem thickness becomes thinner (F). Figure 7 GJ).

[0090] The above results collectively indicate that stiff2 Upregulate NRT5, which is involved in nitrogen translocation, and stem development. Tu1 , d8 and d9 Thickened stems ub2 , ub3 and ch1.2 and cell wall lignin deposition myb69 and bm4 This expression enhances the strength of the corn stalk.

[0091] Example 6 ZmCCT Simultaneously regulate the resistance of corn to stalk lodging and root lodging. Maize stalk lodging includes three types: stalk bending, stalk breakage, and root lodging. Among these, root lodging causes greater yield loss than above-ground stalk lodging in the later stages of development. However, no genes have yet been identified that enhance resistance to root lodging. The maize nodal root system mainly consists of two types of roots: aerial roots growing from above-ground nodes and crown roots growing from underground nodes. These roots are the primary pathways for water and nutrient absorption. Importantly, aerial roots, especially those growing from lower above-ground nodes, typically penetrate downwards into the soil, anchoring the plant and providing mechanical support. The structure of the maize crown and aerial roots plays a major role in resisting root lodging. The above research found... ZmCCT Genes are key regulatory genes for the structure of maize stalks. ZmCCT It regulates stalk thickening and lignin deposition in cell walls, thereby enhancing maize's resistance to lodging. Figure 4 (BF). This reinforcement directly improves the stem's resistance to stem bending and breakage in the above-ground parts.

[0092] In order to determine ZmCCT Whether it also controls root structure development was compared under sandy soil culture (corn seedlings were transplanted into sandy soil and cultured using a complete nutrient solution) and field planting conditions, respectively. stiff2 Root structure between NTPs. Root phenotype was investigated during mid-jointing stage in sand-based culture. Figure 8 AH); When planted in the field, the root phenotype was investigated during the flowering period ( Figure 8I). The survey results show that compared with NTP, ZmCCT Increased TP gene expression stiff2 It exhibits a larger root system, with more and thicker aerial roots and crown roots. Figure 8 B, E, and F), the number of root hairs on the crown root increased significantly ( Figure 8 C and D), total root length (TRL) and dry root weight (DRW) were significantly increased. Figure 8 G and H). Compared to the mid-stage of jointing ( Figure 8 E) Similarly, during the flowering period, TP- stiff2 The number of nodal roots (RN), crown roots (CRN), and aerial roots (ARN) were all significantly increased compared to NTP. Figure 8 I). Furthermore, during the flowering period, TP- stiff2 The growth rate of ARN was stronger than that of CRN. Figure 8 E and I). These changes collectively shape a stronger root structure, particularly the aerial root structure (E and I). Figure 8 J), thereby enhancing the plant's resistance to root lodging. Furthermore, compared to LH244, stiff2 -CR has a weaker aerial root structure ( Figure 5 E).

[0093] In summary, ZmCCT It not only positively regulates the resistance of the aboveground parts of plants to stem lodging, but also plays an important role in improving the resistance of the underground parts of plants to root lodging.

Claims

1. Application of ZmCCT protein in any of the following A1)-A3): A1) Improve corn's resistance to lodging; A2) Developing transgenic maize with improved lodging resistance; A3) Lodging-resistant maize breeding; The ZmCCT protein is any one of the proteins described in (a1)-(a2) below: (a1) The protein shown in sequence 3; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1).

2. Use of biomaterials related to the ZmCCT protein of claim 1 in any of the following A1)-A3): A1) Improve corn's resistance to lodging; A2) Developing transgenic maize with improved lodging resistance; A3) Lodging-resistant maize breeding; The biological material is a nucleic acid molecule encoding the ZmCCT protein of claim 1 or an expression cassette containing the nucleic acid molecule, a recombinant vector, a recombinant microorganism, a transgenic maize cell line, a transgenic maize tissue, or a transgenic maize organ.

3. The application according to claim 2, characterized in that: The nucleic acid molecule is the DNA molecule shown in sequence 1, positions 5136-7682, or sequence 2.

4. The application according to any one of claims 1-3, characterized in that: The lodging resistance includes resistance to stem lodging and resistance to root lodging.

5. A method for improving lodging resistance in maize, comprising the following steps: increasing the content of ZmCCT protein in recipient maize; wherein the ZmCCT protein is any one of the proteins described in (a1)-(a2) below: (a1) The protein shown in sequence 3; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1).

6. A method for cultivating transgenic maize with improved lodging resistance, comprising the following steps: increasing the content of ZmCCT protein in recipient maize to obtain transgenic maize; wherein the transgenic maize exhibits higher lodging resistance than the recipient maize; and wherein the ZmCCT protein is any one of the proteins described in (a1)-(a2) below: (a1) The protein shown in sequence 3; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1).

7. The method according to claim 5 or 6, characterized in that: The lodging resistance includes resistance to stem lodging and resistance to root lodging.