A high-temperature-resistant SNP molecular marker located at a gbar_d01_54580356 locus of sea island cotton and application thereof
By designing SNP molecular markers and primer sets at the Gbar_D01_54580356 site in sea island cotton, the problem of high-temperature resistance assessment of sea island cotton was solved, enabling rapid identification and breeding support, and improving breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-13
- Publication Date
- 2026-07-21
AI Technical Summary
The lack of effective molecular markers for assessing and detecting high-temperature resistance in cotton pollen from island cotton has led to slow breeding progress, and the decline in pollen viability caused by extreme high temperatures has affected global cotton production.
This invention provides an SNP molecular marker located at the Gbar_D01_54580356 site in Sea Island cotton and its application. PCR amplification is performed by designing specific primer sets, and the PCR products are detected by electrophoresis to distinguish between heat-resistant and heat-sensitive Sea Island cotton germplasm.
This technology enables rapid identification of high-temperature resistance in sea island cotton, improves breeding efficiency, accurately assesses the high-temperature resistance of germplasm, and supports the technical foundation for cotton breeding.
Smart Images

Figure CN121160914B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of cotton breeding technology, and in particular relates to a high-temperature resistant SNP molecular marker located at the Gbar_D01_54580356 site in sea island cotton and its application. Background Technology
[0002] Tetraploid Sea Island cotton ( Gossypium barbadense High-quality cotton, known for its long fibers and high quality, is an important raw material for high-end textiles. In recent years, the intensifying trend of global warming and the frequent occurrence of extreme heat events have severely disrupted the reproductive physiology of cotton, leading to a surge in the incidence of male sterility, particularly a significant decline in pollen viability, ultimately causing regional yield declines. Among these varieties, Sea Island cotton, due to its narrow genetic background and sensitivity to high temperatures during its reproductive period, has experienced particularly significant yield reductions. These cascading effects not only threaten the stability of the agricultural economic systems in major cotton-producing regions worldwide but also exacerbate supply chain risks through the unsustainability of the textile raw material supply chain. Therefore, cultivating heat-resistant cotton germplasm has become an urgent breakthrough direction for ensuring the resilient development of the cotton industry.
[0003] Pollen viability is an important phenotypic characteristic of cotton male reproductive organs, and it is highly susceptible to high temperatures. Pollen viability levels are closely related to cotton pollination, fertilization, and ultimately, fiber yield. Traditional phenotypic assessment methods typically involve field planting and collecting data on anther traits. However, with the development of molecular biology techniques, germplasm resource and variety identification have entered the molecular level. Molecular markers based on DNA polymorphism have become powerful tools for analyzing biological genetic diversity, rapidly assisting breeding, reducing costs, and shortening breeding cycles.
[0004] With the development of whole-genome sequencing and resequencing technologies, the development and utilization of SNP loci have been successfully applied in soybean, rice, potato, and upland cotton. However, the genetic resources of cultivated varieties of island cotton are limited, and the innovation of germplasm resources and the development of new varieties are relatively slow. At the same time, due to the complex phenotype of high-temperature resistance in cotton and the numerous influencing factors, no molecular markers for assessing and detecting high-temperature resistance and pollen viability in island cotton have been reported. Summary of the Invention
[0005] In view of this, the purpose of this invention is to provide a high-temperature resistant SNP molecular marker located at the Gbar_D01_54580356 site in sea island cotton and its application.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a heat-resistant molecular marker for sea island cotton, wherein the molecular marker includes SNP sites; The SNP site is located at position 54580356 on chromosome D01 of the cotton island genome. When the deoxynucleotide at the SNP site is G, it is heat-resistant island cotton; When the deoxynucleotide at the SNP site is not G, it is a high-temperature sensitive island cotton. The nucleotide sequence containing the SNP site is shown in SEQ ID NO.1.
[0007] The present invention provides a primer set for amplifying the molecular marker, including an upstream primer and a downstream primer, wherein the upstream primer is shown in SEQ ID NO.4; The downstream primer is shown in SEQ ID NO.5.
[0008] This invention provides a kit for detecting the high-temperature resistance of sea island cotton, the kit comprising the primer set and PCR amplification reagent.
[0009] Preferably, the PCR amplification reagents include Taq DNA polymerase, dNTPs, and buffer reagents.
[0010] This invention provides the application of the aforementioned molecular markers, primer sets, or kits in detecting the thermostable phenotype of cotton plants from islands.
[0011] This invention provides the application of the aforementioned molecular markers, primer sets, and reagent kits in the breeding of island cotton.
[0012] This invention also provides a method for detecting the high-temperature resistance of island cotton, comprising the following steps: The genomic DNA of the target sea island cotton germplasm was amplified by PCR using the primer set described above to obtain PCR amplification products; The PCR amplification product was detected by electrophoresis. When the PCR amplification product had a 236bp band, the tested sea island cotton germplasm was a heat-resistant sea island cotton germplasm. When the PCR amplification product fails to specifically amplify a band or the amplified band does not contain a 236bp band, the tested island cotton germplasm is a sensitive high-temperature island cotton germplasm.
[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a molecular marker related to the high-temperature resistance of sea island cotton powder, wherein the physical location of the molecular marker is in sea island cotton (… Gossypium barbadenseThe SNP site ('3-79_HAU.v3', https: / / doi.org / 10.1038 / s41588-018-0282-x) contains a base at chromosome D01 at position 54580356. The deoxynucleotide polymorphism at this site is either G or A. When the deoxynucleotide at the SNP site is G, it indicates heat-resistant Sea Island cotton; when the deoxynucleotide at the SNP site is not G, it indicates heat-sensitive Sea Island cotton. This molecular marker allows for rapid identification of heat resistance in Sea Island cotton germplasm. Simply use the genomic DNA of the Sea Island cotton germplasm as a template for PCR amplification, and the molecular marker banding pattern accurately determines whether the tested Sea Island cotton germplasm possesses heat resistance. This method is convenient and efficient, providing a technical foundation and support for cotton breeding. Attached Figure Description
[0014] Figure 1 Association analysis and linkage disequilibrium plot of lead-SNPs related to pollen viability in D01 chromosome of sea island cotton; Figure 2 This is a validation diagram of SNP variations based on the Xin 78 and Xin Hai 60 varieties; Figure 3 A graph was developed to detect sensitive KASP markers for the SNP variant (G->A) located at physical location Gbar_D01_54580356 (genome version '3-79_HAU.v3', https: / / doi.org / 10.1038 / s41588-018-0282-x). Figure 4 The verification results of the physical location KASP marker for Gbar_D01_54580356 in natural population high-temperature resistant / sensitive materials are shown in the figure. Detailed Implementation
[0015] This invention provides a molecular marker for high-temperature resistance in sea island cotton, wherein the molecular marker includes SNP sites; The SNP site is located at position 54580356 on chromosome D01 of the cotton island genome. When the deoxynucleotide at the SNP site is G, it is heat-resistant island cotton; When the deoxynucleotide at the SNP site is not G, it is a high-temperature sensitive island cotton. The nucleotide sequence containing the SNP site is shown in SEQ ID NO.1. This SNP site is located at 54580356 bp on chromosome D01 of the cotton sea island genome, version '3-79_HAU.v3', and is publicly available from the CottonGen database at: https: / / www.cottongen.org / data / download / genome_tetraploid / AD2.
[0016] SEQ ID NO.1: TCCTTAACTATCCTGAATATTTATCTCATAAAATTATTCATAAATCAATTTTCTAACTGCTCCTAAACCCTCTTGAATAAATATGGTATTTATCTCTAAAAATAGTATTTTAATCACCAAGTGATAATAAGACTTTCATGCTTATCTAATCACTTCCAAGCAATTCAGTTGGAAGTCTTAGCACCCAAATATGCCTATGTT GTGGTCTCCTTATTCTATATGTTGATTAAACATGTTTAGCGACCAAGCTAAACTTCTTCCAATCTTGCATCATCATAAAATAGTAAGGTCTGATGTGTCCTTCTTTCCCACAATAATGGAATGCAAACTTTCCTTTCTCCTTGTTACATATATGTTGTTGTCCAGACGTTATTTTATTAAATGTTGCAACATTAGATTAA GTGTTACTTATACTTCTCATTCTTTGTGTTAGATTTGGTGCCCTAAGAGTAGTATACTCGTTTGTATATTTGAAATTTTTTTTGAATAGATTGGTTAATAAAATTATTCATGAATTACATTAATTTCCTTTATATAATATTCTCATGTGATTTTTGCATGTAAAGCAAAATAGAAGCAAATATTAGCTCATTGGTTGTCTA ATGTTTAACTAATACTAAACGGTATTACGTGGTCAGATCGTAATACGAAAAAACAACTTATATTAATAGACAAACCTAAACATGTCCTTAGTCTAATCGAAAATGAGCAAACTGATTAAAAGATTAATAAGTTGTCTATCAAGTCCAATTGGGGAGATGTCTTGTCTTAGGTATTGAAGCGATGACTCCCAAAAGATAGA.
[0017] The bolded and underlined positions are SNP sites; The present invention provides a primer set for amplifying the molecular marker, including an upstream primer and a downstream primer, wherein the upstream primer is shown in SEQ ID NO.4; SEQ ID NO.4: 5'-CCTATGTTGTGGTCTCCTTATTCTATAT-3'; The downstream primer is shown in SEQ ID NO.5; SEQ ID NO.5: 5'-CACAAAGAATGAGAAGTATAAGTAACAC-3'.
[0018] This invention provides a kit for detecting the high-temperature resistance of sea island cotton, the kit comprising the primer set and PCR amplification reagent.
[0019] The volume of the upstream primer added is preferably 0.3~0.7 μL, more preferably 0.4~0.6 μL, even more preferably 0.5 μL, and the concentration added is preferably 8~12 mM, more preferably 9~11 mM, even more preferably 12 mM.
[0020] The volume of the downstream primer added is preferably 0.3~0.7 μL, more preferably 0.4~0.6 μL, even more preferably 0.5 μL, and the concentration added is preferably 8~12 mM, more preferably 9~11 mM, even more preferably 12 mM.
[0021] The required sea island cotton DNA sample was extracted using the CTAB method. The volume added to the amplification system was preferably 0.5~3 μL, more preferably 0.7~2 μL, and even more preferably 1 μL. The mass of the genome in the sample was preferably 50~200 ng, more preferably 75~100 ng, and even more preferably 85 ng.
[0022] The final volume of the amplification system is preferably 20 μL.
[0023] In this invention, the PCR amplification reagent preferably includes Taq DNA polymerase, dNTPs, and buffer reagent.
[0024] The preferred volume of the Taq DNA polymerase added is 0.1~0.3 μL, more preferably 0.2 μL, and the preferred concentration is 3~7 U / μL, more preferably 4~6 U / μL, and even more preferably 5 U / μL.
[0025] The volume of dNTPs added is preferably 0.1 to 0.5 μL, more preferably 0.2 to 0.4 μL, and even more preferably 0.3 μL. The concentration added is preferably 8 to 12 mM, more preferably 9 to 11 mM, and even more preferably 12 mM.
[0026] The buffer reagent is preferably 10×Buffer, and the addition volume is preferably 1~3 μL, more preferably 2 μL.
[0027] The annealing temperature for PCR amplification is preferably 55~60℃, more preferably 57~59℃, and even more preferably 58℃.
[0028] This invention provides the application of the aforementioned molecular markers, primer sets, or kits in detecting the heat-resistant phenotype of cotton from island cotton. The SNP molecular markers of this invention can directly detect the genotype at the specified locus, thereby determining whether the cotton germplasm is heat-resistant or heat-sensitive.
[0029] This invention provides the application of the aforementioned molecular markers, primer sets, and reagent kits in the breeding of island cotton.
[0030] This invention also provides a method for detecting the high-temperature resistance of island cotton, comprising the following steps: The genomic DNA of the target sea island cotton germplasm was amplified by PCR using the primer set described above to obtain PCR amplification products; The PCR amplification product was detected by electrophoresis. When the PCR amplification product had a 236bp band, the tested sea island cotton germplasm was a heat-resistant sea island cotton germplasm. When the PCR amplification product fails to specifically amplify a band or the amplified band does not contain a 236bp band, the tested island cotton germplasm is a sensitive high-temperature island cotton germplasm.
[0031] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0032] Example 1
[0033] Analysis of natural variation in the physical location of Gbar_D01_54580356
[0034] The inventors used 336 publicly available data sets of Sea Island cotton (https: / / doi.org / 10.1111 / pbi.13747) and Sea Island cotton samples tested by their research group (Tables 4 and 5) to form a natural population of Sea Island cotton. Through multi-year, multi-location collection of quantitative data on pollen activity under ambient and high-temperature conditions, they assessed the pollen viability heat tolerance index of different germplasms and identified QTLs affecting pollen viability in Sea Island cotton under high temperatures. By analyzing the relationship between pollen viability and different haplotypes within the QTL loci in the natural population, they discovered natural variations linked to the high-temperature resistance phenotype. The SNP at the physical location Gbar_D01_54580356 was selected as the Lead-SNP (see details). Figure 1 (and Table 1), and develop the tagging.
[0035] Table 1 Summary of Natural Population Variation Information
[0036] Note: In the table header, Pos represents the physical location of the genome; Ref represents the reference genotype; Alt represents the variant genotype; Pollenviability_ref_mean represents the average pollen viability of cotton materials with the reference genotype; Pollen viability_alt_mean represents the average pollen viability of cotton materials with the variant genotype; and T. test_p represents the p-value of the T-test for pollen viability between the two genotypes.
[0037] Example 2
[0038] Development of molecular markers for natural variants at the Gbar_D01_54580356 position
[0039] 1. Verification of the authenticity of molecular markers (taking the physical location of 54580356 bp G->A as an example)
[0040] Based on the material information and corresponding genotype information in the mutation map of Example 1, one copy each of materials with genotypes A and G at the 54580356bp position were selected. In this example, XinHai 60 (A) and Xin78 (G) materials were used for molecular marker amplification. The main steps are as follows: (1) Based on the Gbar_D01_54580356 marker position in SEQ ID NO.1, design PCR primers that can amplify sequences containing the Gbar_D01_54580356 variant position. By sequencing the PCR product, determine whether the variant at the Gbar_D01_54580356 position actually exists.
[0041] The nucleotide sequence of SEQ ID NO.1 is as follows: TCCTTAACTATCCTGAATATTTATCTCATAAAATTATTCATAAATCAATTTTCTAACTGCTCCTAAACCCTCTTGAATAAATATGGTATTTATCTCTAAAAATAGTATTTTAATCACCAAGTGATAATAAGACTTTCATGCTTATCTAATCACTTCAAGCAATTCAGTTGGAAGT CTTAGCACCCAAATATGCCTATGTTGTGGTCTCCTTATTCTATAT GTTGATTAAACATGTTTAGCGACCAAGCTAAACTTCTTCCAATCTTGCATCATCATAAAATAGTAAGGTCTGATGTGTCCTTCTTTCCCACAATAATGGAATGCAAACTTTCCTTTCTCCTTGTTACATATATGTTGTTGTCCAGACGTTATTTTATTAAATGTTGCAACATTAGATTAA GTGTTACTTATACTTCTCATTCTTTGTGTTAGATTTGGTGCCCTAAGAGTAGTATACTCGTTTGTAATTTGAAATTTTTTTTGAATAGATTGGTTAATAAAATTATTCATGAATTACATTAATTTCCTTTATATAATATTCTCATGTGATTTTTGCATGTAAAGCAAAATAGAAGCAAATATTAGCTCATTGGTTGTCTAAT GTTTAACTAATACTAAACGGTATTACGTGGTCAGATCGTAATACGAAAAAACAACTTATATTAATAGACAAACCTAAACATGTCCTTAGTCTAATCGAAAATGAGCAAACTGATTAAAAGATTAATAAGTTGTCTATCAAGTCCAATTGGGGAGATGTCTTGTCTTAGGTATTGAA GCGATGACTCCCAAAAGATA GA The bolded and underlined locations indicate the SNP mutation sites, which involve a G->A mutation compared to the reference genome. These mutations are located at 54580356 bp on chromosome D01 of the cotton island genome. The cotton genome version is '3-79_HAU.v3', which can be accessed from the CottonGen database at https: / / www.cottongen.org / data / download / genome_tetraploid / AD2.
[0042] The upstream primer for PCR amplification for mutation authenticity detection is shown in SEQ ID NO.2, specifically: 5'-CTTAGCACCCAAATATGCCT-3'; the downstream primer is shown in SEQ ID NO.3, specifically: 5'-TATCTTTTGGGAGTCATCGC-3'.
[0043] (2) Genomic DNA was extracted from Xinhai 60 (A) and Xin 78 (G) materials using the CTAB method. Fresh leaf samples were placed in 2 mL centrifuge tubes, and a clean steel ball with a diameter of 5 mm and 200 μL of extraction buffer (0.35 M glucose, 0.1 M Tris-HCl, 0.005 M Na2EDTA, 2% PVP K-30 and 0.1% DIECA, pH=7.5) were added. The tubes were then ground in a grinder (Shanghai Jingxin #Tissuelyser-192) for 60 s at a frequency of 60 Hz. After grinding, 800 μL of lysis buffer (0.1 M Tris-HCl, 1.4 M NaCl, 0.02 M Na2EDTA, 2% CTAB, 2% PVP K-30 and 0.1% DIECA, pH 8.0) was added. After incubating in a 65℃ water bath for 30 min, 800 μL of chloroform (chloroform:isoamyl alcohol volume ratio of 24:1) was added, and the tubes were gently inverted for 20 min. The tubes were then centrifuged at 12000 rpm for 8-10 seconds. After 1 minute, the supernatant was transferred and mixed with an equal volume of isopropanol pre-cooled to -20°C. A flocculent DNA precipitate appeared after mixing. The DNA was washed twice with 75% ethanol (v / v), dried in a laminar flow hood, and then dissolved in ddH2O. Using primers SEQ ID NO.2 and SEQ ID NO.3, the PCR system was prepared according to the formula in Table 2, and PCR amplification was performed according to the procedure in Table 3.
[0044] Table 2 PCR system
[0045] Table 3 PCR Procedure
[0046] (3) After PCR, the product was cloned into the entry vector pTOPO-T (Aidlab #CV2101), heat-shocked into competent E. coli DH5α cells, and 4-5 single clones were picked for sequencing using the M13F (TGTAAAACGACGGCCAGT) universal primers to confirm the authenticity of the marker SNP in the sequence. The results are as follows: Figure 2 As shown.
[0047] Depend on Figure 2 It can be concluded that the genotype of XinHai 60 at the 54580356 bp physical position is A, and the genotype of Xin 78 at the 54580356 bp physical position is G; thus confirming the existence of SNP variation. The genotype A of XinHai 60 at the 54580356 bp physical position indicates a heat-sensitive genotype; the genotype G of Xin 78 at the 54580356 bp physical position indicates a heat-resistant genotype.
[0048] 2. Optimal primer sequence and annealing temperature design
[0049] After confirming the authenticity of the marker, the number of materials was increased to explore the optimal primer sequence and annealing temperature. In this embodiment, the design principle of the annealing-sensitive KASP marker was followed. Figure 3 For the 'a' in the primer design and marker development, the steps are as follows: (1) Starting from the physical position of 54580356 bp on the sequence obtained from the sequencing results, a reverse primer (SEQ ID NO.5) was designed with a C base at the 3' end, and a forward primer (SEQ ID NO.4) was also designed. The annealing temperature of both the forward and reverse primers was set to around 57℃. The nucleotide sequence of the upstream primer (i.e., the forward primer) of the KASP-labeled primer is shown in SEQ ID NO.4, specifically: 5'- CCTATGTTGTGGTCTCCTTATTCTATAT-3'; the nucleotide sequence of the downstream primer (i.e., the reverse primer) is shown in SEQ ID NO.5, specifically: 5'- CACAAAGAATGAGAAGTATAAGTAACAC-3'.
[0050] (2) Expand the range of materials. Based on the genetic variation map in Example 1, select five materials with genotype G: 12CY25, 16CQ18, Xinhai25, K-412, and Giza77, and five materials with genotype A: Bazhou267, Xinhai6, Xizha45-4-62-1, Xaifu9, and Yuehai7 (Table 4).
[0051] Table 4. Information on Island Cotton Materials 1
[0052] Genomic DNA was extracted from the above 10 cotton samples using the CTAB method, in the same manner as above.
[0053] After obtaining the genomic DNA from the 10 cotton samples mentioned above, PCR was performed on the genomic DNA of the 12 samples using primers SEQ ID NO.4 and SEQ ID NO.5, according to the PCR system in Table 2 and the PCR program in Table 3 of Example 2. Simultaneously, a gradient annealing experiment was conducted at 1℃ increments from 55℃ to 60℃, with the annealing temperatures set to 55℃, 56℃, 57℃, 58℃, 59℃, and 60℃. After the PCR reaction was completed, the PCR products were obtained and detected by electrophoresis. The detection results are shown below. Figure 3 As shown in b in the figure.
[0054] Depend on Figure 3Analysis of b in the data reveals that molecular marker amplification was performed on 10 materials with different genotypes. Five materials (12CY25, 16CQ18, Xinhai25, K-412, and Giza77) were of genotype G, while five materials (Bazhou267, Xinhai6, Xizha45-4-62-1, Xaifu9, and Yuehai7) were of genotype A. At an annealing temperature of 58–60°C, primers with a C base at the 3' end could not anneal with the sequence of the T genotype. Based on the PCR amplification results, materials with genotype G could amplify normally at an annealing temperature of 58–59°C, while materials with genotype A produced almost no PCR product. To ensure the accuracy of the amplification results, 58°C was ultimately selected as the optimal annealing temperature.
[0055] Example 3
[0056] Molecular marker validation at the natural population level
[0057] Example 2 confirmed the authenticity of the marker and determined the optimal annealing temperature and KASP marker primer sequence. In this example, using the annealing temperature and KASP marker primer sequence confirmed in Example 2, and based on the average pollen viability phenotypic data of the natural population, 22 samples each of heat-resistant and heat-sensitive materials were randomly selected (Table 5) for DNA extraction.
[0058] Table 5 Information on Sea Island Cotton Materials 2
[0059] Using primers SEQ ID NO.4 and SEQ ID NO.5, and following the PCR system in Table 2 and the PCR procedure in Table 3, the 44 PCR materials were amplified at a 54,580,356 bp physical location under annealing temperature at 58℃. After the PCR reaction was complete, the PCR products were obtained and detected by electrophoresis. The results are shown below. Figure 4 As shown. Figure 4 In the figure, 'a' represents the amplification results of 22 high-temperature resistant materials, and the asterisk indicates materials with insignificant or nonspecific amplification. Figure 4 In the figure, b represents the amplification results of 22 sensitive high-temperature materials, and the asterisk indicates materials with obvious or specific amplification.
[0060] Depend on Figure 4 Analysis revealed that PCR results showed 21 samples of heat-resistant materials amplified specific bands, while 1 sample exhibited weak or non-specific band amplification (e.g., ...). Figure 4 (a) Among the high-temperature sensitive materials, 0 samples could amplify specific bands, while 22 samples had faint bands or non-specific amplification. Figure 4(b) According to the chi-square test, there was a significant difference in amplification efficiency between the high-temperature resistant material and the high-temperature sensitive material, with a p-value of 2.3 × 10⁻⁶. -10 .
[0061] The results of the above embodiments show that the SNP molecular markers provided by the present invention and the primers developed based on the SNP molecular markers can realize the detection of high temperature resistance of island cotton and effectively distinguish between high temperature resistant island cotton germplasm and high temperature sensitive island cotton germplasm.
[0062] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A molecular marker for high-temperature resistance in island cotton, characterized in that, The molecular markers include SNP sites; The SNP site is located at position 54580356 on chromosome D01 of the cotton island genome. When the deoxynucleotide at the SNP site is G, it is heat-resistant island cotton; When the deoxynucleotide at the SNP site is not G, it is a high-temperature sensitive island cotton. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
1.
2. The primer set for amplifying the molecular marker of claim 1, characterized in that, It includes an upstream primer and a downstream primer, wherein the upstream primer is shown in SEQ ID NO.4; The downstream primer is shown in SEQ ID NO.
5.
3. A reagent kit for detecting the high-temperature resistance of island cotton, characterized in that, The kit includes the primer set and PCR amplification reagents as described in claim 2.
4. The reagent kit according to claim 3, characterized in that, The PCR amplification reagents include Taq DNA polymerase, dNTPs, and buffer reagents.
5. The use of the molecular marker of claim 1, the primer set of claim 2, or the kit of claim 3 or 4 in detecting the thermostable phenotype of cotton plants.
6. The application of the molecular marker of claim 1, the primer set of claim 2, and the kit of claim 3 or 4 in the breeding of heat-resistant island cotton.
7. A method for detecting the high-temperature resistance of island cotton, characterized in that, Includes the following steps: The genomic DNA of the target sea island cotton germplasm was amplified by PCR using the primer set described in claim 2 to obtain the PCR amplification product; The PCR amplification product was subjected to electrophoresis detection. When the PCR amplification product had only one 236bp band, the tested sea island cotton germplasm was a heat-resistant sea island cotton germplasm. Otherwise, the sea island cotton germplasm to be tested is a high-temperature sensitive sea island cotton germplasm.
Citation Information
Patent Citations
Group of QTLs (quantitative trait loci) related to high temperature resistance of upland cotton, molecular marker and application of QTLs
CN118186135A
SNP (Single Nucleotide Polymorphism) molecular marker related to high-temperature resistance of cotton anther and application of SNP molecular marker
CN118853929A