OsSZF12 gene and application thereof in improving rice salt tolerance

Abstract

The application discloses OsSZF12 A gene and application thereof in improving salt tolerance of rice OsSZF12 The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO:1. OsSZF12 The application also discloses a phenotype of a mutant strain of the gene under 120 mM NaCl treatment, and the protein and the coding gene thereof have important theoretical and practical significance for research on a plant salt tolerance mechanism and improvement of salt tolerance and related traits of the plant, play an important role in plant salt tolerance molecular breeding, and have a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and gene technology, specifically involving... OsSZF12 Genes and their application in improving salt tolerance in rice. Background Technology

[0002] Rice is one of the world's most important food crops, serving as a primary food source for more than half the world's population. However, due to continuous global population growth, over-fertilization, and other unhealthy farming practices, soil salinization has damaged arable land resources and caused significant losses in agricultural production. Meanwhile, China possesses vast coastal tidal flats and inland saline-alkali lands, representing a huge potential for comprehensive utilization of these land reserves. Nevertheless, the existence of saline-alkali land restricts crop growth, reduces land utilization, and poses a threat to agricultural production. Developing and utilizing saline-alkali land is of significant practical importance for improving the ecological environment and ensuring food security.

[0003] Rice is a salt-sensitive crop, and its sensitivity to salt stress varies at different developmental stages. During seed germination, saline-alkali environments significantly reduce germination rate, germination potential, germination index, and seed vigor index. In the seedling stage, salt stress leads to reduced plant height and root length, leaf curling, decreased root length and lateral root number, and decreased seedling biomass, root number, and root volume. Furthermore, salt stress also reduces the number of effective tillers, delays heading, decreases pollen viability, and hinders panicle differentiation, ultimately affecting rice yield.

[0004] Saline-alkali land is an important reserve of arable land and a potential "granary" in my country. By promoting salt-tolerant rice cultivation techniques, saline-alkali land resources can be fully utilized, improving grain yield and quality. Furthermore, salt-tolerant rice has advantages such as wind resistance, flood resistance, and resistance to pests and diseases, which are beneficial to protecting national food security. Rice is the preferred food crop for improving coastal tidal flats and saline-alkali land, and has already generated considerable economic benefits. Converting saline-alkali land to rice cultivation has the advantages of being simple, not affecting agricultural production, not polluting the environment, and having significant improvement effects. Studies have found that planting salt-tolerant rice can not only significantly reduce soil salinity and soil bulk density, but also increase soil organic matter content and soil water retention capacity.

[0005] In summary, the background of salt-tolerant rice technology involves multiple aspects, including the impact of saline-alkali land on rice growth, breeding techniques for salt-tolerant rice, and related research progress. In the future, with continuous technological advancements, more salt-tolerant, high-yielding, and high-quality rice varieties will be bred and widely applied in actual production. This is of great significance for ensuring high and stable rice yields on saline-alkali farmland, increasing crop planting area and total yield by utilizing marginal saline-alkali land, and safeguarding global food security. Summary of the Invention

[0006] The purpose of this invention is to provide OsSZF12 Genes and their application in improving salt tolerance in rice.

[0007] A sort of OsSZF12 Genes, the ones mentioned OsSZF12 The polynucleotides of the gene are shown in (a), (b), (c), or (d): (a) A polynucleotide as shown in SEQ ID No: 1; or (b) A polynucleotide whose complementary sequence to SEQ ID No: 1 can hybridize under stringent hybridization conditions, and whose encoded protein still has salt tolerance. (c) A polynucleotide that has at least 90% or more homology with the polynucleotide shown in SEQ ID No: 1; or (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, wherein the protein encoded by the polynucleotide mutant still has salt-tolerant activity.

[0008] An OsSZF12 protein, the amino acid sequence of which is shown in (a), (b), or (c): (a) The amino acid sequence as shown in SEQ ID No: 2 of the sequence listing; or (b) Amino acids that have at least 90% or more homology with the amino acid shown in SEQ ID No: 2; or (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids based on the protein shown in SEQ ID No: 2, and the protein still has salt-tolerant activity.

[0009] Includes the OsSZF12 The carrier of genes.

[0010] Includes the OsSZF12 Engineered bacteria that act as vectors for genes.

[0011] The detection OsSZF12 Primers for any segment of a gene.

[0012] The OsSZF12 Application of genes in breeding salt-tolerant rice varieties.

[0013] A method to improve the salt tolerance of rice and reduce OsSZF12 Protein expression levels in rice.

[0014] The method includes transforming rice cells with the aforementioned DNA molecules or polypeptides, or silencing or mutating the aforementioned DNA molecules or polypeptides contained in the target rice, and then cultivating the transformed rice cells into plants to obtain transgenic rice with altered salt tolerance, wherein the salt tolerance can be increased or decreased.

[0015] The beneficial effects of this invention: This invention is the first to identify a method that reduces the water content of rice. OsSZF12 Gene expression significantly enhances the salt tolerance of rice seedlings, resulting in a higher survival rate of transgenic mutant lines compared to wild-type plants after a period of stress treatment. The protein and its encoding gene of this invention have significant theoretical and practical implications for the study of plant salt tolerance mechanisms and for improving plant salt tolerance and crop yield traits. They will play a crucial role in crop genetics and breeding and have broad application prospects. Attached Figure Description

[0016] Figure 1 As shown OsSZF12 Results of expression induced by 120 mM NaCl.

[0017] Figure 2 As shown OsSZF12 DNA identification results of mutant plants.

[0018] Figure 3 As shown OsSZF12 Phenotype of mutant transgenic plants after salt stress treatment.

[0019] Figure 4 As shown OsSZF12 Survival rate of mutant transgenic plants after salt stress treatment. Detailed Implementation

[0020] To facilitate understanding of the present invention, a more comprehensive description will be given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0021] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0022] Example 1 OsSZF12 Gene salt-induced expression analysis Rice seedlings of variety ZH11 at the two-leaf-one-heart stage were collected. One group served as a control, while the other group was treated with 120 mM NaCl. Samples were collected at 0, 0.5, 1, 2, 6, 8, 10, and 12 h after treatment. Total RNA was extracted according to the instructions of the Vazyme (Nanjing Novizan Biotechnology Co., Ltd.) RNA extraction kit. The RNA was then reverse transcribed into cDNA according to the instructions of the Vazyme RNA reverse transcription kit. ACTIN was used as an internal control gene. OsSZF12 Primers XF and XR were designed for gene sequencing, and qPCR analysis was performed with three biological replicates at each time point. Results showed that after 2 h of salt treatment... OsSZF12 The expression level of [the gene] initially increased, reaching its peak at 8 hours, and then began to decline, while the control group showed no significant changes in gene expression at any time point, indicating that [the gene expression level is lower than that of the control group]. OsSZF12 The expression of [something] is induced by salt stress ( Figure 1 ).

[0023] XF: GCATAGGCAGCTTGGATGTT (SEQ ID No: 3); XR: CAGGAGCATTGACAGCAGAA (SEQ ID No: 4); Example 2 OsSZF12 Obtaining mutant transgenic plants exist OsSZF12 A suitable PAM site is selected at the 5' end of the gene, and a specific single-stranded guide RNA (sgRNA) is designed based on the selected PAM site. Typically, a sequence of 20 bases in length is chosen to ensure its binding specificity to the target gene. The designed sgRNA sequence is cloned into a vector to form a complete CRISPR-Cas9 expression vector. The constructed vector is transformed into Agrobacterium EHA105, and then transformed into the ZH11 variety through callus infection to obtain mutant plants. sf-c1 and szf-c2 DNA fragments were amplified using primer pairs LP1 / RP1 and LP2 / RP2 and then sequenced. OsSZF12 DNA identification results and corresponding coding amino acid sequences of mutant plants are as follows: Figure 2 As shown.

[0024] LP1: TTAATTGATCACATGGTATTAGTG (SEQ ID No: 5); RP1: TTGATAGAGCTGAAATTGTCGGC (SEQ ID No: 6); LP2: GGCAGCAGCGTTGCAAGTACAATC (SEQ ID No: 7); RP2: AAACGATTGTACTTGCAACGCTGC (SEQ ID No: 8); Example 3 OsSZF12 Salt tolerance analysis of mutant plants right OsSZF12 mutant lines szf-c1 and szf-c2 Salt tolerance of seedlings was assessed. Seeds with uniform germination were soaked at 37℃ for one day and then germinated. Uniformly germinating seeds were planted in 96-well plates for hydroponics and cultured in Yashida medium until the seedlings reached the two-leaf-one-heart stage. The culture was then replaced with a nutrient solution containing 120 mM NaCl for two weeks of treatment. Observations were conducted after two weeks of treatment. sf-c1 and szf-c2 Salt tolerance enhanced ( Figure 3 According to the survival rate statistics, the survival rate of ZH11 is approximately 10%. sf-c1 and szf-c2 The survival rate is around 20%, and there is a significant difference between the two. Figure 4 ),show OsSZF12 Negative regulation of salt tolerance in rice seedlings.

[0025] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A method for improving the salt tolerance of rice, characterized in that, The expression level of OsSZF12 protein in rice was reduced. The amino acid sequence of the OSSZF12 protein is shown in SEQ ID No: 2.

Images