Microalga nannochloropsis sh2 and screening method and application thereof

Abstract

The present application relates to a kind of micro-nanqiqiu SH2 and its screening method and application, belong to microbial technology field.The micro-nanqiqiu SH2 is preserved in China typical culture collection center on June 19, 2025, and the preservation number is CCTCC NO:20251433.The micro-nanqiqiu SH2 of the present application is rich in long-chain polyunsaturated fatty acid, can simultaneously produce EPA and ARA and other multiple high-value products, greatly improves the comprehensive utilization value and economy of SH2, and lays a foundation for developing composite nutrient product for different people.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a microbial algae SH2 and its screening method and application. Background Technology

[0002] Long-chain polyunsaturated fatty acids (LCPUFAs) generally refer to straight-chain fatty acids with a carbon chain length of 18 to 22 carbon atoms and containing two or more double bonds. Based on the position of the first double bond from the methyl terminus (Ω end) in its molecular structure, they are mainly divided into two major series: Ω-3 and Ω-6. The Ω-3 series mainly includes alpha-linolenic acid (ALA), as well as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), which have important physiological activities; the Ω-6 series mainly includes linoleic acid (LA) and its metabolite arachidonic acid (AA).

[0003] Eicosapentaenoic acid (C20:5, EPA), as a long-chain polyunsaturated fatty acid in the Omega-3 series, plays an important role in regulating blood lipids, preventing arrhythmia, and preventing cardiovascular and cerebrovascular diseases, and is known as a "vascular cleanser." Its anti-inflammatory and nerve-development-promoting functions have also been widely confirmed. Due to the limited endogenous synthesis capacity of the human body, adults need to ingest an additional 250-500 mg of EPA daily. Currently, EPA is mainly derived from marine fish. However, due to the rapid decline in fish resources globally and the continuous growth of the world's population, fish oil will be unable to meet the market demand for EPA. In addition, fish oil also has disadvantages such as high cholesterol content, heavy metal ion pollution, and a fishy smell. Therefore, the development of new sustainable sources of EPA is urgently needed.

[0004] Microalgae have shown significant advantages as an alternative source of EPA: these single-celled photosynthetic microorganisms have high growth efficiency, do not occupy arable land resources, and can effectively utilize carbon dioxide and pollutants such as nitrogen and phosphorus in water as nutrient sources, while also possessing carbon fixation and water purification functions. Among the many EPA-rich microalgae, such as Monodus subterraneus, Phaeodactylum tricornutum, Nitzschia closterium, and Pavlova viridis, Nannochloropsis gaditana has been included in my country's feed ingredient catalog and new food ingredient list due to its comprehensive advantages such as rapid growth rate, strong lipid synthesis capacity, and high EPA content.

[0005] *Nannochloropsis* is a genus of eukaryotic marine microalgae with small cell sizes (approximately 2–4 μm in diameter). Currently, it includes six known species, such as *N. oculata*, *N. gaditana*, and *N. salina*. Its main fatty acid composition includes myristic acid (C14:0), palmitic acid (C16:0), palmitoleic acid (C16:1), arachidonic acid (C20:4), and EPA (C20:5), with EPA accounting for 20–40% of the total fatty acid content. It has broad application prospects in functional foods, pharmaceuticals, and biofuels.

[0006] However, the industrialization of *Microcystis aeruginosa* still faces bottlenecks such as limited biomass accumulation and immature production processes, resulting in high EPA production costs. Therefore, screening for high-yielding algal strains with superior traits to improve EPA synthesis efficiency and cultivation performance from the source has become the core path to promote its large-scale application and reduce overall production costs. Summary of the Invention

[0007] The first objective of this invention is to provide a microalgae SH2, wherein the EPA content in the algal powder of the microalgae SH2 is 33.37 mg / g.

[0008] The second objective of this invention is to provide a method for screening Microcystis SH2.

[0009] The third objective of this invention is to provide an application of Microcystis SH2.

[0010] To achieve the above objectives, the technical solution adopted by the present invention is as follows: Microcystis SH2 was deposited at the China Center for Type Culture Collection on June 19, 2025, with accession number CCTCC NO: 20251433.

[0011] Furthermore, the long-chain polyunsaturated fatty acid content in the algal powder of *Microcystis chrysogenum* SH2 accounts for 39.86% of the total fatty acids; the eicosapentaenoic acid content in the algal powder of *Microcystis chrysogenum* SH2 accounts for 26.62% of the total fatty acids; and the arachidonic acid content in the algal powder of *Microcystis chrysogenum* SH2 accounts for 4.9% of the total fatty acids.

[0012] Furthermore, the protein content in the algal powder of *Microcystis hygroscopica* SH2 accounts for 40.61% of the dry weight of the algal powder; the polysaccharide content in the algal powder of *Microcystis hygroscopica* SH2 accounts for 14.29% of the dry weight of the algal powder.

[0013] Application of Microcystis SH2 in fatty acid production.

[0014] Furthermore, the fatty acid is one or more of arachidonic acid, eicosapentaenoic acid, and long-chain polyunsaturated fatty acids.

[0015] The screening method for SH2 of *Microcystis globulus* includes the following steps: 1) Take a water sample, inoculate the water sample into F / 2 liquid medium, then enrich and culture to obtain algal solution, dilute the algal solution and spread it on F / 2 solid medium, culture until a single algal colony appears, and then purify to obtain pure microalgae; 2) Transfer individual pure microalgae to F / 2 liquid medium for enrichment culture to obtain seed culture, inoculate the seed culture into F / 2 liquid medium, and culture on a shaker. Select dominant algal strains based on the content of long-chain polyunsaturated fatty acids and eicosapentaenoic acid. 3) Identify the dominant algal strains.

[0016] Further, in step 2), the seed culture is inoculated into F / 2 liquid medium and cultured on a shaker to obtain algal culture. The algal culture is then centrifuged, washed with water, and freeze-dried to obtain algal powder. The algal powder contains 39.86% long-chain polyunsaturated fatty acids of total fatty acids; 26.62% eicosapentaenoic acid of total fatty acids; 4.9% arachidonic acid of total fatty acids; 40.61% protein of dry weight; and 14.29% polysaccharide of dry weight.

[0017] Furthermore, the culture conditions for the algal solution obtained by enrichment culture in step 1) are: temperature of 25 ℃, light intensity of 2000-4000 Lux, humidity of 40-50%, and light-dark cycle of 12 h:12 h.

[0018] Furthermore, the culture conditions for cultivating until a single algal colony appears in step 1) are: temperature 25 ℃, light intensity 2000-4000 Lux, humidity 40-50%, and light-dark cycle ratio of 12 h:12 h.

[0019] Furthermore, the culture conditions for the shaker culture in step 2) are as follows: temperature 25 ℃, light intensity 2000-4000 Lux, light-dark cycle 12 h:12 h, humidity 40-50%, rotation speed 150 rpm, and culture time 14 d.

[0020] The beneficial effects of this invention are: The microalgae SH2 of this invention is rich in long-chain polyunsaturated fatty acids (LCPUFA), which can simultaneously produce a variety of high-value products such as EPA and ARA, greatly enhancing the comprehensive utilization value and economic efficiency of SH2, and laying the foundation for the development of compound nutrient products for different populations.

[0021] The present invention, *Microcystis globulus* SH2, under standard autotrophic culture, has a LCPUFA content of 39.86% of total lipids, demonstrating that SH2 has the characteristic of efficiently accumulating high-value LCPUFA in lipid synthesis and metabolism. This characteristic allows SH2 algal powder or its extract to be used as a high-quality natural source of LCPUFA without the need for complex enrichment processes, and has direct application potential in functional foods, health products and other fields.

[0022] Microalgae SH2 can efficiently synthesize EPA, which accounts for up to 26.62% of total lipids. EPA is a recognized key Omega-3 fatty acid with anti-inflammatory and cardiovascular health-promoting physiological activities. Currently, the mainstream source of Omega-3 on the market is fish oil, which has problems such as fishy smell, potential accumulation of heavy metals, and limited sources. This invention utilizes microalgae to produce EPA, providing a sustainable, traceable, and pure plant-based alternative with broad commercial value and market prospects. Attached Figure Description

[0023] Figure 1 Microscopic image of *Microcystis spp.* SH2 from Example 1; Figure 2 This is the phylogenetic tree diagram of the SH2 system constructed in Example 1; Figure 3 This is a graph showing the EPA content of the eight microalgae strains in Example 1; Figure 4 This is a graph showing the ARA content of the eight microalgae strains in Example 1; Figure 5 This is a growth curve of *Microcystis spp.* SH2 in Example 1; Figure 6 The graph shows the protein and polysaccharide content of *Microcystis hygroscopica* SH2 in Example 1. Detailed Implementation

[0024] The present invention will be further described below with reference to the embodiments and accompanying drawings.

[0025] Example 1 I. Sampling Location and Sampling Time Seawater samples were collected in December 2024 from Lingshan Bay, Huangdao District, Qingdao City. The sampling point was 6 kilometers from the shore, and the water depth was 10 meters. The water samples were immediately placed in a 4 ℃ refrigerator after arriving at the laboratory, and the samples were processed within 48 hours after collection.

[0026] II. Separation and Purification F / 2 solid and liquid media were prepared using the F / 2 medium formula and 20 g / L sea salt crystals for the enrichment and isolation of microalgae.

[0027] The F / 2 culture medium formula is: NaNO3: 8.82 × 10⁻⁶ -4 M; NaH2PO4·H2O: 3.62×10 -5 M; Na₂EDTA·2H₂O: 1.17×10 -5 M; FeCl3·6H2O: 1.17×10 -5 M; MnCl2·4H2O: 9.09×10 -7 M; ZnSO4·7H2O: 8.00×10 -8 M; CoCl2·6H2O: 5.00×10 -8 M; CuSO4·5H2O: 1.00×10 -8 M; Na₂MoO₄·2H₂O: 8.22 × 10⁻⁶ -8 M; H2SeO3: 1.00×10 -8 M; NiSO4·6H2O: 1.00×10 -8 M; Na3VO4: 1.00×10 -8 M; K2CrO4: 1.00×10 -8 M; Vit.B1: 2.96 × 10 -7 M; Vit.H: 2.05 × 10 -9 M; Vit.B 12 3.69×10 -10 M.

[0028] F / 2 liquid medium contains the F / 2 medium formulation and 20 g / L sea salt crystals, while F / 2 solid medium is F / 2 liquid medium with 8% agar added.

[0029] First, 20 mL of water sample was inoculated into 100 mL of F / 2 liquid medium and placed in a light incubator for enrichment culture under conditions of 25 ℃, 4000 Lux, 45% humidity, and a 12 h:12 h light-dark cycle to obtain algal solution. The algal solution was then serially diluted with sterile water to 10⁻⁶. -1 10 -2 10 -3 The gradient dilutions were obtained by multiplying the dilutions by 100 μL each and spreading them onto F / 2 solid medium plates. The plates were then incubated at 25 ℃, 4000 Lux, 45% humidity, and a 12 h:12 h light-dark cycle until single algal colonies appeared. Subsequently, single algal colonies of varying morphology, size, and color were picked and streaked 2-3 times on solid plates for purification. The purity of the algal strains was preliminarily assessed using an inverted fluorescence microscope. Eight pure microalgae strains were isolated using the above method and named SHB, SHB1-3, SH2, SHB2-2, SHB3, SHC1, SHC2, and SHC3, respectively.

[0030] III. Cultivation of Microalgae Eight individual pure-culture microalgae were transferred to 100 mL of F / 2 liquid medium for enrichment culture to obtain seed culture. The seed culture of the eight microalgae was then subjected to initial OD values. 680 =0.2-0.3% was inoculated into an Erlenmeyer flask containing 100 mL of F / 2 liquid medium and cultured on a light-shaking incubator. The culture conditions for light-shaking incubation were as follows: temperature 25 °C, light intensity 4000 Lux, light-dark cycle 12 h:12 h, ambient humidity 45%, and continuous shaking at 150 rpm. After 14 days of culture, the algal solution was collected. The algal solution was centrifuged at 4 °C and 10000×g for 10 minutes to collect the algal cell precipitate, and washed three times with ultrapure water to obtain algal sludge. The obtained algal sludge was frozen overnight at -80 °C and then freeze-dried. Finally, the freeze-dried algae were ground into a fine powder to obtain algal powder, which was stored at -20 °C for subsequent component analysis.

[0031] IV. Fatty Acid Extraction and Methionization Five mg of algal powder from eight microalgae strains were weighed and added to 100 μL of a 2 g / L heptadecanoic acid internal standard solution and 500 μL of a freshly prepared 0.5 g / L sodium hydroxide-methanol solution. The mixture was vortexed at 1200 rpm for 2 h to induce methyl esterification. Subsequently, 40 μL of 98% sulfuric acid was added in a fume hood to neutralize the reaction system. After the reaction was complete, 400 μL of n-hexane was added to extract the generated fatty acid methyl esters. The mixture was vortexed and centrifuged at 14,000 rpm for 2 min. The upper n-hexane phase was collected, and the fatty acid composition and content were analyzed using gas chromatography-flame ionization detector (GC-FID).

[0032] The fatty acid composition analysis results are shown in Table 1. The proportion of LCPUFA in the total lipids of all eight microalgae strains was no less than 30%. Among them, strain SH2 had a particularly high proportion of LCPUFA, reaching 39.86%, and was rich in EPA, accounting for 26.62% of the total fatty acids. Further quantitative analysis of EPA and ARA in SH2 yielded the following results: Figure 3 and Figure 4 As shown, from Figure 3 , Figure 4 It can be seen that SH2 has the highest EPA content, with an EPA content of 33.37 mg / g and an ARA content of 9.74 mg / g.

[0033] Table 1. Fatty acid composition analysis results of 8 microalgae strains

[0034] V. Gene Sequencing and Identification A single SH2 algal colony was picked and suspended in 20 μL of sterile water. The colonies were repeatedly pipetted until dispersed, forming a uniform pale green suspension. The PCR tube was heated in a 99 ℃ metal bath for 20 min, then cooled to 4 ℃. The resulting solution was used as the PCR template. The reaction mixture consisted of: 1.0 μL of 18F primer (CCAACCTGGTTGATCCTGCCAGTA), 1.0 μL of 18R primer (CCTTGTTACGACTTCACCTTCCTCT), 1.5 μL of DNA template, 25 μL of 2×Taq enzyme, and finally, sterile water was added to a total volume of 50 μL. The PCR amplification program was as follows: 95 ℃ pre-denaturation for 5 min; followed by 35 cycles of amplification (95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 2 min); and a final extension at 72 ℃ for 10 min.

[0035] PCR products were verified by 1% agarose gel electrophoresis. Positive samples with clear bands and no impurities were sent to Sanger sequencing at Sangon Biotech to obtain 18S rDNA sequences. The sequencing results were compared with BLAST homology in the GenBank database, and the results showed that the algal strain had 100% homology with *Nannochloropsis gaditana* sp. Figure 2 To construct the phylogenetic tree, the microalgae was ultimately identified as belonging to the genus *Nannochloropsis gaditana* and named SH2 (*Nannochloropsis gaditana* sp.SH2). Figure 1 Microscopic image of *Nannochloropsis gaditana* sp., magnified 40 times.

[0036] The species *Nannochloropsis gaditana* sp. SH2 was deposited on June 19, 2025, at the China Center for Type Culture Collection (CCTCC) located at Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number CCTCC NO: 20251433. It is named *Nannochloropsis gaditana* sp. SH2.

[0037] VI. Cultivation and Nutrient Detection of Micrococcus pluvialis SH2 The identified *Microcystis spp.* SH2 was cultured according to the method in step three. Biomass changes were reflected by measuring the absorbance at 680 nm. 1 mL of algal solution was sampled every 48 h, and its growth curve was plotted. The results are as follows: Figure 5As shown, *Microcystis spp.* SH2 entered a stable phase after 20 days of cultivation, with a biomass dry weight of 3.33 g / L. The algae were collected, and freeze-dried algal powder was prepared according to the method in step three. Nutrient composition analysis was performed, and the specific determination methods are as follows: (1) Protein content was determined using the Kjeldahl method (referring to national standards) and then converted to total nitrogen; (2) Carbohydrate content was determined using the phenol-sulfuric acid method. The results are as follows: Figure 6 As shown, after 20 days of autotrophic culture, the SH2 protein content of *Microcystis aeruginosa* reached 40.61%, and the polysaccharide content was 14.29%.

[0038] Other embodiments of this disclosure will readily occur to those skilled in the art upon consideration of the specification and practice of the disclosure herein. This disclosure is intended to cover any variations, uses, or adaptations of this disclosure that follow the general principles of this disclosure and include common knowledge or customary techniques in the art not disclosed herein. The specification and examples are to be considered exemplary only, and the true scope and spirit of this disclosure are indicated by the claims.

[0039] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. The scope of patent protection of the present invention shall be determined by the claims. Similarly, any equivalent structural changes made based on the content of the present invention's specification shall also be included within the scope of protection of the present invention.

Claims

1. Microcystis SH2, characterized in that, Micrococcus SH2 was deposited at the China Center for Type Culture Collection on June 19, 2025, with accession number CCTCC NO: 20251433. The long-chain polyunsaturated fatty acid content in the algal powder of Micrococcus SH2 accounted for 39.86% of the total fatty acids; the eicosapentaenoic acid content accounted for 26.62% of the total fatty acids; the arachidonic acid content accounted for 4.9% of the total fatty acids; the protein content accounted for 40.61% of the dry weight of the algal powder; and the polysaccharide content accounted for 14.29% of the dry weight of the algal powder.

2. The application of Micrococcus pluvialis SH2 as described in claim 1 in the production of fatty acids.

3. The application of *Microcystis spp.* SH2 according to claim 2, characterized in that, The fatty acids include one or more of arachidonic acid and eicosapentaenoic acid.

Images