Internal standard gene, probe primer and kit for quantitatively detecting HCMV nucleic acid

Abstract

The present application relates to the technical field of nucleic acid detection, in particular to a kind of internal standard gene, probe primer and kit for quantitative detection of HCMV nucleic acid, the internal standard gene includes core sequence and flanking sequence located at the both ends of core sequence, and the nucleotide sequence of its core sequence is as shown in SEQ ID NO.1.The internal standard gene sequence, detection primer and detection probe of the internal standard gene and the detection primer and detection probe of specific recognition HCMV nucleic acid obtained by the present application can realize the rapid, accurate quantitative detection of HCMV nucleic acid, improve the accuracy and reliability of detection result.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid detection technology, and in particular to an internal standard gene, probe primers, and kit for quantitative detection of HCMV nucleic acid. Background Technology

[0002] In recent years, the application of nucleic acid quantification methods in HCMV detection has gradually attracted attention. Conventional nucleic acid quantification methods typically employ qPCR technology, such as patent CN119614756A, which requires plotting a standard curve in each experiment to ensure the accuracy and stability of the quantification results. This method is not only cumbersome to operate, but also consumes a large amount of calibration materials for each experiment, resulting in high detection costs.

[0003] Furthermore, traditional quantitative reagents often use three forms of quantitative references: pseudoviruses, artificially constructed plasmids, or artificially synthesized DNA fragments. For example, patent CN116732236A uses pseudoviruses to prepare quantitative references. Pseudoviruses are enveloped viruses, which have relatively poor stability, are the most complex to prepare, have the highest cost, and require more stringent storage and transportation conditions. For instance, patent CN119614756A uses recombinant human cytomegalovirus plasmids as quantitative references. Since artificially constructed plasmids typically exhibit three structures after preparation—supercoiled, open-circular, and linear—the proportions of these structures change with prolonged storage, ultimately leading to discrepancies in the detection results. Artificially synthesized fragments alone are unstable in samples and easily degraded. These internal standards suffer from poor stability, complex preparation, high cost, and stringent storage and transportation requirements. Current cytomegalovirus nucleic acid detection methods lack a quantitative reagent that can overcome the shortcomings of existing technologies, making it difficult to achieve accurate, rapid, and absolute quantitative detection of human cytomegalovirus. Summary of the Invention

[0004] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide an internal standard gene, probe primers and kit for quantitative detection of HCMV nucleic acid, so as to solve the problems in the prior art.

[0005] To achieve the above and other related objectives, the present invention first provides an internal control gene for the quantitative detection of HCMV nucleic acid. The internal control gene includes a core sequence and flanking sequences located at both ends of the core sequence. The oligonucleotide backbone of the flanking sequences is modified with phosphate thioester. The nucleotide sequence of the core sequence is shown in SEQ ID NO.1.

[0006] The present invention also provides a detection primer and a detection probe for detecting the above-mentioned internal standard gene, wherein the detection primer includes an internal standard upstream primer as shown in SEQ ID NO.3 and an internal standard downstream primer as shown in SEQ ID NO.4; and the detection probe further includes an internal standard probe as shown in SEQ ID NO.5.

[0007] The present invention also provides a detection substance for HCMV, the detection substance comprising the above-mentioned internal standard gene, detection primers and detection probes for detecting the above-mentioned internal standard gene, and detection primers and detection probes for specifically recognizing HCMV nucleic acid, wherein the detection primers for specifically recognizing HCMV nucleic acid include an HCMV upstream primer as shown in SEQ ID NO.6 and an HCMV downstream primer as shown in SEQ ID NO.7; the detection probes for specifically recognizing HCMV nucleic acid further include an HCMV probe as shown in SEQ ID NO.8.

[0008] The present invention also provides the use of the above-mentioned detection substance in the preparation of HCMV detection products.

[0009] The present invention also provides an HCMV detection kit, the kit comprising the detection substances described above.

[0010] The present invention also provides a method for quantitative detection of HCMV nucleic acid for non-diagnostic purposes, comprising the following steps: extracting DNA from the sample to be tested and the internal standard gene, and performing nucleic acid detection using the above-mentioned kit.

[0011] As described above, the internal standard gene, probe primers, and kit for quantitative detection of HCMV nucleic acid of the present invention have the following beneficial effects: 1) This invention uses an internal standard absolute quantification method to replace the traditional standard curve absolute quantification method, overcoming the problems of poor stability, complex preparation, and high cost of traditional internal standard quantitative reagents. By using artificially synthesized DNA fragments modified with phosphate thioesters as internal standards, the problems of poor stability and easy degradation of pseudoviruses are effectively solved, improving the accuracy and reliability of detection results; 2) The internal standard of this invention uses a DNA fragment modified with phosphate thioester, which can effectively resist the degradation of nucleases, improve the stability of the internal standard in the sample, avoid the problem of easy degradation of artificially synthesized fragments alone, and ensure the reliability of the detection results. 3) The internal standard quantitative reagent of the present invention is easy to prepare and store, has good stability and durability, significantly reduces production and transportation costs, and improves product availability and market competitiveness. Attached Figure Description

[0012] Figure 1 The image shows the amplification of the HCMV plasmid.

[0013] Figure 2 The image shows an amplification diagram of the internal standard gene.

[0014] Figure 3 The graph shows the acceleration and stability trend of the HCMV pseudovirus.

[0015] Figure 4 The graph shows the accelerated stability trend of the HCMV plasmid.

[0016] Figure 5 The graph shows the accelerated stability trend of the internal standard gene.

[0017] Figure 6 The image shows an amplification plot of the extracted HCMV international standard and internal standard primary reference (IS).

[0018] Figure 7 The graph shows the standard curve of the HCMV plasmid.

[0019] Figure 8 This graph shows the difference between standard curve quantification and internal standard method quantification for different sample matrices.

[0020] Figure 9 Displayed as a Bland-Altman analysis chart.

[0021] Figure 10 Displayed as a regression analysis graph. Detailed Implementation

[0022] The present invention first provides an internal control gene for quantitative detection of HCMV nucleic acid. The internal control gene includes a core sequence and flanking sequences located at both ends of the core sequence. The oligonucleotide backbone of the flanking sequences is modified with phosphate thioester. The nucleotide sequence of the core sequence is shown in SEQ ID NO.1.

[0023] SEQ ID NO. 1: 5'-CCTCATTCCCATGCCATCTCTGCACCTCTCAACTGCCGCTGTTCAGTTGACAGTCCTGGTGCGCTGGTTTGACTACATTCAACCAACGC-3'.

[0024] In some embodiments of the present invention, the length of the flanking sequence is n nucleotides, where n ≥ 3. Further, the length of the flanking sequence is 3 ≤ n ≤ 8. For example, it can be 3, 4, 5, 6, 7, or 8 nucleotides.

[0025] In a specific embodiment of the present invention, the length of the flanking sequence is 6 nucleotides.

[0026] In some embodiments of the present invention, the nucleotide sequence of the flanking sequence is any arrangement of A, T, C, and G.

[0027] In a specific embodiment of the present invention, the nucleotide sequence of the flanking sequence is shown in SEQ ID NO:2.

[0028] SEQ ID NO:2:ATCTGA.

[0029] In a specific embodiment of the present invention, the nucleotide sequence of the internal standard gene is shown in SEQ ID NO:9.

[0030] SEQ ID NO:9: 5′-A*T*C*T*G*ACCTCATTCCCATGCCATCTCTGCACCTCTCAACTGCCGCTGTTCAGTTGACAGTCCTGGTGCGCTGGTTTGACTACATTCAACCAACGCA*T*C*T*G*A-3′.

[0031] The nucleotide sequence of its complementary strand is shown in SEQ ID NO:10.

[0032] SEQ ID NO:10: 5′-T*C*A*G*A*TGCGTTGGTTGAATGTAGTCAAACCAGCGCACCAGGACTGTCAACTGAACAGCGGCAGTTGAGAGGTGCAGAGATGGCATGGGAATGAGGT*C*A*G*A*T-3′ The bolded part represents the flanking sequence, and * indicates that the two bases are modified by thiophosphate.

[0033] In some embodiments of the present invention, the flanking sequences at both ends are independent of each other in length and nucleotide sequence.

[0034] The present invention also provides a detection primer and a detection probe for detecting the above-mentioned internal standard gene, wherein the detection primer includes an internal standard upstream primer as shown in SEQ ID NO.3 and an internal standard downstream primer as shown in SEQ ID NO.4; and the detection probe further includes an internal standard probe as shown in SEQ ID NO.5.

[0035] In some embodiments of the present invention, one end of the internal standard probe is labeled with a fluorescent reporter group, and the other end is labeled with a fluorescent quencher group. The fluorescent reporter group is selected from one or more of FAM, HEX, TET, ROX, and JOE; the fluorescent quencher group is selected from one or more of ECLIPSE, DABCYL, BHQ-1, BHQ-2, and BHQ-3.

[0036] In a specific embodiment of the present invention, the fluorescent reporter group of the internal standard probe is HEX, and the fluorescent quencher group is BHQ-1.

[0037] The present invention also provides a detection substance for HCMV, the detection substance comprising the above-mentioned internal standard gene, detection primers and detection probes for detecting the above-mentioned internal standard gene, and detection primers and detection probes for specifically recognizing HCMV nucleic acid, wherein the detection primers for specifically recognizing HCMV nucleic acid include an HCMV upstream primer as shown in SEQ ID NO.6 and an HCMV downstream primer as shown in SEQ ID NO.7; the detection probes for specifically recognizing HCMV nucleic acid further include an HCMV probe as shown in SEQ ID NO.8.

[0038] In some embodiments of the present invention, one end of the HCMV probe is labeled with a fluorescent reporter group, and the other end is labeled with a fluorescent quencher group. The fluorescent reporter group is selected from one or more of FAM, HEX, TET, ROX, and JOE; the fluorescent quencher group is selected from one or more of ECLIPSE, DABCYL, BHQ-1, BHQ-2, and BHQ-3.

[0039] In a specific embodiment of the present invention, the fluorescent reporter group of the HCMV probe is FAM, and the fluorescent quencher group is BHQ-1.

[0040] Specifically, the fluorescent reporter groups labeled at the 5' ends of the internal standard probe and the HCMV probe are different, and their fluorescence wavelengths are also different. Preferably, the fluorescence wavelengths of the two fluorescent reporter groups differ significantly, while their signal intensities are similar, ensuring the accuracy of the detection results and avoiding mutual interference between signals.

[0041] This kit uses polymerase chain reaction (PCR) combined with TaqMan technology. Specific primers are designed based on the nucleic acid sequence of HCMV to amplify the corresponding nucleic acid fragments. At the same time, highly specific TaqMan probes can bind to the corresponding nucleic acid fragments and undergo hydrolysis under the action of Taq exonuclease activity to generate a fluorescent signal. The real-time amplification curve can be obtained based on the relationship between the fluorescence signal and the amplification cycle number.

[0042] The present invention also provides the use of the above-mentioned detection substances in the preparation of HCMV detection products.

[0043] In some embodiments of the present invention, the test samples for which the detection product is applicable are selected from blood samples and body fluid samples. Specifically, the blood samples are selected from whole blood, plasma, or serum; the body fluid samples are selected from urine or breast milk.

[0044] In some embodiments of the present invention, the detection product is used for the determination of HCMV, the selection of treatment plans, and / or prognostic assessment.

[0045] The present invention also provides an HCMV detection kit, the kit comprising the detection substances described above.

[0046] In some embodiments of the present invention, the working concentration of the HCMV upstream primer and / or HCMV downstream primer is 0.2–0.6 μM, based on the volume of the PCR reaction system. The working concentration of the HCMV upstream primer and / or HCMV downstream primer is selected from any of the following ranges: 0.2–0.25 μM, 0.25–0.3 μM, 0.3–0.35 μM, 0.35–0.4 μM, 0.4–0.45 μM, 0.45–0.5 μM, 0.5–0.55 μM, or 0.55–0.6 μM. In a specific embodiment of the present invention, the working concentration of the HCMV upstream primer and / or HCMV downstream primer is 0.4 μM.

[0047] In some embodiments of the present invention, the working concentration of the HCMV probe is 0.03–0.07 μM, based on the volume of the PCR reaction system. The working concentration of the HCMV probe is selected from any of the following ranges: 0.03–0.04 μM, 0.04–0.05 μM, 0.05–0.06 μM, or 0.06–0.07 μM. In a specific embodiment of the present invention, the working concentration of the HCMV probe is 0.05 μM.

[0048] In some embodiments of the present invention, the working concentration of the internal standard upstream primer and / or downstream primer is 0.1–0.5 μM, based on the volume of the PCR reaction system. The working concentration of the internal standard upstream primer and / or downstream primer is selected from any of the following ranges: 0.1–0.15 μM, 0.15–0.2 μM, 0.2–0.25 μM, 0.25–0.3 μM, 0.3–0.35 μM, 0.35–0.4 μM, 0.4–0.45 μM, or 0.45–0.5 μM. In a specific embodiment of the present invention, the working concentration of the internal standard upstream primer and / or downstream primer is 0.25 μM.

[0049] In some embodiments of the present invention, the working concentration of the internal standard probe is 0.03–0.07 μM, based on the volume of the PCR reaction system. The working concentration of the internal standard probe is selected from any of the following ranges: 0.03–0.04 μM, 0.04–0.05 μM, 0.05–0.06 μM, or 0.06–0.07 μM. In a specific embodiment of the present invention, the working concentration of the internal standard probe is 0.05 μM.

[0050] In this invention, the working concentration refers to the final concentration in the PCR reaction system.

[0051] In some embodiments of the present invention, the detection kit further includes nucleic acid extraction reagents.

[0052] The nucleic acid extraction reagent is selected from nucleic acid extraction reagents based on silica membrane adsorption or magnetic bead methods. In a specific embodiment of the present invention, the nucleic acid extraction reagent is a nucleic acid extraction reagent based on silica membrane adsorption. For example, the commercially available QIAamp DNA Mini Kit can be used. This nucleic acid extraction reagent includes lysis buffer, washing buffer, and elution buffer, etc.

[0053] In some embodiments of the present invention, the detection kit further includes a detection solution mixture A, which includes PCR buffer, Mg... 2+ Essential components for PCR amplification, such as dNTPs and Taq enzymes.

[0054] Based on the volume of the PCR reaction system, the Mg 2+ The working concentration is 3 mM to 6 mM; for example, the Mg 2+ The working concentration is selected from any of the following ranges: 3 mM~4 mM, 4 mM~5 mM, 5 mM~6 mM. In a specific embodiment of the present invention, the Mg... 2+ The working concentration is 4.5 mM.

[0055] Based on the volume of the PCR reaction system, the working concentration of the dNTP is 0.05 mM to 0.25 mM; for example, the working concentration of the dNTP is selected from any of the following ranges: 0.05 mM to 0.1 mM, 0.1 mM to 0.15 mM, 0.15 mM to 0.2 mM, or 0.2 mM to 0.25 mM. In a specific embodiment of the present invention, the working concentration of the dNTP is 0.15 mM.

[0056] Based on the volume of the PCR reaction system, the working concentration of the Taq enzyme is 0.02~0.05 U / μL; the working concentration of the Taq enzyme is selected from any of the following ranges: 0.02~0.03 U / μL, 0.03~0.04 U / μL, 0.04~0.05 U / μL. In a specific embodiment of the present invention, the working concentration of the Taq enzyme is 0.0375 U / μL.

[0057] The present invention also provides a method for quantitative detection of HCMV nucleic acid for non-diagnostic purposes, comprising the following steps: extracting DNA from the sample to be tested and the internal standard gene, and performing nucleic acid detection using the above-mentioned kit.

[0058] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0059] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0060] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention. Example 1

[0061] This embodiment provides primer and probe sequences for detecting HCMV and internal standards, and describes the detection method.

[0062] HCMV target genes were searched and downloaded using NCBI, and sequences were compared to select conserved regions as candidate target areas. HCMV-specific amplification primers and probes were designed using Beacon Designer software. The primers and probes were synthesized by Invitrogen (Shanghai) Trading Co., Ltd., and their specific sequences are as follows: HCMV upstream primer: 5′-CACTGTCATCAGAATATATGATGTA-3′ (SEQ ID NO:6); HCMV downstream primer: 5′-GCGGTTGCTACTACTTTC-3′ (SEQ ID NO:7); HCMV probe: 5′-FAM-TCCTCACCATAGCCACC-BHQ-1-3′ (SEQ ID NO: 8).

[0063] The primer-probe sequence for the internal standard is as follows: Internal standard upstream primer: 5′-CCTCATTCCCATGCCATC-3′ (SEQ ID NO:3); Internal standard downstream primer: 5′-GCGTTGGTTGAATGTAGTC-3′ (SEQ ID NO:4); Internal standard probe: 5′-HEX-CGCACCAGGACTGTCAA-BHQ-1-3′ (SEQ ID NO:5).

[0064] After the primer and probe powders arrive, dissolve them in sterile nuclease-free water according to the amount (or number of moles) of nucleic acid provided by the manufacturer to prepare a 20 μM solution for later use.

[0065] The HCMV plasmid, synthesized by General Biotechnology (Anhui) Co., Ltd., has the following sequence: CACTGTCATCAGAATATATGATGTATATTATTTCCTCCAAACTCCTCACCATAGCCACCAATTCGCATCACTTAAGAAAGTAGTAGCAACCGC (SEQ ID NO: 11).

[0066] After the HCMV plasmid powder arrived, it was dissolved in 40 μL of TE buffer to obtain the plasmid stock solution. Then, an appropriate amount of the stock solution was taken and subjected to 10 t / t of TE buffer. 4 The solution was diluted 10-fold to determine the initial concentration of the standard. Using this initial concentration as the first standard, and with TE buffer as the diluent, six consecutive 10-fold serial dilutions were performed to obtain seven standard solutions at different concentrations. These solutions were then used in subsequent real-time quantitative PCR reactions to plot a standard curve for later detection.

[0067] The HCMV pseudovirus was synthesized by Sanyou Biopharmaceutical (Shanghai) Co., Ltd., and its target sequence is the same as that of the HCMV plasmid.

[0068] The fragment with the internal standard being a phosphate thioester modified was synthesized by Shanghai Sangon Biotech Co., Ltd. The asterisk (*) in the sequence indicates a phosphate thioester modification between two bases. The two complementary sequences are as follows: Positive strand: 5′-A*T*C*T*G*ACCTCATTCCCATGCCATCTCTGCACCTCTCAACTGCCGCTGTTCAGTTGACAGTCCTGGTGCGCTGGTTTGACTACATTCAACCAACGCA*T*C*T*G*A-3′ (SEQ ID NO:9); Negative strand: 5′-T*C*A*G*A*TGCGTTGGTTGAATGTAGTCAAACCAGCGCACCAGGACTGTCAACTGAACAGCGGCAGTTGAGGTGCAGAGATGGCATGGGAATGAGGT*C*A*G*A*T-3′ (SEQ ID NO: 10).

[0069] After the internal standard powder arrives, dissolve it in sterile nuclease-free water to prepare a 20 μM stock solution, then use TE buffer for 10... 9 The solution was diluted 10 times to obtain an initial working solution, and then diluted 4 more times to prepare a series of standards for subsequent detection.

[0070] The composition of the mixture is shown in Table 1:

[0071] Detection: Aliquot 20 μL of the detection mixture into PCR tubes, and add 20 μL of the test sample, including HCMV plasmid gradient solution and internal standard gradient solution, to each well. Centrifuge and mix to obtain a total PCR reaction volume of 40 μL. Place the reaction tubes on a real-time quantitative PCR instrument and perform PCR amplification according to the following procedure (Table 2). Acquire fluorescence signals at 60℃. The total reaction volume is 40 μL.

[0072]

[0073] The peak shapes for the detection of HCMV and internal standard are shown in the figure. Figure 1 and Figure 2 The corresponding detection Ct values ​​are shown in Tables 3 and 4. It can be seen that the amplification efficiencies of the two are 95.53% and 95.72%, respectively, with a difference of only 0.19%. These results indicate that the amplification efficiencies of HCMV and the internal standard in this detection system are close to the ideal value (100%), and their amplification kinetics are highly consistent, meeting the requirements for quantification using the internal standard.

[0074]

[0075] Example 2

[0076] This embodiment evaluated the stability of HCMV pseudovirus, HCMV plasmid, and phosphate thioester modified internal control gene fragment at different temperatures.

[0077] Experimental Methods: HCMV pseudovirus, HCMV plasmid, and phosphate-thioester modified internal control gene were aliquoted into centrifuge tubes and stored in constant temperature incubators at -20℃, 4℃, 25℃, 37℃, and 45℃, respectively. One tube was taken out at each time point, and three replicates were extracted using the QIAamp DNA Mini Kit (Cat. No. 51306, QIAGEN, specific operating steps were performed according to the instructions). Detection mixture was prepared (same as in Example 1), and PCR detection was performed according to the steps in Example 1. The mean of the three replicates was calculated, and a trend graph was plotted based on the mean Ct values ​​detected at each temperature. The mean Ct value of the first detection (day 0) was used as the baseline, and ±0.5Ct was considered the normal fluctuation range.

[0078] As shown in Table 5, the stability results of HCMV pseudovirus indicate that, when stored at five different temperatures, the measured Ct values ​​gradually increased with increasing storage temperature and time. This is because the pseudovirus is unstable at higher temperatures and is prone to degradation, leading to a decrease in its concentration. The stability trend is shown in the graph below. Figure 3 .

[0079]

[0080] As shown in Table 6, unlike HCMV pseudoviruses, the stability results of HCMV plasmids indicate that when the plasmids were stored at five different temperatures, the higher the storage temperature and the longer the storage time, the gradually decreasing Ct value; conversely, the lower the storage temperature, the gradually increasing Ct value. The stability trend is shown in the figure below. Figure 4 As shown, this is because commercially available plasmid DNA is typically a mixture of three conformations (supercoiled, linear, and open circular), and different conformations have different amplification efficiencies in PCR. Changes in storage temperature can lead to interconversion between these conformations, potentially causing variations in amplification efficiency and ultimately resulting in differences in the detected Ct values.

[0081]

[0082] As shown in Table 7 and Figure 5As shown, the stability results of the thiophosphate-modified internal standard gene fragment indicate that after 90 days at 5 temperatures, the detected Ct values ​​are still within the quality control range, which shows that it is not sensitive to temperature stress and its chemical stability is better than that of HCMV pseudovirus and plasmid, making it more suitable as a quantitative reference material for long-term use.

[0083] Example 3

[0084] This embodiment provides the preparation of internal standard reference materials for quantitative analysis and their value determination traceability.

[0085] 3.1 Determination of the concentration of the internal standard primary reference (IS) working solution 1) Mix the two chains modified with thiophosphate, i.e., the positive chain and the negative chain, at equal concentrations and anneal them to form a double-chain internal standard; 2) Take 5 μL of the double-stranded internal standard solution and add it to 200 μL of negative plasma. Use the QIAamp DNA MiniKit to extract nucleic acid. 3) Using the extracted nucleic acid as a template, real-time fluorescence PCR detection was performed according to the method in Example 1; 4) Based on the obtained Ct value, select an appropriate dilution factor to dilute the initial internal standard solution to ensure that the final working concentration Ct value is within the range of 26±0.5.

[0086] 3.2 Quantitative Traceability Operation 3.2.1 Preparation of co-extracted samples 1) The concentration was traced back to the 1st WHO International Standard for Human Cytomegalovirus (HCMV) (NIBSC code 09 / 162). After dissolving the HCMV international standard in water, a concentration of 5 × 10⁻⁶ was obtained. 6 A solution of IU / mL; 2) Take 100 μL of this solution, dilute it 10 times with negative plasma, mix well and set aside; 3) Take another 200 μL of diluted standard, add 5 μL of internal standard primary reference (IS), mix thoroughly, and prepare a co-extracted sample.

[0087] 3.2.2 Nucleic acid extraction and detection 1) Nucleic acid extraction was performed on the co-extracted samples using the QIAamp DNA Mini Kit, with 3 replicates for each sample; 2) Separately extract HCMV plasmid nucleic acid solutions at four 10-fold serial dilutions with known copy number concentrations as standard curves; 3) Take 20 μL of nucleic acid from the co-extracted sample and plasmid standard, add them to 20 μL of detection mixture, and perform real-time fluorescence PCR detection.

[0088]

[0089]

[0090] 3.3 Quantitative Traceability Methods 1) Using the concentration Log of HCMV plasmid standard 10 The values ​​are on the x-axis, assuming the concentration of the four standards is 1 × 10⁻⁶. 8 IU / mL, 1×10 7 IU / mL, 1×10 6 IU / mL, 1×10 5 IU / mL, corresponding concentration Log 10 The values ​​are 8, 7, 6, and 5. The measured Ct value is the ordinate. A linear regression equation (standard curve) is established, yielding y = -3.329x + 45.721. 2) Calculate the intercept of the standard curve: Keeping the slope constant, substitute the Log value (5.69897) of the known concentration of the international standard and the measured average Ct value into the regression equation to calculate the intercept of the linear regression equation as 44.832. 3) Correcting the standard curve: Correcting the intercept in the original regression equation to obtain the source-corrected standard curve y = -3.329x + 44.832; 4) Substitute the measured average Ct value of the internal standard primary reference (IS) into the calibrated standard curve to infer its concentration, and the final value is determined to be 4.51 × 10⁻⁶. 5 IU / mL.

[0091] The specific Ct values ​​for HCMV international standard and internal standard primary reference (IS) are shown in Table 8, and the peak shapes are shown in [the table below]. Figure 6 The HCMV standard curve is shown below. Figure 7 The specific Ct values ​​are shown in Table 9. The final calculated concentration of the internal standard primary reference (IS) is 4.51 × 10⁻⁶. 5 IU / mL. Example 4

[0092] This embodiment provides a comparison between the internal standard method and the standard curve method to verify the accuracy of the internal standard method in the quantitative detection of HCMV in complex biological matrices.

[0093] A known concentration of HCMV sample (1.06E+07 IU / mL) was serially diluted 10-fold with negative human plasma and negative human serum to prepare five concentration gradients (HCMV-1 to HCMV-5). 200 μL of each concentration was added to 5 μL of a known concentration of traceable internal standard working solution. Samples were extracted using the QIAamp DNA Mini Kit, with three replicates for each concentration. All samples were analyzed using both the standard curve method and the internal standard quantification method, and the differences between the two methods were compared.

[0094] The calculation formula for the internal standard quantification method is as follows:

[0095] Among them, Y 样 This refers to the concentration value of HCMV, Y 内 The concentration value of the internal standard, Ct 样 The Ct value refers to the detection value of HCMV. 内 The detection Ct value of the internal standard.

[0096]

[0097]

[0098] The Ct values ​​for standard curve quantification and internal standard quantification are shown in Table 10, and the corresponding peak shapes are shown in [Table 10]. Figure 8 The differences between the two quantitative methods in human plasma and human serum matrices are shown in Table 10. It can be seen that the average difference using the human plasma matrix is ​​-0.04 log₂. 10 The mean difference in human serum was -0.12 log. 10 The absolute values ​​of the differences between the two were significantly less than the acceptable ±0.5 log in clinical virological quantification. 10 Within the range. Therefore, it can be considered that the HCMV internal standard quantification method established in this application has equivalent quantitative accuracy to the recognized standard curve quantification method, and can achieve accurate quantification of HCMV virus in different biological matrices. Example 5

[0099] This embodiment provides the quantitative effect of the constructed internal standard quantification method in clinical samples.

[0100] Twenty-five HCMV-positive samples were collected from the hospital. 200 μL of each sample was taken and 5 μL of internal standard working solution of known concentration was added. Nucleic acid extraction was performed using the QIAamp DNA Mini Kit. At the same time, four HCMV calibrators were extracted to establish a standard curve. After extraction, real-time fluorescence quantitative PCR analysis was performed using the detection system of Example 1.

[0101] The standard curve method and the internal standard quantification method were used to assign values ​​to all samples, and the differences between the two methods were compared. The formula for internal standard quantification is:

[0102] Among them, Y 样 This refers to the concentration value of HCMV, Y 内 The concentration value of the internal standard, Ct 样 The Ct value refers to the detection value of HCMV. 内 The detection Ct value of the internal standard.

[0103] Standard curve method: The concentration is calculated based on the regression equation (y = -3.312x + 45.418) established by the standard.

[0104] The test results are shown in Table 12. The differences between the calculated internal standard quantification results and the standard curve quantification results are all within ±0.5 log. 10 Within the range.

[0105] To comprehensively assess the consistency between the two methods, Bland-Altman analysis and regression analysis were performed. Figure 9-10 The Bland-Altman analysis showed that the mean difference between the two methods was -0.01, with a 95% confidence interval (CI) including 0, indicating no significant systematic bias. Furthermore, both the upper and lower limits of the LoA (LoA) were less than ±0.5 log₂. 10 Regression analysis showed that the 95% confidence interval for the intercept was (-0.3287, 0.0448), which includes 0, indicating no constant bias; the 95% confidence interval for the slope was (0.9908, 1.0588), which includes 1, indicating no proportional bias. Therefore, combining the Bland-Altman and regression analysis results, the internal standard quantification method and the standard curve quantification method showed high consistency in quantitative detection of HCMV clinical samples, with no significant statistical bias. Therefore, these two methods can be used interchangeably in clinical testing practice. Furthermore, the internal standard quantification method does not rely on the standard curve for each experiment, making it more convenient to operate, especially suitable for rapid and accurate quantification of single or small samples.

[0106]

[0107] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. An internal standard gene for the quantitative detection of HCMV nucleic acid, characterized in that, The internal control gene includes a core sequence and flanking sequences at both ends of the core sequence. The oligonucleotide backbone of the flanking sequences is modified with phosphate thioester. The nucleotide sequence of the core sequence is shown in SEQ ID NO.

1. The internal control gene is used for the internal standard absolute quantification of HCMV nucleic acid. The sequence of the internal control gene is shown in SEQ ID NO.

9.

2. A detection primer and detection probe for detecting the internal standard gene of claim 1, characterized in that, The detection primers include an internal standard upstream primer as shown in SEQ ID NO.3 and an internal standard downstream primer as shown in SEQ ID NO.4; the detection probes include an internal standard probe as shown in SEQ ID NO.

5.

3. The detection primers and detection probes according to claim 2, characterized in that, One end of the internal standard probe is labeled with a fluorescent reporter group, and the other end is labeled with a fluorescent quencher group; the fluorescent reporter group is selected from FAM, HEX, TET, ROX, JOE; the fluorescent quencher group is selected from ECLIPSE, DABCYL, BHQ-1, BHQ-2, BHQ-3.

4. A detection substance for detecting HCMV, characterized in that, The detection substance includes the internal standard gene as described in claim 1, the detection primers and detection probes as described in claim 2 or 3, and the detection primers and detection probes that specifically recognize HCMV nucleic acid. The detection primers that specifically recognize HCMV nucleic acid include the HCMV upstream primer as shown in SEQ ID NO. 6 and the HCMV downstream primer as shown in SEQ ID NO.

7. The detection probes that specifically recognize HCMV nucleic acid include the HCMV probe as shown in SEQ ID NO.

8.

5. The detection substance according to claim 4, characterized in that, One end of the HCMV probe is labeled with a fluorescent reporter group, and the other end is labeled with a fluorescent quencher group; the fluorescent reporter group of the HCMV probe is FAM, and the fluorescent quencher group is BHQ-1.

6. Use of the detection substance for detecting HCMV as described in claim 4 or 5 in the preparation of HCMV detection products.

7. A detection kit for HCMV, characterized in that, The kit includes the detection substance for detecting HCMV as described in claim 4 or 5.

8. The reagent kit according to claim 7, characterized in that, Includes one or more of the following characteristics: A) Based on the volume of the PCR reaction system, the working concentration of the HCMV upstream primer and / or HCMV downstream primer is 0.2~0.6 μM; B) Based on the volume of the PCR reaction system, the working concentration of the HCMV probe is 0.03~0.07 μM; C) Based on the volume of the PCR reaction system, the working concentration of the internal standard upstream primer and / or the internal standard downstream primer is 0.1~0.5 μM; D) Based on the volume of the PCR reaction system, the working concentration of the internal standard probe is 0.03~0.07 μM; E) also includes nucleic acid extraction reagents; said nucleic acid extraction reagents are selected from nucleic acid extraction reagents based on silica membrane adsorption or magnetic bead methods; F) also includes detection mixture A; said detection mixture A includes PCR buffer, Mg 2+ One or more of dNTPs or Taq enzymes.

9. A method for quantitative detection of HCMV nucleic acid for non-diagnostic purposes, characterized in that, Includes the following steps: DNA is extracted from the sample to be tested and nucleic acid detection is performed using the kit described in claim 7 or 8.

Images