Application of os sub1c gene and its coded protein in affecting rice plant type

Abstract

The application discloses OsSub1C The application belongs to the technical field of biotechnology, and relates to application of a gene and a coded protein in influencing a rice plant type. OsSub1C The application clones a gene from Yunyin and uses Yunyin as background material to obtain two homozygous mutant strains by CRISPR / Cas9 technology and Agrobacterium-mediated rice genetic transformation. OsSub1C The application also obtains two overexpression transgenic strains by Agrobacterium-mediated rice genetic transformation of a coding sequence driven by a strong promoter 35S. OsSub1C Phenotype analysis shows that the OE-1 strain has increased plant height, slender stems and significantly less tiller number than a wild type plant, and the plant type is slightly looser than that of the wild type plant. ossub1c The OE-2 strain is significantly dwarfed, has thick stems, dark green and upright leaves, and significantly increased ineffective tiller number at the base. OsSub1C The results show that the gene directly influences the rice plant type, and has application significance in improvement of the rice plant type.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and particularly relates to... OsSub1C Application of genes and their encoded proteins in influencing rice plant architecture. Background Technology

[0002] "Food is the paramount necessity of the people, and rice is the foremost food." As a typical monocotyledonous model plant and one of the world's three major staple foods, rice plays a vital role in human survival and development. Breeding rice varieties with ideal plant types has always been a primary goal in food production. Rice plant type is closely regulated by genes at various stages and is one of the key factors determining rice yield. Plant type is a comprehensive expression of agronomic traits, mainly including plant height, tillering, leaf shape, and panicle characteristics. Cultivating an ideal plant type is essential to further increase rice yield. With the continuous deepening of molecular research on rice, some genes related to plant type have been reported. Therefore, discovering new genes influencing rice plant type, developing new rice plant types, and further improving rice yield are particularly crucial.

[0003] APETALA2 / Ethylene responsive factor (AP2 / ERF) is a plant-specific transcription factor. A typical AP2 domain consists of 60-70 amino acid residues and was first discovered in Arabidopsis homologous proteins. Based on the number of AP2 domains and gene function, this family can be further divided into three categories: the AP2 subclass, containing two AP2 domains; the ERF subclass, containing only one AP2 / ERF domain; and the RAV subclass, containing both an AP2 / ERF domain and a VP1 / ABI3 domain. The ERF subclass can be further divided into the ERF subclass and the CBF / DREB subclass based on the different core binding elements of their downstream target genes. The core binding element of the ERF subclass is... GCC-like (A) GCCGCC ); The core component of the CBF / DREB subclass is C-repeat (A / GCC According to statistics, rice contains 165 AP2 / ERF family members, including 24 AP2 subclasses, 136 ERF subclasses, and 5 RAV subclasses.

[0004] Among all rice varieties, Sub1 The locus (quantity and shape locus) encodes two proteins, Sub1B and Sub1C, which are only found in flood-tolerant varieties. Sub1The locus encodes an additional Sub1A protein. Sub1A, Sub1B, and Sub1C all belong to the ERF subclass, which plays important roles in various biological processes in rice, such as spikelet development, seed size, biotic and abiotic stresses, and trichome development. (The last sentence appears to be incomplete and possibly refers to further information about rice.) Sub1 Research on gene clusters focuses on Sub1A superior, Sub1A It was identified as the major gene for flood tolerance, containing Sub1A-1 Varieties with alleles, such as FR13A, can survive for up to two weeks even when completely submerged in water because the ethylene content does not increase significantly. Under submerged conditions, in species containing... Sub1A In the flood-tolerant variety FR13A, the CIPK15-mediated pathway was inhibited. Furthermore, ethylene under flooded conditions can promote… Sub1A The expression of these substances promotes the accumulation of GA signal transduction factors SLR1 and SLRL1, thereby inhibiting GA signal transduction, which in turn suppresses the elongation of the aboveground parts of the plant and enhances its waterlogging tolerance. Under flooded conditions, Sub1A It has also been shown to affect the expression of 12 other AP2 / ERF genes, prolong leaf senescence, and improve drought resistance in rice. Furthermore, Sub1A has been found to specifically interact with the kinase MPK3, forming the MPK3-Sub1A complex, and is phosphorylated by it. Simultaneously, under flooded conditions, Sub1A can directly interact with… MPK3 The promoter binding regulates the survival of rice seedlings under flooded conditions. However, regarding... Sub1 The other two genes at the locus Sub1B , Sub1C The function of this has not been reported in rice. Summary of the Invention

[0005] In view of the above-mentioned shortcomings in the prior art, the present invention provides for the first time... OsSub1C Application of genes and their encoded proteins in influencing rice plant architecture. Specifically, this invention clones genes from japonica rice "Yunyin" into rice. OsSub1C Genes. Using Yunyin as background material, two homozygous mutant lines were obtained through CRISPR / Cas9 technology and Agrobacterium-mediated genetic transformation of rice, namely... ossub1c-3 and ossub1c-5 Simultaneously driven by a strong starter for 35 seconds. OsSub1C Two overexpressing transgenic lines, OE-, were obtained through Agrobacterium-mediated genetic transformation of the coding sequence. OsSub1C -1 and OE- OsSub1C -4. Phenotypic analysis revealed that OE- OsSub1C The plant height increased, the stems became thinner, and the number of tillers was significantly less than that of the wild type. The plant shape was also slightly looser than that of the wild type. ossub1cThe strains were significantly dwarfed, with robust stems, dark green and upright leaves, and a significantly increased number of ineffective basal tillers. These results indicate that... OsSub1C It directly affects the rice plant architecture and has application significance in rice plant architecture improvement.

[0006] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: One of the objectives of this invention is to provide OsSub1C The application of genes in regulating rice plant architecture, the aforementioned OsSub1C The CDS sequence of the gene is shown in SEQ ID NO.3.

[0007] Furthermore, in the aforementioned application, overexpression OsSub1C Genes that increase plant height, produce slender stems, reduce tillering, and result in a loose plant structure, can be knocked out. OsSub1C Genes can cause plants to be dwarfed, have thicker stems, increase the number of tillers, and have dark green, upright leaves.

[0008] A second objective of this invention is to provide a primer combination for regulating... OsSub1C Gene expression, including overexpression OsSub1C Primer combinations and / or knockout of genes OsSub1C Primer combinations for genes.

[0009] Furthermore, the overexpression OsSub1C The primer combination for the gene has the nucleotide sequence shown in SEQ ID NO.4~SEQ ID NO.5.

[0010] Furthermore, the knockout OsSub1C The primer combination for the gene has the nucleotide sequence shown in SEQ ID NO.6~SEQ ID NO.7.

[0011] A third objective of this invention is to provide a kit containing the primer combination.

[0012] A fourth objective of this invention is to provide a recombinant expression vector containing the aforementioned... OsSub1C Gene.

[0013] The fifth objective of this invention is to provide a host bacterium containing the aforementioned... OsSub1C The gene may contain the recombinant expression vector.

[0014] The sixth objective of this invention is to provide the application of the primer combination, the kit, the recombinant expression vector, and / or the host bacterium in regulating rice plant architecture.

[0015] Furthermore, the application includes its use in the breeding of new rice varieties and / or new lines with different plant types.

[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention clones rice from japonica rice "Yunyin" into paddy rice. OsSub1C Genes. Using Yunyin as background material, two homozygous mutant lines were obtained through CRISPR / Cas9 technology and Agrobacterium-mediated genetic transformation of rice, namely... ossub1c-3 and ossub1c-5 Simultaneously driven by a strong starter for 35 seconds. OsSub1C Two overexpressing transgenic lines, OE-, were obtained through Agrobacterium-mediated genetic transformation of the coding sequence. OsSub1C -1 and OE- OsSub1C -4. Phenotypic analysis revealed that OE- OsSub1C The plant height increased, the stems became thinner, and the number of tillers was significantly less than that of the wild type. The plant shape was also slightly looser than that of the wild type. ossub1c The strains were significantly dwarfed, with robust stems, dark green and upright leaves, and a significantly increased number of ineffective basal tillers. These results indicate that... OsSub1C It directly affects the rice plant architecture and has application significance in rice plant architecture improvement. Attached Figure Description

[0017] Figure 1 In Embodiment 1 of the present invention OsSub1C Agarose gel electrophoresis analysis of CDS amplification products.

[0018] Figure 2 As in Embodiment 1 of the present invention OsSub1C Subcellular localization analysis results.

[0019] Figure 3 Background information for the cloud in Embodiment 1 of the present invention OsSub1C The process of creating knockout and overexpression transgenic lines, including: A, OsSub1C Schematic diagram of gene structure and location of knockout target sites. B, two. OsSub1C Knockout strains ( ossub1c-3, ossub1c-5 Sequence and amino acid changes. C, qRT-PCR detection. OsSub1C Relative expression levels in overexpression lines. At least three biological replicates were set up, with the expression level in *Yunnan* as 1.0.

[0020] Figure 4 In Embodiment 1 of the present invention OsSub1C Directly altering rice plant architecture, including: A, Yunyin, OE- OsSub1C as well as ossub1c General morphology of the strain. Scale bar: 10 cm. B–F, Yunyin, OE- OsSub1C as well as ossub1cThe average number of tillers (B), plant height (C), yield per plant (D), seed setting rate (E), and thousand-grain weight (F) of the line. Detailed Implementation

[0021] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the invention without departing from its spirit and essence are within the scope of the invention. The reagents, kits, and instruments used in the following examples are commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventional methods.

[0022] The technical solution of the present invention will be further described in detail below with reference to the embodiments.

[0023] Example 1 1. Rice Sub1C Cloning of genes After searching the NCBI website, corresponding primers were designed, and the cDNA of japonica rice "Yunyin" was cloned using it as a template. Sub1C Gene. Its amplification primers are as follows: OsSub1C -CDS-F: ATGCGCCGCCGCGTCTCCTC (SEQ ID NO.1) OsSub1C -CDS-R: TCAGCTCCAGAAGCGCATGT (SEQ ID NO.2) Amplification was performed using the PCR amplification enzyme KOD FX DNA Polymerase provided by TOYOBO. The PCR amplification system consisted of: Primer Star 10 μL, ddH2O 7 μL, Primer-F 1.5 μL, Primer-R 1.5 μL, and template DNA 1 μL. After adding the sample, the mixture was mixed and centrifuged. The PCR amplification program was as follows: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 65℃ annealing for 30 s, 72℃ extension for 60 s, for a total of 35 cycles; 72℃ extension for 5 min; and isothermal at 4℃. This was obtained from [source missing]. OsSub1C Gene CDS. After amplification, the PCR products were detected by agarose gel electrophoresis. The amplified products were then recovered from the gel and sent to the company for sequencing to obtain the gene CDS. OsSub1C Gene CDS (e.g.) Figure 1 (As shown).

[0024] CDS sequence of the gene (SEQ ID NO.3): ATGCGCCGCCGCGTCTCCTCCTCCTCCTCCTCCTCCTCGTCCTCGTCGCCGGCGAGGCATCACAAGGCGCGGCGCAGCAGGAGGAAGCTCGCCGTCGACGAGGACTGGGAGGCCGCCTTCCGCGAGTTCCTCTCCCGCGACCACGACGACGACGACGACGACCACGACGGTCAGCATGTCGTTGTTGCGCCGTTGATCCGTGGTAGTGACAAGTGCGTCCACGGCCACGAGGTGGTGGCGTCGACGGTCGGCGGTGGCGCAAGCGGCGGACGACGACGAGCCGACGACGACGACGGCGAGCGGCGGCGGCGGCGGCGGAGGGAGAAGCGGAGCTACCCGTACCGCGGCATCCGGCAGCGGCCGTGGGGGAGGTGGGCGTCGGAGATCCGCGACCCCGTCAAGGGCATCCGCGTCTGGCTCGGCACCTTCGACACCGCCGAGGGCGCCGCGCGCGCCTACGACGACGAGGTTCGCCGCATCTACGGCGGCAACGCCAAGACCAACTTCCCCCCATCGCCGCCCACGCCGCCGCCGCCGGAGAAGCCAGCGGCGGAGAGGAGCCCCTCGACGACGCCGACGACGACCACGGAGGACTCCGGCGACTCGCGCATACTCATCGAGTGCTGCTCCGACGACCTGATGGACAGCCTCCTCGCCGCCTTCGACATGACCACCGGCGACATGCGCTTCTGGAGCTAA 2 OsSub1C Subcellular localization analysis Using the cDNA of 'Yunyin' as a template, construct OsSub1C- GFP transient expression vector (see Yu X, Xie Y, Wang L, Li L, Jiang S, Zhu Y, Xie H, Cui L, Wei Y, Xiao Y, Cai Q, Zheng Y, Chen L, Xie H, Zhang J. Transcription factor NAC78 cooperates with NAC78 interacting protein 6 to confer drought tolerance in rice. Plant Physiol. 2024 Oct 1;196(2): 1642-1658. doi: 10.1093 / plphys / kiae395.). Amplification was performed using the PCR amplification enzyme KOD FX DNA Polymerase provided by TOYOBO. The PCR amplification system was: Primer Star 10 μL, ddH2O 7 μL, Primer-F 1.5 μL, Primer-R 1.5 μL, template DNA 1 μL. After sample addition, mix and centrifuge. The PCR amplification program is as follows: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 65℃ annealing for 30 s, 72℃ extension for 60 s, for a total of 35 cycles; 72℃ extension for 5 min; and isothermal at 4℃. The amplified PCR products are detected by agarose gel electrophoresis. Once the bands are confirmed to be correct, the gel is recovered. The obtained target fragment is then ligated into a cloning vector, transformed, and sequenced. Ligation: The existing pRHVnRFP vector in the laboratory is used, with the following restriction enzyme sites: Kpn1 and HindⅢ Homologous recombination ligation was performed using Vazyme's Exnase ligase at 37°C for 30 min to ligate the target fragment with homologous ends and the digested vector. The ligation product was then transformed into competent *E. coli* cells. After colony growth, 2-3 single colonies were picked from the culture medium for propagation and sent to a sequencing company for sequencing using PCR amplification primers. Sequence alignment confirmed successful vector ligation, and positive strains were preserved. Plasmids were extracted from the positive strains to obtain the recombinant vector plasmid. Transient expression vector plasmids were extracted using an Endotoxin-free plasmid DNA purification kit (MACHEREY-NAGEL, Germany), following the manufacturer's instructions. After extraction, the plasmid was quantified and diluted to 2 µg / µL; 5-10 µg of plasmid is required for one protoplast transformation. After transformation, cells were cultured at 28°C for 16 h, and the red fluorescence of transfected cells was observed under a laser confocal microscope (LEICA TCSSP8, Germany). Results showed… OsSub1C-GFP is granular and localized in the nucleus of rice protoplast cells (e.g. Figure 2 (As shown).

[0025] The amplification primers are as follows: OsSub1C -RFP-F: CCGGGTGAGCTCGGTACCAAGCTTATGCGCCGCCGCGTCTCCTC (SEQ IDNO.4) OsSub1C -RFP-R: TACTCACTTAGCGGCCGCACTAGTTCAGCTCCAGAAGCGCATGT (SEQ IDNO.5) 3 OsSub1C Creation of knockout mutants and overexpression materials Will OsSub1C The gene accession number LOC_Os09g11460 was logged into the CRISPR-GE website (http: / / skl.scau.edu.cn / home / ) for CRISPR / Cas9 knockout target prediction. Simultaneously, suitable target sequences were selected from the early coding region and conserved protein kinase regions as gRNA targets (the underlined parts below are the targets). Figure 3 As shown in Figure A), the target sequence was then entered into the CRISPR RGEN Tools website (http: / / www.rgenome.net / cas-offinder / ) for off-target analysis. Next, the following targets were selected: OsSub1C -Cas9-T1: AATAATGGTCTCTGGC GGCCTCCCAGTCCTCGTCGA GTTTTAGAGCTAGAAATAGC (SEQ ID NO.6) OsSub1C -Cas9-T2: ATTATTGGTCTCTAAAC CGACGGTCAGCATGTCGTTG GCTTCTTGGTGCC (SEQ ID NO.7) Then, the target site was introduced by PCR amplification. Finally, the CRISPR / Cas9 knockout vector of the pHUE411 gene was constructed using the Golden Gate cloning method (see Yu X, Xie Y, Wang L, Li L, Jiang S, Zhu Y, Xie H, Cui L, Wei Y, Xiao Y, Cai Q, Zheng Y, Chen L, Xie H, Zhang J. Transcription factor NAC78 cooperates with NAC78 interacting protein 6 to confer drought tolerance in rice. Plant Physiol. 2024 Oct 1;196(2):1642-1658. doi: 10.1093 / plphys / kiae395.). After the sequence was confirmed to be correct, the recombinant plasmid was transformed into Agrobacterium (EHA105) competent cells using the freeze-thaw method. Using Yunyin as background material, transgenic materials were obtained through Agrobacterium-mediated genetic transformation of rice. DNA was extracted from the obtained T0 generation transgenic plants, and the presence of positive plants was detected using CRISPR / Cas9 vector-specific primers. The primer sequences are as follows: OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3' (SEQ ID NO.8) TaU3-RD: 5'-CTCACAAATTATCAGCACGCTAGTC-3' (SEQ ID NO.9) Positive plants were planted in the experimental field. After harvesting individual T1 generation seedlings and extracting DNA from their leaves, primers were designed near the two target sites to detect the knockout. The primer sequences are as follows: OsSub1C -Cas9-T1T2-F: GCATCAGCATCACAACCCACCA (SEQ ID NO.10) OsSub1C -Cas9-T1T2-R: CCGTAGATGCGGCGAACCTC (SEQ ID NO.11) Two homozygous lines were obtained through testing, and it was also found that the protein translation of the two mutants was altered due to mutations (e.g., Figure 3 (As shown in B). Then, homozygous seeds were planted in the experimental field, and phenotypic analysis was performed on the T2 generation plants.

[0026] In addition, RNA was extracted from the leaves of the overexpression lines, then converted into cDNA, and its expression level was detected using quantitative real-time immunoassay. The results showed that, compared with the wild type, the overexpression lines showed significantly higher levels of RNA. OsSub1C The expression level of [something] was significantly increased (e.g. Figure 3 (As shown in C). Then, homozygous seeds were planted in the experimental field, and phenotypic analysis was performed on the offspring plants. The fluorescent primer sequences are as follows: OsSub1C -qPCR-F: ATACTCATCGAGTGCTGCTCCGAC (SEQ ID NO.12) OsSub1C -qPCR-R: TTAGCTCCAGAAGCGCATGTC (SEQ ID NO.13) 4 OsSub1C Directly change the rice plant type Wild-type cloud seeding, OsSub1C Overexpression (OE-) OsSub1C -1、OE- OsSub1C -4) and two OsSub1C Knockout homozygous lines ( ossub1c -3、 osssub1c -5) Experimental fields were planted in Sanya, Hainan, and agronomic trait surveys and crop testing data were conducted. Results showed that OE- OsSub1C The stems of this strain are slender and the number of tillers is significantly less than that of the wild type, and the plant shape is also slightly looser than that of the wild type. ossub1c The strains are significantly dwarfed, with thicker stems and a significantly increased number of ineffective basal tillers (e.g., Figure 4 (As shown in A).

[0027] Statistical analysis results show that compared with the wild type, ossub1c The plant height decreased, the number of tillers increased significantly, and the seed setting rate and thousand-grain weight decreased significantly, resulting in a significant decrease in yield per plant (e.g., Figure 4 (As shown in B–4F). Compared to the wild type, OE- OsSub1C Plant height was basically unaffected (slightly increased), tiller number decreased significantly, and seed setting rate and thousand-grain weight decreased, resulting in a decline in yield per plant (e.g., Figure 4 (as shown in B–4F). These results indicate that... OsSub1C It directly affects the rice plant type.

[0028] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. OsSub1C The application of genes in regulating rice plant architecture is characterized by, The OsSub1C The CDS sequence of the gene is shown in SEQ ID NO.3; the regulation of rice plant architecture is achieved by knocking out the gene. OsSub1C Gene-based; knockout OsSub1C Genes can cause plants to be dwarfed, have thicker stems, increase the number of tillers, and have dark green, upright leaves.

2. The application according to claim 1, characterized in that, The knockout was achieved using CRISPR / Cas9 gene editing technology.

3. A method for knocking out the application described in claim 1 or 2 OsSub1C The application of primer combinations for genes or kits containing said primer combinations in regulating rice plant architecture, characterized in that: The nucleotide sequences of the primer combination are shown in SEQ ID NO.6~SEQ ID NO.7; the regulation of rice plant type is achieved by knocking out the... OsSub1C Gene-based; knockout OsSub1C Genes can cause plants to be dwarfed, have thicker stems, increase the number of tillers, and have dark green, upright leaves.

Images