A combination of snp molecular markers for identifying torreya grandis sex and application thereof

Abstract

The application discloses the technical field of plant species molecular identification, and discloses a SNP molecular marker combination for identifying the gender of Torreya grandis and application thereof. The SNP molecular marker combination comprises three SNP molecular marker sites of SNP1, SNP2 and SNP3. The SNP1 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO. 1, and the genotype is C or T. The SNP2 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO. 2, and the genotype is C or A. The SNP3 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO. 3, and the genotype is A or G. When the SNP1, SNP2 and SNP3 are in a TCA combination, the Torreya grandis is male, otherwise, the Torreya grandis is female. By detecting the base difference of the three specific SNP sites, the gender of Torreya grandis seedlings can be accurately and early determined, so that the breeding cycle is significantly shortened and the breeding cost is reduced.

Description

Technical Field

[0001] This invention relates to the field of molecular identification technology for plant species, specifically to a combination of SNP molecular markers for identifying the sex of Torreya grandis and its application. Background Technology

[0002] Torreya grandis ( Torreya grandis The seeds of Torreya grandis (Chinese nut) are rich in oils and nutrients, possessing high economic and medicinal value. Torreya grandis is a dioecious plant, meaning each plant has only male or female reproductive organs. This biological characteristic places special demands on its cultivation and propagation. A proper male-female ratio is fundamental to ensuring seed yield. However, in actual production, Torreya grandis typically takes more than 10 years to reach sexual maturity and exhibit distinct sex characteristics. This delayed sex manifestation significantly limits its planting efficiency and genetic breeding progress.

[0003] Currently, the sex differentiation mechanism in gymnosperms such as Torreya grandis remains poorly understood, and effective means for early identification of male and female plants are lacking. Traditional methods mainly rely on plant morphological observation or histological examination, which are time-consuming, cumbersome, and have low accuracy. However, with the development of molecular biology techniques, using DNA molecular markers for early plant sex identification has become an important direction in modern breeding. For example, in plants such as Ginkgo biloba, Hops, and Hippophae rhamnoides, studies have used methods such as genome resequencing, SNP screening, GWAS, and K-mer counting to locate sex-related genetic regions and have successfully developed various sex-specific molecular markers such as KASP, CAPS, and InDel. However, due to the large size, high heterogeneity, and complex sex determination mechanism of Torreya grandis, there is currently no systematic report on its sex-determining sites and stable molecular markers. With the release of the Torreya grandis reference genome and the maturity of high-throughput sequencing technology, conducting whole-genome resequencing, sex-related site discovery, and haplotype structure analysis is expected to overcome this research bottleneck.

[0004] Therefore, developing a set of molecular marker discovery technology system for sex differentiation in Torreya grandis will not only help to elucidate the genetic mechanism of its sex differentiation, but also be widely used in early sex screening, germplasm resource evaluation, targeted breeding and cultivation configuration optimization, which has important scientific research significance and industrial value. Summary of the Invention

[0005] The purpose of this invention is to provide a combination of SNP molecular markers for identifying the sex of Torreya grandis and its application, which solves the current technical problem of lacking an effective method for identifying the sex of Torreya grandis.

[0006] The present invention achieves the above objectives through the following technical solutions: The first objective of this invention is to provide a combination of SNP molecular markers for identifying the sex of Torreya grandis, wherein the combination of SNP molecular markers includes three SNP molecular marker sites: SNP1, SNP2, and SNP3. The SNP1 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO.1, and the genotype is C or T; The SNP2 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO.2, and the genotype is C or A; The SNP3 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO.3, and the genotype is A or G; When SNP1, SNP2, and SNP3 form a TCA combination, the Torreya grandis is male; otherwise, it is female.

[0007] The second objective of this invention is to provide a primer pair for amplifying the aforementioned SNP molecular marker combination for identifying the sex of Torreya grandis. The primer pair for amplifying the molecular marker combination is as follows: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R:AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F:TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

[0008] A third objective of this invention is to provide an application of the above-mentioned molecular marker combination or primer pair in identifying the sex of Torreya grandis seedlings or asexually propagated seedlings.

[0009] A fourth objective of this invention is to provide a kit for identifying the sex of Torreya grandis, comprising the aforementioned primer pair.

[0010] The fifth objective of this invention is to provide a method for identifying the sex of Torreya grandis using the above-mentioned molecular marker combination, comprising the following steps: Step S1: Extract DNA from the Torreya grandis tissue to be tested; Step S2: Design specific primers based on SNP molecular marker combinations, use Torreya grandis tissue DNA as a template, and perform PCR amplification using the designed specific primers to obtain amplification products; Step S3: Sequencing the amplified products to detect the genotype of the SNP molecular marker sites for rapid identification of the sex of Torreya grandis. When the genotypes of SNP1, SNP2, and SNP3 are TCA combinations, the Chinese torreya is male; otherwise, it is female.

[0011] As a further optimization of the present invention, the specific primer is characterized in that: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R:AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F:TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

[0012] As a further optimization of the present invention, the PCR amplification reaction system is as follows: the total reaction volume is 25.0 µL, containing 1.0 µL template DNA, 1 µL each of forward and reverse primers, 12.5 µL DNA polymerase and 9.5 µL ddH2O.

[0013] As a further optimization of the present invention, the PCR amplification reaction conditions are as follows: denaturation at 95°C for 3 min, followed by 35 cycles, each cycle including 95°C for 15 s, 58°C for 15 s and 72°C for 30 s, and finally extension at 72°C for 5 min.

[0014] The beneficial effects of this invention are as follows: The sex-determining molecular markers developed in this invention can directly determine the sex of Torreya grandis seedlings or asexually propagated seedlings through three SNP loci, avoiding the problem of waiting more than 10 years for sexual maturity to identify sex, greatly shortening the breeding cycle and saving breeding costs. Using the developed sex markers, male and female plants can be accurately screened during breeding and afforestation, achieving a reasonable configuration ratio, improving pollination efficiency and seed yield, which is a key technical link in improving the economic benefits of Torreya grandis. The sex-determining regions and candidate functional genes identified in this invention provide a molecular basis and theoretical support for further research on the genetic mechanisms of sex differentiation and reproductive development regulatory networks in Torreya grandis, and also have reference value for studying the sex determination mechanisms of other gymnosperms. The results of this invention can be widely applied to various stages such as seedling screening, germplasm resource protection and optimization, cultivation structure optimization, and precision forestry management, with good industrial transformation potential and economic benefits. Attached Figure Description

[0015] Figure 1 This is a map showing the distribution of sex-related significant SNP alleles on chromosome 10 of Torreya grandis. Figure 2 Genotypes and electrophoresis results of SNP loci in Torreya grandis grouped by sex; Figure 3 A comparison of the amplified sequences of SNP1 sites from 10 male and 10 female Torreya grandis trees with the reference sequence; Figure 4 A comparison of the amplified sequences of SNP2 sites from 10 male and 10 female Torreya grandis trees with the reference sequence; Figure 5 This image shows a comparison between the amplified sequences of SNP3 sites from 10 male and 10 female Torreya grandis trees and the reference sequence. Detailed Implementation

[0016] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0017] Example 1. Obtaining SNP molecular marker sites To genotype SNPs in female and male individuals, low-quality resequencing reads were first removed using Fastp (v.0.23.2) with default parameters. Then, clean resequencing fragments from 30 female and 30 male samples were aligned to the female reference genome.

[0018] During genome alignment, the female genome was used as the reference genome, and the CPU-accelerated variant retrieval tool, Sentieon, was employed. BWA-MEM and Sort tools were used for alignment and sorting, respectively, while the SentieonHaplotyper algorithm was used for single-sample variant detection, generating single-sample gVCF files. Finally, the SentieonGenotyper algorithm was used to perform joint variant detection on the gVCF files of multiple samples to obtain the final variant retrieval results.

[0019] For variant screening, GATK was used for initial filtering, with the following criteria: OD < 2.0, MO < 40.0, FS > 60.0, QUAL < 30.0, SOR > 3.0, MQRankSum < -12.5, and ReadPosRankSum < -8.0. Subsequently, VCFtools was used for further population-based filtering of SNPs, retaining only SNPs with a minor allele frequency greater than 5%, missing data less than 80%, read depth greater than 6, and minimum quality greater than 30. These SNPs were considered high-quality SNPs.

[0020] To identify sex-related candidate gene regions, a GWAS strategy was employed. Genomic data from 10 female and 10 male *Torreya grandis* individuals were collected and analyzed at the Panmugang Base in Lin'an District, Hangzhou City, Zhejiang Province. GWAS analysis of sex traits (female and male) was based on high-quality SNPs, using a female reference genome. We applied a mixed linear model (MLM) and GEMMA software for association analysis and calculated the p-value for each SNP. Finally, a genome-wide significance threshold of log10 (p-value) > 8 was set, and three potential sex-related SNP loci were selected: located at positions 339372332 (SNP1-SEQ ID NO.1), 355669871 (SNP2-SEQ ID NO.2), and 360973569 (SNP3-SEQ ID NO.3) on chromosome 10, respectively. The results are shown below. Figure 1 As shown.

[0021] Specific primers were designed to target the sequence differences at this SNP site, and SNP molecular markers were developed. The nucleotide sequences of the specific primers are shown below: SNP1_F:GTTCACTCAAAACTTAGGCAAAGATG; SEQ ID NO.4; SNP1_R:AATCTAGTGGACAATTAGATAATACCATTCT; SEQ ID NO.5; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SEQ ID NO.6; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SEQ ID NO.7; SNP3_F:TTTTCAACCTGATGGAGAAAATATGA; SEQ ID NO.8; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC; SEQ ID NO.9.

[0022] Example 2. Identifying the sex of Torreya grandis 1. Sample collection and DNA extraction (1) Sampling and preservation: Ten female and ten male tender leaves of Torreya grandis were collected from Panmugang Base in Lin'an District, Hangzhou City, Zhejiang Province. After being frozen in liquid nitrogen, they were stored in a -80℃ freezer. (2) Extraction and preservation of leaf genomic DNA: Take 100-200 mg of frozen leaf tissue, put it into a 2 ml EP tube containing 2 steel balls, freeze it again in liquid nitrogen, and grind it into a fine powder using a grinder. Use the FastPure® Plant DNA Isolation Mini Kit manufactured by Novizan, and follow the manufacturer's instructions for extraction. Store the DNA at -20℃.

[0023] 2. Amplification Based on the following specific primers: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R:AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F:TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

[0024] The extracted total DNA from Torreya grandis was used as a template for PCR amplification using the primer pairs designed above.

[0025] PCR amplification system:

[0026] PCR amplification procedure:

[0027] The PCR products were subjected to agarose gel electrophoresis to verify the successful amplification of the expected target band. To ensure clear band separation, a 1% agarose gel was used, and the electrophoresis conditions were set to 120V for 20 minutes. The gel was stained with electrophoresis buffer containing ethidium bromide to facilitate band observation under UV light. After electrophoresis, the target band size was confirmed to be 400 bp. Figure 2 As shown.

[0028] After identifying the target band, carefully cut the target band from the gel using a sterile blade, ensuring that only the portion containing the target fragment is retrieved. Next, perform gel recovery using the EasyGel Recovery Kit according to the manufacturer's instructions, including dissolving, purifying, and concentrating the DNA from the gel fragment, to ensure that the recovered PCR product has sufficient purity and concentration for subsequent sequencing analysis.

[0029] The recovered DNA products, after concentration determination, were sent to a sequencing company for first-generation sequencing analysis. During sequencing, standard Sanger sequencing methods were used to ensure accurate and reliable sequence data. These DNA amplified band patterns and subsequent sequencing alignment results were then analyzed. Figure 2 This can further distinguish the male and female sexes of Torreya grandis.

[0030] The obtained sequencing results were imported into SnapGene software for sequence analysis. Through alignment analysis, the 200th base position was accurately located, and the base information corresponding to that position was viewed. The software clearly displays whether the base at that position in the sequencing result matches the base in the reference sequence, as shown in the results. Figure 3-5 As shown, the 200th base of the SNP1 site in all male Torreya grandis plants is T, the 200th base of the SNP2 site is C, and the 200th base of the SNP3 site is A. Therefore, the feasibility of the molecular marker of the present invention is verified.

[0031] The combination of three SNP loci is closely linked to or co-segregates with the male and female traits of Torreya grandis, and can be used as molecular markers for the molecular detection of male and female traits of Torreya grandis. It can also be used for the genetic background analysis of Torreya grandis, as well as for molecular marker-assisted selection breeding of male and female traits of Torreya grandis, and has broad application prospects.

[0032] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A combination of SNP molecular markers for identifying the sex of Torreya grandis, characterized in that, The SNP molecular marker combination consists of three SNP molecular markers: SNP1, SNP2, and SNP3. The nucleotide sequence of SNP1 is shown in SEQ ID NO.

1. The 200th base of this nucleotide sequence is the SNP site, and the genotype is C or T. The nucleotide sequence of SNP2 is shown in SEQ ID NO.

2. The 200th base of this nucleotide sequence is the SNP site, and the genotype is C or A. The nucleotide sequence of SNP3 is shown in SEQ ID NO.

3. The 200th base of this nucleotide sequence is the SNP site, and the genotype is A or G. When the genotype of the SNP loci in SNP1, SNP2, and SNP3 is the TCA combination, the Chinese torreya is male; otherwise, it is female.

2. Primer pairs for amplifying the SNP molecular marker combination for identifying the sex of Torreya grandis as described in claim 1, characterized in that, The primer pair used to amplify the molecular marker combination is: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R:AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F:TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

3. The application of the molecular marker combination as described in claim 1 or the primer pair as described in claim 2 in identifying the sex of Torreya grandis seedlings.

4. A reagent kit for identifying the sex of Torreya grandis, characterized in that, Includes the primer pair as described in claim 2.

5. A method for identifying the sex of Torreya grandis using the molecular marker combination described in claim 1, characterized in that, Includes the following steps: Step S1: Extract DNA from the Torreya grandis tissue to be tested; Step S2: Design specific primers based on SNP molecular marker combinations, use Torreya grandis tissue DNA as a template, and perform PCR amplification using the designed specific primers to obtain amplification products; Step S3: Sequencing the amplification products to detect the genotypes of SNP loci in SNP1, SNP2 and SNP3 for rapid identification of the sex of Torreya grandis. When the genotype of the SNP loci in SNP1, SNP2, and SNP3 is the TCA combination, the Chinese torreya is male; otherwise, it is female.

6. The method according to claim 5, characterized in that, The specific primers are: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R:AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F:TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

7. The method according to claim 5, characterized in that, The PCR amplification reaction system is as follows: the total reaction volume is 25.0 µL, containing 1.0 µL template DNA, 1 µL each of forward and reverse primers, 12.5 µL DNA polymerase and 9.5 µL ddH2O.

8. The method according to claim 5, characterized in that, The PCR amplification reaction conditions are as follows: denaturation at 95℃ for 3 min, followed by 35 cycles, each cycle consisting of 95℃ for 15 s, 58℃ for 15 s and 72℃ for 30 s, and finally extension at 72℃ for 5 min.

Images