A rice grain width regulating RNA sequence microRNA-osmiRNA5499 and application thereof

Abstract

The present application relates to the field of biotechnology, and particularly relates to a kind of RNA sequence microRNA-OsmiRNA5499 for regulating rice grain width and its application.RNA sequence microRNA-OsmiRNA5499 is from the 4th chromosome position of rice Nangeng 9108: 17241717-17241841, is obtained by RNA extraction and gene cloning, and it is negative regulation in the regulation of rice grain width;The nucleotide sequence of RNA sequence includes: (1) the nucleotide sequence shown in SEQ ID NO.1;Or, (2) the complementary sequence of the nucleotide sequence shown in SEQ ID NO.1;Or, (3) sequence with at least 90% homology with the nucleotide sequence shown in SEQ ID NO.1 and retains the grain width control activity.The present application increases the rice grain width of the mutant obtained by knocking out OsmiRNA5499 by guide editing technology by 4.25%.The present application develops a new type of grain width increasing material based on the new function of rice OsmiRNA5499, and provides a genetic basis for the breeding of rice grain width increasing varieties.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a microRNA-OsmiRNA5499 RNA sequence that regulates the width of rice grains and its applications. Background Technology

[0002] Rice yield is mainly composed of tiller number, number of grains per panicle, and thousand-grain weight. In the rice industry system, grain width is a core morphological trait that determines yield, processing quality, and market value. Its strategic importance is reflected in the demand of the entire industry chain: From the production end, grain width directly contributes to the thousand-grain weight, a component of yield. Wider grain morphology can significantly improve the grain storage capacity per unit area, and is a core agronomic trait that determines thousand-grain weight and final yield, providing a basic guarantee for high and stable yield.

[0003] Over the past few decades, scientists have cloned more than 60 genes regulating grain size, mainly focusing on G protein signaling pathways, MAPK signaling pathways, and ubiquitin-proteasome pathways. However, existing grain width enhancement technologies face serious challenges: traditional hybridization breeding is time-consuming and prone to introducing undesirable linked traits, while chemical mutagenesis carries the risk of uncontrollable mutations. Under this industrial bottleneck, microRNA (miRNA) has emerged as a breakthrough solution due to its inherent ability to finely regulate gene expression. These non-coding small RNA molecules, approximately 21 nucleotides (nt) in length, can precisely regulate the expression activity of target genes at the post-transcriptional level by sequence-specific base pairing with the 3'-untranslated region (3'-UTR) of target gene mRNA. Their mechanism of action primarily relies on the assembly of the RNA-induced silencing complex (RISC) to cleave and degrade target mRNA or inhibit translation, thereby finely coordinating the spatiotemporal dynamics of developmental pathways. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a microRNA-OsmiRNA5499 for regulating rice grain width and its applications. This invention utilizes high-throughput construction of a whole-genome miRNA knockout mutant library in rice to identify for the first time a key factor, OsmiRNA5499, with a significant negative regulatory effect on grain width formation. This mutant exhibits a stable and significant grain width phenotype in T2 generation homozygous plants, with an average increase of 4.25% in grain width compared to the wild-type control, while maintaining unchanged grain length, thereby increasing thousand-grain weight and achieving targeted optimization of grain structure. This provides a breakthrough tool for high-yield rice breeding.

[0005] Therefore, the present invention provides the following technical solution:

[0006] In a first aspect, the present invention provides an RNA sequence microRNA-OsmiRNA5499 for regulating rice grain width in an optional embodiment. The RNA sequence microRNA-OsmiRNA5499 was obtained by RNA extraction and gene cloning from chromosome 4 of rice variety Nangeng 9108, located at positions 17241717-17241841. It exhibits negative regulation in regulating rice grain width.

[0007] The nucleotide sequence of the RNA sequence includes:

[0008] (1) The nucleotide sequence as shown in SEQ ID NO.1; or,

[0009] (2) The complementary sequence of the nucleotide sequence shown in SEQ ID NO.1; or,

[0010] (3) A sequence having at least 90% homology with the nucleotide sequence shown in SEQ ID NO.1 and retaining the grain width regulation activity.

[0011] Preferably, the precursor sequence of the RNA sequence microRNA-OsmiRNA5499 is shown in SEQ ID NO.2.

[0012] Secondly, in an optional embodiment, the present invention provides a method for preparing a rice mutant gene with wide grains, comprising the following steps:

[0013] The OsmiRNA5499 precursor region on chromosome 4 of the rice variety Nanjing 9108 was targeted for deletion using the Prime Editing system. The target deletion fragment was 178 bp in length, resulting in a rice mutant gene with wide grains.

[0014] The target deletion fragment includes the DNA sequence corresponding to the microRNA-OsmiRNA5499 RNA sequence that regulates the width of rice grains.

[0015] Preferably, the nucleotide sequence of the target deletion fragment is as shown in SEQ ID NO.3.

[0016] Preferably, the nucleotide sequence of the rice mutant gene with wide grains is shown in SEQ ID NO.4.

[0017] Thirdly, in an optional embodiment, the present invention provides an expression vector into which the DNA sequence corresponding to the RNA sequence microRNA-OsmiRNA5499, which regulates the width of rice grains, is inserted, and a recombinant plasmid is used as the host cell, either a microbial cell or a plant cell.

[0018] Fourthly, in an optional embodiment, the present invention provides a transformant, wherein the transformant stably contains the above-mentioned expression vector, or is a microbial cell or plant cell whose genome integrates the DNA sequence corresponding to the above-mentioned RNA sequence microRNA-OsmiRNA5499 that regulates the width of rice grains.

[0019] Fourthly, in an optional embodiment, the present invention provides the application of the above-mentioned RNA sequence microRNA-OsmiRNA5499, which regulates the width of rice grains, in regulating the ability of plant grain development.

[0020] Preferably, the method for regulating plant seed development is as follows: after knocking out the DNA sequence corresponding to the RNA sequence microRNA-OsmiRNA5499 in the plant genome, the plant seeds are planted to obtain wide-seed plant offspring.

[0021] Preferably, the plant includes one of corn, rice, wheat, rapeseed, and sorghum.

[0022] The nucleotide sequence of SEQ ID NO.1 is as follows:

[0023] GAAGGAAGAAUCGUUAUGGAA.

[0024] The nucleotide sequence of SEQ ID NO.2 is as follows:

[0025] TTTCTGCTGTTCCATGTTCGATTCTTCATTTGGGGATCTAACATCAGCGGGAACCTTAAGTCTTCTTCACATATCCATTTGATGGATAGATTGCCGAAGGAAGAATCGTTATGGAATGATGCAGAT.

[0026] The nucleotide sequence of SEQ ID NO.3 is as follows:

[0027] GGTAGGAATTTCTGCTGTTCCATGTTCGATTCTTCATTTGGGGATCTAACATCAGCGGGAACCTTAAGTCTTCTTCACATATCCATTTGATGGATAGATTGCCGAAGGAAGAATCGTTATGGAATGATGCAGATATGAAACATGAGCTAAATTCAAAATGGTTTAGATTCAGCCGTCG.

[0028] The nucleotide sequence of SEQ ID NO.4 is as follows:

[0029] ACTGGTGGTGCTCTATTTATACGTGAGTTGCCTAGCTTCTAGCTATCTACATAAATTGCACATACATGTTTCTGTTCGAGGTAGATAAAGACGGAAAAGAGGCACAAGATATATATATTTTATCATGAAATTCTAGTACTATCTAATATTTCTTCGTCTTTCACAGCCTCAGCCAAATGTGTGGCACGTAGGAATAGGAGACTCTGGTCAGTCCA TGTCCTCTCAGGCTCTGCTTGGGGGCTCAGGTTATCATCAACTCACCGTGCCGTAGTGTACATCAAGATAGTACTGTACTGTAACAGTAATATCTCGTAAAACTGCTGGGTGAAAGGTGCAGTGAAGTACGTGTGACCGAGTTGAGGACATTGAAGTTCTTGTACTGACAATGAGTGAGGACATTGAAGAAAATTGCTTCACCTGAGCAGGAGAT.

[0030] Compared with the prior art, the present invention has one of the following beneficial effects:

[0031] 1. This invention knocks out OsmiRNA5499 using guided editing technology, resulting in a 4.25% increase in grain width in the resulting mutant rice. Based on the novel function of rice OsmiRNA5499, this invention has developed a new material for increasing grain width, providing a genetic basis for breeding rice varieties with increased grain width. Attached Figure Description

[0032] Figure 1 The image shows the detection electrophoresis diagram of the OsmiRNA5499 mutant and the rice variety Nanjing 9108 provided in Example 2 of this invention. In the image, lane 1 is the DNA marker (100bp-8000bp), lane 2 is the wild type, and lanes 3 and 4 are the OsmiRNA5499 knockout fragments.

[0033] Figure 2 This is a schematic diagram of the sequencing results of the OsmiRNA5499 mutant and the rice variety Nanjing 9108 provided in Example 2 of the present invention.

[0034] Figure 3 Phenotypic diagram of grain width of OsmiRNA5499 mutant and rice variety Nanjing 9108 provided in Example 2 of the present invention;

[0035] Figure 4This is a statistical analysis of the significant differences in grain width between the OsmiRNA5499 mutant and the rice variety Nanjing 9108 provided in Example 2 of the present invention. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0037] Unless otherwise specified, the methods used in the following embodiments are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0038] Example 1

[0039] The precursor region of OsmiRNA5499 in the genome of the rice variety Nanjing 9108 (Oryza sativa ssp. japonica) was targeted for deletion using the Prime Editing system. The target deletion fragment was 178 bp in length (as shown in SEQ ID NO.3) to verify the granule size regulation function of this miRNA. The specific protocol is as follows:

[0040] (1) Obtain nucleotide sequences containing 200 bp extensions before and after the OsmiRNA5499 precursor region from the NCBI website, and search for suitable PAM sites near the start and end positions of the target gene coding sequence. The PAM site for the forward sequence is -NGG, and for the reverse sequence it is CCN-;

[0041] (2) Using the laboratory-optimized guided editing system vector, the PlantPegDesigner online platform (http: / / www.plantgenomeediting.net) was used to set the editing sequence format according to the system requirements and input the target sequence to obtain the spacer sequence, reverse transcription template (RTT), and primer binding sequence (PBS) required for pegRNA design. Subsequently, the linker sequence was obtained through the pegLIT website (peglit.liugroup.us), and primers were designed according to different genome editing strategies to complete fragment assembly. Specific primers were designed as follows:

[0042] OsmiRNA5499-sgRNA-1F: (5'>AATAATggtctcTTGCAacgtaggaataggagacGGTgtttcagagctatgctgg<3')

[0043] OsmiRNA5499-sgRNA-2F: (5'>AATAATggtctcTctggTGCAgacatggactgaccagaCGAgtttcagagctatgctgg<3')

[0044] OsmiRNA5499-sgRNA-1R: (5'>AATAATggtctcTcgcgTCAAGGATTGATgaataggagactctggtcagtcgcaccgactcggtgccac<3')

[0045] OsmiRNA5499-sgRNA-2R: (5'>AATAATggtctcTTCAAGATTTATTactgaccagagtctcctattcgcaccgactcggtgccac<3')

[0046] (3) The vector was constructed using a dual-tRNA tandem method targeting two sites. The synthesized primers were amplified using annealed sg2.0 sequences as templates. After purification, the concentrations of each fragment were adjusted as required, and the vector was constructed using the Golden-Gate method. The specific method is as follows:

[0047] After the above primers were synthesized, the concentration was diluted to 10 μM and annealed according to the following system:

[0048]

[0049] After the system is prepared, it is placed in a 37℃ oven for 1 h. Then, 2.5 μL of 1 mol / L NaCl is added, and the mixture is placed in a preheated 95℃ metal bath for 5 s. After that, the metal bath power is turned off and the mixture is allowed to cool naturally for 2-3 h.

[0050] After annealing, perform Golden-Gate according to the following system:

[0051]

[0052] After the PCR reaction, *E. coli* XL1-Blue competent cells were removed from the -80°C freezer and placed on ice until partially thawed to a mixture of ice and water. All PCR products were then added to the competent cells, and the cells were incubated on ice for 30 minutes. During this time, the metal bath was preheated to 42°C. After the ice bath, the competent cells were heat-shocked in the metal bath at 42°C for 90 seconds, and then immediately returned to ice to cool for 2 minutes. Then, 1 mL of LB liquid medium was added, and the cells were incubated at 37°C and 120 rpm for 1 hour. The revived bacterial culture was centrifuged at 12,000 rpm for 30 seconds to concentrate the cells. After resuspending, the cells were spread onto LB solid medium containing kanamycin and incubated overnight upside down at 37°C.

[0053] The next day, the plates were removed, and single colonies were picked for identification. Each single colony was simultaneously streaked onto a plate containing both Kana and spectinomycin (Spec) and incubated at 37°C for at least 4 hours to observe whether the colonies could grow on the Spec resistant plates. Colonies that grew on Kana plates but not on Spec plates were selected for further colony PCR verification.

[0054] (4) The construct is expected to delete a 178 bp fragment in the region where OsmiRNA5499 is located (as shown in SEQ ID NO.3), and the deleted fragment was verified in Example 2.

[0055] Example 2

[0056] 1. The constructed guide editing vector PE-miR5499 was transformed into embryogenic callus of Nanjing 9108 rice using Agrobacterium-mediated transformation (strain EHA105). Leaf samples were taken from T0 generation regenerated plants, and genomic DNA was extracted using the CTAB method. The specific steps were as follows: 100 mg of leaf samples were ground with liquid nitrogen, 900 μL of preheated CTAB lysis buffer was added, and the mixture was incubated at 65℃ for 45 minutes. Extraction was performed using chloroform-isoamyl alcohol (24:1), and DNA was precipitated with isopropanol followed by washing with 70% ethanol.

[0057] Use specific primer pairs:

[0058] OsmiRNA5499-KF: (5'>ACTGGTGTGCTCTATTTATACGT<3')

[0059] OsmiRNA5499-KR: (5'>ATCTCCTGCTCAGGTGAAGC<3')

[0060] PCR amplification was performed (annealing temperature 58℃, extension time 30s). In the wild type, the amplified product was 609 bp in length, containing the complete precursor miRNA sequence of SEQ ID NO.2 plus the upstream (212 bp) and downstream (272 bp) sequences (containing the DNA sequence corresponding to the mature miRNA sequence of SEQ ID NO.1). A mutant that successfully deleted the target fragment (178 bp) should show a specific band of 431 bp, i.e., the sequence of SEQ ID NO.4. Electrophoresis was performed (electrophoresis results are shown below). Figure 1 As shown), and compared by sequencing (see...). Figure 2 The results showed that the mutant plants contained a large deletion, consistent with the design, and positive plants were obtained. After propagation, T2 generation positive plants were obtained and used to determine grain width.

[0061] 2. To eliminate phenotypic interference that may be caused by T-DNA insertion, two independent T2 generation rice lines were constructed in this study. For the wild-type Nanjing 9108 and the two aforementioned T2 lines, grain width was statistically analyzed using a standardized method: physiologically plump grains were selected as the observation unit for each line, and five parallel biological replicates were set up (each replicate measured ≥100 grains). The observation results are visualized using bar charts (see [see results]). Figure 3 and Figure 4 ).

[0062] pass Figure 3 It can be seen that, under the experimental conditions of selecting plump grains in physiological condition as the observation unit and setting 5 parallel biological replicates (each replicate measuring ≥100 grains), the grain width of the two independent OsmiRNA5499 mutants (miR5499-1 and miR5499-2) is significantly larger than that of the rice variety Nanjing 9108 (wild type), which preliminarily shows that the OsmiRNA5499 mutant can increase the grain width of rice.

[0063] pass Figure 4 It can be seen that the grain width of rice from the OsmiRNA5499 mutant is 4.25% wider on average than that of wild-type Nanjing 9108. The differences in grain width between the two OsmiRNA5499 mutants and wild-type Nanjing 9108 reached a statistically significant level after analysis, eliminating the interference of random errors on the grain width difference results, and clearly confirming that knocking out OsmiRNA5499 has a significant effect on increasing the grain width of rice.

[0064] Although the principles of the present invention have been described in detail above with reference to preferred embodiments, those skilled in the art should understand that the above embodiments are merely illustrative explanations of the implementation of the present invention and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute a limitation on the scope of the present invention. Any obvious changes, such as equivalent transformations or simple substitutions, based on the technical solutions of the present invention without departing from the spirit and scope of the present invention fall within the protection scope of the present invention.

Claims

1. A method for preparing a rice mutant gene with wide grains, characterized in that, Includes the following steps: Using a guided editing system, the precursor region of OsmiRNA5499 on chromosome 4 of the rice variety Nanjing 9108 was targeted for deletion. The target deletion fragment was 178 bp long, resulting in a rice mutant gene with wide grains. The target deletion fragment includes the DNA sequence corresponding to OsmiRNA5499, which regulates the width of rice grains. The sequence of OsmiRNA5499 is shown in SEQ ID NO.1, and the nucleotide sequence of the target deletion fragment is shown in SEQ ID NO.

3.

2. The application of OsmiRNA5499 knockout in regulating rice grain development, characterized by: The method for regulating rice grain development is as follows: after knocking out the DNA sequence corresponding to OsmiRNA5499 in the rice genome, rice seeds are planted to obtain wide-grain rice offspring. The sequence of OsmiRNA5499 is shown in SEQ ID NO.1.

Images