A molecular marker related to immune traits of huangshan male semi-fine wool sheep, a detection method and application thereof

Abstract

The present application relates to the technical field of molecular marker, especially relates to a kind of molecular marker related to immunity character of Xiangnian Banmao sheep, its detection method and application.The present application provides a kind of SNP molecular marker related to immunity character of Xiangnian Banmao sheep, the SNP molecular marker is located at the 221922324 th base of the 3rd chromosome of Lambre sheep reference genome ARS-UI_Ramb_v3.0, GCF_016772045.2;Mutant base is T or C.The present application can judge the immunoglobulin IgA, IgG, IgM content of Xiangnian Banmao sheep individual by detecting the base of the 221922324 th nucleotide site on the 3rd chromosome of Xiangnian Banmao sheep, and the present application provides new SNP molecular marker resources for the marker-assisted selection of Xiangnian Banmao sheep immunity character for non-diagnostic purposes.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to a molecular marker associated with immune traits in elephant male semi-fine wool sheep, its detection method, and its application. Background Technology

[0002] The Xiangxiong semi-fine wool sheep is an excellent local sheep breed developed in a specific high-altitude environment, exhibiting unique adaptability to harsh conditions characterized by high altitude and low oxygen. It not only provides high-quality wool and mutton products, but its stable reproduction in high-altitude regions also makes it a valuable genetic resource for studying livestock environmental adaptability and disease resistance. Currently, breeding efforts for this breed largely focus on traditional production traits (such as wool fineness and body weight), while research into the genetic mechanisms of its intrinsic immune and disease-resistant capabilities—an important economic trait—is still insufficient. The lack of efficient molecular breeding methods has hindered the development of disease-resistant strains of this breed.

[0003] In the field of livestock and poultry molecular breeding, identifying molecular markers closely linked to important economic traits is crucial for early and efficient breeding. Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, have become a core tool in current genetic research and marker-assisted selection (MAS) due to their wide distribution, abundant quantity, and suitability for high-throughput genotyping. Although SNP marker technology has achieved significant results in the breeding of rice, maize, and some large livestock and poultry (such as pigs and chickens), the discovery of relevant functional SNP markers for the distinctive local breed of Xiangxiong semi-fine wool sheep, particularly its immune traits closely related to its strong adaptability to high altitudes, remains a blank, severely limiting the full exploitation of the breed's molecular breeding potential.

[0004] Therefore, there is an urgent need in this field for a molecular marker that can specifically associate with the immune traits of male semi-fine wool sheep. Identifying SNP loci significantly associated with immune traits can not only provide a theoretical basis for revealing the molecular genetic basis of this breed's strong environmental adaptability and disease resistance, but also directly translate into an efficient detection method applicable to breeding practices. This will enable early and accurate selection of male semi-fine wool sheep for immune disease resistance, accelerate the genetic progress of superior breeding stock, and is of great significance for improving the overall health of the population and the economic benefits of sheep farming. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker associated with immune traits in male semi-fine wool sheep, its detection method, and its application.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a SNP molecular marker associated with immune traits in male elephant semi-fine wool sheep. The SNP molecular marker is located at the 221922324th base on chromosome 3 of the Lambble sheep reference genome ARS-UI_Ramb_v3.0, GCF_016772045.2; the mutated base is T or C.

[0007] Preferably, when the base of the SNP molecular marker site is T, the genotype is TT or TC; when the base of the SNP molecular marker site is C, the genotype is CC; the immune trait is the content of immunoglobulins IgA, IgG, and IgM; the content of immunoglobulins IgA, IgG, and IgM in male semi-fine wool sheep individuals with the TT genotype is significantly lower than that in individuals with the CC and TC genotypes, while the content of immunoglobulins IgA, IgG, and IgM in individuals with the CC and TC genotypes does not show significant differences.

[0008] This invention provides the application of the aforementioned SNP molecular marker in the preparation of products for detecting the immunity of male elephant semi-fine wool sheep or products for assisted breeding of male elephant semi-fine wool sheep.

[0009] This invention provides primer pairs for amplifying the aforementioned SNP molecular markers, the nucleotide sequences of which are shown in SEQ ID NO:2~3.

[0010] This invention provides the application of the primer pair described above in the preparation of products for detecting the immunity of male elephant semi-fine wool sheep or products for assisted breeding of male elephant semi-fine wool sheep.

[0011] This invention provides a kit for detecting the immunity of male elephant semi-fine wool sheep, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0012] This invention provides a kit for assisted breeding of male elephant semi-fine wool sheep, comprising reagents for detecting the SNP molecular markers or the primer pairs.

[0013] This invention provides a method for non-diagnostic selection of heliotropic semi-fine wool sheep using immune trait markers, comprising the following steps: (1) Extract genomic DNA from Xiangxiong semi-fine wool sheep; (2) Using the genomic DNA of the elephant male semi-fine wool sheep obtained in step (1) as a template, amplification is performed using the primer pair to obtain the amplification product; (3) Perform genotyping on the amplification products to obtain different genotypes of elephant male semi-fine wool sheep; associate the genotypes of elephant male semi-fine wool sheep with immune indicators; the immune indicators are the content of IgA, IgG or IgM.

[0014] Preferably, the amplification system in step (2) consists of 25 μL of PCR enzyme, 1 μL each of upstream and downstream primers, and 1 μL of template DNA.

[0015] Preferably, the amplification program in step (2) is: 98℃ for 2 min; 98℃ for 10 s, 60℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; and 72℃ extension for 2 min.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The SNP molecular marker described in this invention is located at the 221922324th base on chromosome 3 of the Rambouillet reference genome; the variant type is T / C, named g221922324T>C, and there are three genotypes. When the 221922324th base on chromosome 3 is T, the genotype is TT or TC; when the 221922324th base on chromosome 3 is C, the genotype is CC. Through association analysis between different genotypes and the content of immunoglobulins IgA, IgG, and IgM, it was found that the immunoglobulin IgA, IgG, and IgM levels of male semi-fine wool sheep individuals with the TT genotype were significantly lower than those with the CC and TC genotypes (p<0.05), while no significant difference was found between individuals with the CC and TC genotypes (p>0.05).

[0017] This invention can determine the levels of immunoglobulins IgA, IgG, and IgM in individual elephant male semi-fine wool sheep by detecting the base at nucleotide site 221922324 on chromosome 3. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in elephant male semi-fine wool sheep for non-diagnostic purposes. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] Figure 1 This is an agarose gel electrophoresis image of the PCR amplification products.

[0020] Figure 2 This is a sequencing peak diagram. Detailed Implementation

[0021] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0022] Example 1

[0023] 1 Sample Collection

[0024] At the Xiangxiong semi-fine wool sheep breeding farm in Ngari Prefecture, Tibet Autonomous Region, 121 adult Xiangxiong semi-fine wool sheep under natural grazing conditions were randomly selected. Five mL of fasting blood samples were collected in coagulation-promoting vacuum blood collection tubes, allowed to stand for 30 min, then centrifuged at 3500 r / min for 15 min. The supernatant was collected into clean PE tubes, sealed, and stored at -20℃ for immunoassay. Another 5 mL blood sample was collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed, placed in a sampling box with ice packs for temporary storage, and then transported back to the laboratory for freezing at -20℃ for DNA extraction.

[0025] 2. Main Reagents and Instruments

[0026] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kits, DL1000 markers, agarose, nucleic acid dyes, and PCR enzymes were purchased from Beijing TransGen Biotech Co., Ltd.; a NanoDrop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; an electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and a PCR instrument was purchased from BioRad. IgA, IgG, and IgM detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0027] 3 Methods

[0028] 3.1 Detection of immunoglobulins IgA, IgG, and IgM

[0029] Serum IgA, IgG, and IgM were measured using a detection kit from Nanjing Jiancheng Bioengineering Institute. First, a standard curve was established using standards. Then, 7 μL of distilled water, standard solution, and the sample to be tested were added to blank tubes, standard tubes, and test tubes, respectively. R1 solution was added to bring the total volume to 900 μL, and the tubes were incubated at 37°C for 5 min. The reading at 340 nm was recorded as A1. Next, 180 μL of R1 solution was added to each tube, and the tubes were incubated at 37°C for 5 min. The reading at 340 nm was recorded as A2. Finally, ΔA = A2 - A1 was calculated, and ΔA was substituted into the standard curve equation to calculate the concentrations of IgA, IgG, and IgM in the sample.

[0030] 3.2 Extraction of genomic DNA from blood

[0031] Genomic DNA was extracted from blood samples using the blood genomic DNA extraction kit from Beijing TransGen Biotech Co., Ltd. The concentration and purity of the extracted DNA were measured using a UV spectrophotometer. A concentration >20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 were sufficient for the experiment. The extracted DNA was stored at -20℃ for later use.

[0032] 3.3 Primer Design

[0033] Based on the gene sequence of chromosome 3 of the Rambouillet reference genome (ARS-UI_Ramb_v3.0, GCF_016772045.2) (GenBank accession number: NC_056056.1), a pair of specific primers containing the g221922324T>C SNP site was designed using Oligo 7 software.

[0034] Primer sequences: F: 5'-AACAACCTCCATTAGGCACCA-3'; R: 5'-AGTCTATTGCACATCCTCGGACA-3'; As shown in SEQ ID No. 2 and 3.

[0035] The amplified fragment was 335 bp in length, and the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0036] 3.4 PCR amplification and sequencing

[0037] PCR amplification system 25 μL: PCR enzyme 22 μL, forward and reverse primers 1 μL each, template DNA 1 μL.

[0038] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 60℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.

[0039] PCR products were detected by 1.5% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Sangon Biotech (Shanghai) Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID No. 1, and the SNP marker is located at position 188 of the nucleotide sequence shown in SEQ ID No. 1.

[0040] The sequencing results of PCR products were compared using the bioanalysis software MEGA 6.0, and the sequencing peak diagrams were analyzed to complete the typing.

[0041] 4. Statistical Analysis

[0042] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. The frequency of the g221922324T>C gene, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium were calculated using Popgen32 software. The polymorphism information content (PIC) was calculated using PIC software. The association between different genotypes and immunoglobulins IgA, IgG, and IgM in male elephant semi-fine wool sheep was analyzed using a general linear model in IBM SPSS Statistics 22 software. Results are expressed as mean ± standard error.

[0043] 5 Results

[0044] 5.1 PCR amplification and sequencing results

[0045] The amplified products of the g221922324T>C SNP site on chromosome 3 of Xiangxiong semi-fine wool sheep were detected using 1.5% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 335 bp, which is in line with the expected size, and the next step of the experiment can be carried out.

[0046] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2 .Depend on Figure 2 It can be seen that the TC mutation occurs at the g221922324T>CSNP site, resulting in three genotypes: TT, TC, and CC.

[0047] SEQ ID No.1

[0048] AACAACCTCCATTAGGCACCATCTTCCTTGATTTACTAAGGCTGAGAGAAGTGGCTTTCCTGAGGTTCCCCCGTGGCTGGCACAGACGGACATAGAACCCACATCTGTCTGACTACAAAGTCCTATTATTTCTACCCGGTCTGAGGGCTCCTTCCTGCCCGTTTCCT CCTCTGTACCCCCGCCCACTGGAGATTCAGCCCCTCTCTCACTCCTCACTTTGCGGACCTGTGTTGCCAACTCATGCGTAGGGTTTTAGCTTCGAAAATTGGAAGAAGGGGGCTTAGCTTAAAACCCCTGTTATGGCCAAAATAATGTCCGAGGATGTGCAATAGACT.

[0049] 5.2 Statistical Analysis Results

[0050] From a population genetics perspective, the genotype and allele frequencies of the g221922324T>C SNP locus on chromosome 3 in male semi-fine wool sheep were analyzed. Table 1 shows that at the g221922324T>C SNP locus, the CC genotype had the highest frequency and was the dominant genotype, while the C allele frequency was 89%, indicating it was the dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.20, the PIC was 0.18, and PIC<0.25, indicating low polymorphism.

[0051] Table 1. Polymorphism of SNP site g221922324T>C on chromosome 3 of male semi-fine wool sheep

[0052] 5.3 Association analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0053] The association between different genotypes of Xiangxiong semi-fine wool sheep and the levels of immunoglobulins IgA, IgG, and IgM was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that the levels of immunoglobulins IgA, IgG, and IgM in Xiangxiong semi-fine wool sheep with the TT genotype were significantly lower than those with the CC and TC genotypes (p<0.05). No significant differences were observed between individuals with the CC and TC genotypes (p>0.05). This indicates that the bases at the g221922324T>C SNP site on chromosome 3 of Xiangxiong semi-fine wool sheep are significantly correlated with IgA, IgG, and IgM levels (p<0.05), and are SNP markers related to IgA, IgG, and IgM in Xiangxiong semi-fine wool sheep. The results are shown in Table 2.

[0054] Table 2. Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM.

[0055] Note: Different lowercase letters in the same row indicate significant differences (p<0.05).

[0056] In summary, the SNP molecular marker described in this invention is located at the 221922324th base on chromosome 3 of the Rambouillet reference genome (ARS-UI_Ramb_v3.0, GCF_016772045.2); the variant type is T / C, named g221922324T>C, and there are three genotypes. When the 221922324th base on chromosome 3 is T, the genotype is TT or TC; when the 221922324th base on chromosome 3 is C, the genotype is CC. Through association analysis between different genotypes and the content of immunoglobulins IgA, IgG, and IgM, it was found that the immunoglobulin IgA, IgG, and IgM levels of male semi-fine wool sheep individuals with the TT genotype were significantly lower than those with the CC and TC genotypes (p<0.05), while no significant difference was found between individuals with the CC and TC genotypes (p>0.05). By detecting the base at nucleotide site 221922324 on chromosome 3 of male elephant semi-fine wool sheep, the levels of immunoglobulins IgA, IgG, and IgM in individual male elephant semi-fine wool sheep can be determined. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in male elephant semi-fine wool sheep for non-diagnostic purposes.

[0057] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of primer pairs for detecting SNP molecular markers related to immune traits in male elephant semi-fine wool sheep in the preparation of products for detecting the immunity of male elephant semi-fine wool sheep, characterized in that, The SNP is located at the 221922324th base on chromosome 3 of the Lambble sheep reference genome ARS-UI_Ramb_v3.0, GCF_016772045.2; the mutated base is T or C; the immune trait is the content of immunoglobulins IgA, IgG, and IgM. The levels of immunoglobulins IgA, IgG, and IgM in male elephant semi-fine wool sheep with the TT genotype were significantly lower than those in individuals with the CC and TC genotypes. There was no significant difference in the levels of immunoglobulins IgA, IgG, and IgM between individuals with the CC and TC genotypes.

2. The application according to claim 1, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2~3.

3. A method for non-diagnostic selection of male elephant semi-fine wool sheep using immunophenotypic markers, characterized in that, Includes the following steps: (1) Extract genomic DNA from Xiangxiong semi-fine wool sheep; detect the 221922324th base on chromosome 3 of the Lambula sheep reference genome ARS-UI_Ramb_v3.0, GCF_016772045.2; (2) Using the genomic DNA of the elephant male semi-fine wool sheep obtained in step (1) as a template, amplification is performed using the primer pair described in claim 2 to obtain the amplification product; (3) Genotypic analysis was performed on the amplification products to obtain different genotypes of male elephant semi-fine wool sheep; the genotypes of male elephant semi-fine wool sheep were correlated with immune indicators; the immune indicators were the contents of IgA, IgG or IgM; the contents of immunoglobulins IgA, IgG and IgM in male elephant semi-fine wool sheep individuals with TT genotype were significantly lower than those in individuals with CC and TC genotypes, and the contents of immunoglobulins IgA, IgG and IgM in individuals with CC and TC genotypes did not show significant differences.

4. The method according to claim 3, characterized in that, The amplification system in step (2) consists of 25 μL, including: 22 μL of PCR enzyme, 1 μL each of upstream and downstream primers, and 1 μL of template DNA.

5. The method according to claim 3, characterized in that, The amplification program for step (2) is as follows: 98℃ for 2 min; 98℃ for 10 s, 60℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.

Images