Use of a substance for knocking out the coding gene of protein ZmbZIP61 in improving heat tolerance of corn

Abstract

The present application relates to the technical field of biotechnology, and discloses application of a substance for knocking out a coding gene of a protein ZmbZIP61 in improving heat resistance of corn. One technical solution of the present application provides application of the substance for knocking out the coding gene of the protein ZmbZIP61, and the application is any one of the following: P1, application in improving heat resistance of corn; P2, application in corn breeding; the ZmbZIP61 protein can be specifically a protein with an amino acid sequence of SEQ ID No. 2 in a sequence listing or a derivative protein thereof. The ZmbZIP61 protein and related biological materials can be used for regulating heat resistance of corn.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of substances that knock out the gene encoding the protein ZmbZIP61 in improving the heat resistance of maize. Background Technology

[0002] Maize is one of the world's most important food crops, serving as food, livestock feed, and industrial raw material. Sustainable growth in its yield is crucial for ensuring food security (JANNI et al., 2020). With increasing extreme weather events such as global warming, the maintenance of maize yields is under threat. Therefore, research on maize's response to high-temperature stress and identification of key genes and their regulatory modules will provide genetic materials and a theoretical basis for breeding heat-resistant maize (ZHAO et al., 2017).

[0003] References: JIANG S, CHENG Q, YAN J, FU R and WANG X, 2020. Genome optimization for improvement of maize breeding. Theor Appl Genet, 133(5): 1491-1502. DOI:10.1007 / s00122-019-03493-z. ZHAO C, LIU B, PIAO S, WANG T,WU D, LIU Z, ZHU Y, ZHU Z and ASSENG S, 2017. Temperature increase reduces global yields of major crops in four independent estimates. Proc Natl AcadSci USA, 114(35): 9326-9331. DOI: 10.1073 / pnas.1701762114. Summary of the Invention The technical problem to be solved by this invention is how to improve the heat resistance of corn.

[0004] To address the aforementioned technical problems, this invention first provides the application of a substance that knocks out the gene encoding the protein ZmbZIP61, wherein the application is any one of the following: P1. Application in improving the heat resistance of corn; P2. Applications in maize breeding; The protein ZmbZIP61 may be a protein of the following types: A1), A2), or A3): A1) The amino acid sequence of this protein is SEQ ID No. 2; A2) A protein derived from A1) or having more than 80% identity with and the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in A1). A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1), A2) or A3).

[0005] In the above applications, the protein ZmbZIP61 can be derived from corn.

[0006] In the above applications, the corn breeding refers to the selection of heat-resistant corn varieties.

[0007] The term "more than one amino acid residue" as mentioned above can specifically refer to up to ten amino acid residues.

[0008] In the above applications, the gene encoding the protein ZmbZIP61 can be a DNA molecule as shown in a1), a2), or a3) below: a1) The coding sequence is the DNA molecule shown in SEQ ID No. 1 of the sequence listing; a2) has 90% or more identity with the nucleotide sequence defined in a1) and encodes a DNA molecule that encodes the protein ZmbZIP61 described above. a3) hybridizes under strict conditions to the nucleotide sequence defined by a1) or a2) and encodes a DNA molecule that encodes the protein ZmbZIP61 described above.

[0009] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences. Having 90% or more identity can mean at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity.

[0010] In the above applications, the knockout is achieved through gene knockout. Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0011] In the above applications, the substance that knocks out the gene encoding the protein ZmbZIP61 can be a reagent that knocks out the gene through homologous recombination or a reagent that knocks out the gene through CRISPR-Cas9.

[0012] In the above applications, the substance that knocks out the gene encoding the protein ZmbZIP61 can be any one of the following c1)-c4): c1) Knock out the nucleic acid molecule encoding the ZmbZIP61 protein gene; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3).

[0013] c1) The nucleic acid molecule mentioned above is an sgRNA that targets the gene encoding the protein ZmbZIP61 described above, or a DNA molecule that expresses the sgRNA.

[0014] The target sequence of the sgRNA is positions 549-567 of SEQ ID No. 3.

[0015] To address the aforementioned technical problems, this invention also provides a method for improving the heat resistance of maize by knocking out the gene encoding the protein ZmbZIP61 in the maize genome.

[0016] The above-mentioned knockout of the gene encoding the protein ZmbZIP61 in the maize genome can be achieved by any method in the existing technology, so as to produce deletion mutations, insertion mutations or base transformation mutations in the gene, thereby reducing or losing gene function. Specifically, it can be chemical mutagenesis, physical mutagenesis, RNAi, site-directed genome editing or homologous recombination, etc.

[0017] Among the aforementioned site-specific genome editing methods, zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology, clustered regularly interspaced short palindromic repeats / CRISPR-associated (CRISPR-Cas9 system) technology, and other technologies capable of site-specific genome editing can be employed. Regardless of the method used, the entire coding gene of the aforementioned proteins can be targeted, or individual elements regulating the expression of the coding gene can be targeted, as long as gene function loss or reduction is achieved. For example, exons or 5' UTRs of the coding genes of the aforementioned proteins can be used as targets.

[0018] The method described above may include introducing a substance that knocks out the gene encoding the ZmbZIP61 protein into the corn. The substance that knocks out the gene encoding the ZmbZIP61 protein may be any one of the following substances (c1)-c4): c1) Nucleic acid molecules that inhibit or reduce the expression of the protein ZmbZIP61 encoding gene described above; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3).

[0019] c1) The nucleic acid molecule mentioned above is an sgRNA that targets the gene encoding the protein ZmbZIP61 described above, or a DNA molecule that expresses the sgRNA.

[0020] The target sequence of the sgRNA is positions 549-567 of SEQ ID No. 3.

[0021] This invention also protects the aforementioned protein ZmbZIP61.

[0022] This invention also protects biomaterials related to the protein ZmbZIP61, said biomaterial being any one of B1) to B5) below: B1) Nucleic acid molecules encoding ZmbZIP61; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B1); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3).

[0023] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0024] In the above-mentioned biological materials, the nucleic acid molecule described in B1) is a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No.1.

[0025] Of the above-mentioned biological materials, B2) describes an expression cassette containing the nucleic acid molecule. ZmbZIP61 Gene expression cassettes (CACs) are nucleic acid molecules capable of expressing ZmbZIP61 in host cells. These cassettes may include promoters, gene expression cassette ... ZmbZIP61 The promoter of gene transcription may also include a terminator. ZmbZIP61Transcription terminator. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiology 120:979-992); chemically induced promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by jasmonic acid methyl ester); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1)). 0099169.7), seed storage protein-specific promoters (e.g., promoters of bean globular protein, napin, oleosin, and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (I 985 Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acids Res., 15:9627).

[0026] In the aforementioned biological materials, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.

[0027] This invention discloses a method for processing corn. ZmbZIP61 A method to improve heat resistance in maize by knocking out genes. Specifically, the CRISPR-Cas9 system is used to knock out genes in recipient maize genes. ZmbZIP61 Genes are edited, and the stated ZmbZIP61 A gene mutation causes premature termination of translation, resulting in transgenic corn, which is then used in recipient corn. ZmbZIP61 Gene editing. This invention utilizes CRISPR-Cas9-mediated gene editing technology on maize. ZmbZIP61 gene By performing targeted knockout of specific targets, we can obtain maize mutant materials with significantly improved heat resistance, providing new materials for maize variety breeding. Attached Figure Description

[0028] Figure 1 In Embodiment 1 of the present invention ZmbZIP61 Two gene-editing mutants zmbzip61-1 and zmbzip61-2 Comparison of nucleotide sequences with wild-type (WT).

[0029] Figure 2 In Embodiment 1 of the present invention ZmbZIP61 Two gene-editing mutants zmbzip61-1 and zmbzip61-2 Phenotypes of wild-type (WT) after high-temperature treatment.

[0030] Figure 3 In Embodiment 1 of the present invention ZmbZIP61 Two gene-editing mutants zmbzip61-1 and zmbzip61-2 Phenotype of wild type (WT) before high-temperature treatment.

[0031] Figure 4 In Embodiment 1 of the present invention ZmbZIP61 Two gene-editing mutants zmbzip61-1 and zmbzip61-2 Statistical test of Fv / Fm before and after high-temperature treatment of wild-type (WT) . Detailed Implementation

[0032] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0034] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0035] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

[0036] Example 1 A gene associated with high-temperature stress response was identified in maize using three-dimensional genomics. ZmbZIP61 The gene number is Zm00001d015743, which belongs to the bZIP transcription factor family.

[0037] The inventor cloned ZmbZIP61 Full-length gene, ZmbZIP61 The genome sequence is shown in SEQ ID No. 3. ZmbZIP61 The gene coding region sequence is shown in SEQ ID No. 1, encoding the ZmbZIP61 protein, and the amino acid sequence of the ZmbZIP61 protein is shown in SEQ ID No. 2: SEQ ID No. 1: ATGCAGGAGCAGGCGGCGAGCTCGCGGCCTTCCAGCAGCGAGAGGTCGTCCAGCTCCGGGCACCACGTGGACATGGAGGTCAAGGAAGGGATGGAGAGCGACGATGAGATAAGGAGAGTGCCGGAGCTGGGCCTGGAGTTGCCGGGAGCCTCCACGTCGGGCAGGGAGGCTGGCCCTGGCGCTGCGGGCGCAGACCGCGCCCTTGCCCAGTCGTCCACGGCGCAGGCCAGCGCGCGCCGCCGCGTCCGCAGCCACGCCGACAAGGAGCACAAGCGCCTCAAAAGGTTACTGAGGAACAGGGTGTCAGCTCAACAGGCTAGAGAGAGGAAGAAGGCTTATTTAACTGATCTGGAGGTGAAGGTGAGAGATCTGGAGAAGAAGAACTCGGAGATGGAAGAGAGGCTCTCCACCCTCCAGAACGAGAACCAGATGCTCCGACAGATACTGAAGAACACCGCTGTAAACAGAAGAGGTTCAGGAAGCACTGCTAGTGGAGAGGGCCACGGCCAATAG SEQ ID No.2 MQEQAASSRPSSSERSSSSGHHVDMEVKEGMESDDEIRRVPELGLELPGASTSGREAGPGAAGADRALAQSSTAQASARRRVRSHADKEHKRLKRLLRNRVSAQQARERKKAYLTDLEVKVRDLEKKNSEMEERLSTLQNENQMLRQILKNTAVNRRGSGSTASGEGHGQ SEQ ID No.3 1. Construction ZmbZIP61 CRISPR-Cas9 mutant materials To verify ZmbZIP61 Gene function was demonstrated by constructing genes using sgRNA. ZmbZIP61 The CRIPSPR mutant material. The sgRNA targeting sequence is GGAGTTGCCGGGAGCCTCC (same as positions 549-567 of SEQ ID No. 3).

[0038] The specific construction method is as follows: The Center for Crop Functional Genomics and Molecular Breeding at China Agricultural University was commissioned to construct and create a stable genetically transformed mutant line of ZmbZIP61. Specifically, ND101 (provided by the Center for Crop Functional Genomics and Molecular Breeding at China Agricultural University) was used as the recipient, and pBUE411 (provided by the Center for Crop Functional Genomics and Molecular Breeding at China Agricultural University) was used as the gene editing vector. The gene was targeted at positions 549-567 of SEQ ID No. 3, and CRISPR-Cas9 technology was used for the process. ZmbZIP61 Gene editing yielded two stable mutant lines: ZmbZIP61- 1 and ZmbZIP61-2 .

[0039] Compared to wild type (WT), detection ZmbZIP61-1 and ZmbZIP61-2 Target gene editing status, results are shown in [link to results]. Figure 1 : zmbzip61-1 Compared to wild type (WT), mutants zmbzip61-1 In the genome, ZmbZIP61 A gene mutation occurred, resulting in a deletion of the sequence ACCTGTGGTGTGATTGAGTTGCAGGGATGGAGAGCGACGATGAGATAAGGAGAGTGCCGGAGCTGGGCCTGGAGTTGCCGGGAGCCTCCACGTCGGGCAGGGAGGCTGGCCCTGGCGCTGCGGGCGCAGACCGCGC, totaling a deletion of 136 bp. ZmbZIP61 A frameshift mutation caused premature termination of transcription, preventing the encoding of the protein ZmbZIP61 with the amino acid sequence SEQ ID No. 2, ultimately leading to... ZmbZIP61 Loss of function, thus ZmbZIP61 Gene knockout.

[0040] zmbzip61-2Compared to wild type (WT), mutants zmbzip61-2 In the genome, ZmbZIP61 A gene mutation occurred, with two homologous chromosomes deleting the sequence ACGATGAGATAAGGAGAGTGCCGGAGCTGGGCCTGGAGTTGCCGGGAGCCTCC (53 bp deletion) between positions 515 and 515 of SEQ ID No. 3, and inserting four TCAT bases (4 bp insertion) between positions 514 and 515 of SEQ ID No. 3, resulting in... ZmbZIP61 Premature termination of gene transcription prevents the encoding of the protein ZmbZIP61 with the amino acid sequence SEQ ID No. 2, ultimately leading to... ZmbZIP61 Loss of function, thus ZmbZIP61 Gene knockout.

[0041] 2. ZmbZIP61 Identification of high temperature tolerance of mutants 2.1 Phenotypic Identification To verify ZmbZIP610 Whether or not they participate in the high-temperature stress response process, comparing wild-type and two mutant lines. zmbzip61-1 and zmbzip61-2 After field planting, the plants were placed in a high-temperature greenhouse at 45°C for 20 minutes during the maturity period (one week after pollination). Phenotypic photos were taken before and after the high-temperature treatment.

[0042] Three replicates, with two plants per replicate.

[0043] The phenotypes of corn before and after high-temperature treatment were photographed, and it was found that after high-temperature treatment ( Figure 2 Wild type and mutant compared to before high temperature treatment ( Figure 3 All of them shrank. Compared to the wild type, the mutants... zmbzip61-1 and zmbzip61-2 The leaves exhibited less curling and wrinkling, and were more open, indicating that knockout... ZmbZIP610 The mutant of the gene is more tolerant to high temperatures, and this gene may be involved in the high-temperature stress response process of maize.

[0044] 2.2 Determination of Fv / Fm value To further verify ZmbZIP610 Whether or not it participates in the maize high-temperature stress response process, the maturity stage (two weeks after pollination) mutant zmbzip61-1 and zmbzip61-2Wild-type maize plants were placed in high-temperature environments (39℃) and normal environments (29℃). The Fv / Fm values ​​of the middle part of the ear leaves of wild-type and mutant maize plants were measured respectively. When the temperature was 29℃ from 9:00 to 10:00 on the day when high temperature was expected, it was considered a normal environment. The Fv / Fm of the predetermined plants in the field was measured. When the temperature was 39℃ from 14:00 to 15:00 in the afternoon, it was considered a high-temperature environment. The Fv / Fm of the predetermined plants were measured again in the same order.

[0045] Eight replicates were performed for each mutant and 16 replicates for the wild type, resulting in a total of 32 Fv / Fm values. A t-test was performed to assess the significance of Fv / Fm values ​​at high and normal temperatures. The results showed that high-temperature treatment significantly reduced the Fv / Fm value in the wild type, while there was no significant difference in Fv / Fm value among the mutants, indicating that... ZmbZIP61 The mutant is less affected by high temperatures and has a stronger tolerance to high-temperature stress. Figure 4 ).

[0046] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of knocking out the gene encoding the protein ZmbZIP61 in improving the heat resistance of maize, characterized by: The protein ZmbZIP61 is a protein with the amino acid sequence SEQ ID No.

2.

2. The application according to claim 1, characterized in that: The gene encoding the protein ZmbZIP61 is a DNA molecule as shown in a1) or a2) below: a1) The coding sequence is the DNA molecule shown in SEQ ID No. 1 of the sequence listing; The DNA molecule that has 90% or more identity with the nucleotide sequence defined in a2) and a1) and encodes the ZmbZIP61 protein of SEQ ID No.

2.

3. The application according to any one of claims 1-2, characterized in that: The substance that knocks out the gene encoding the protein ZmbZIP61 is introduced into the corn, wherein the substance is any one of c1)-c4): c1) Knock out the nucleic acid molecule encoding the ZmbZIP61 protein gene; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3).

4. The application according to claim 3, characterized in that: c1) The nucleic acid molecule is an sgRNA that targets the gene encoding the protein ZmbZIP61 of any of claims 1-2 or a DNA molecule that expresses the sgRNA.

5. The application according to claim 4, characterized in that: The target sequence of the sgRNA is positions 549-567 of SEQ ID No.

3.

6. A method for improving the heat resistance of corn, characterized in that, Heat tolerance of maize is improved by knocking out the gene encoding the protein ZmbZIP61 described in any of claims 1-2 in the maize genome.

7. The method according to claim 6, characterized in that: The method includes introducing a substance into the corn that knocks out the gene encoding the protein ZmbZIP61; the substance is any one of c1)-c4): c1) Knock out the nucleic acid molecule encoding the ZmbZIP61 protein gene; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3).

8. The method according to claim 7, characterized in that: c1) The nucleic acid molecule is an sgRNA that targets the gene encoding the protein ZmbZIP61 of any of claims 1-2 or a DNA molecule that expresses the sgRNA.

9. The method according to claim 8, characterized in that: The target sequence of the sgRNA is positions 549-567 of SEQ ID No. 3.

Images