The litchi LcVAS1a gene and its application in plant organ abscission

Abstract

This application belongs to the field of plant genetic engineering, specifically relating to a litchi LcVAS1a gene and its application in plant organ abscission. The CDS sequence of this gene is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2. Experiments have shown that the LcVAS1a gene is upregulated during litchi fruit abscission; heterologous overexpression promotes Arabidopsis flower organ abscission; and silencing the LcVAS1a gene in the litchi pedicel abscission region inhibits young fruit abscission. This invention provides new gene resources and technical means for regulating plant organ abscission, and is of great significance for increasing the yield of crops such as litchi.

Description

Technical Field

[0001] This application belongs to the field of plant genetic engineering, specifically relating to a litchi LcVAS1a gene and its application in plant organ abscission. Background Technology

[0002] Lychee (Litchi chinensis Sonn.) belongs to the genus Litchi in the family Sapindaceae. It has a long history of cultivation and is a specialty fruit tree widely cultivated in the subtropical regions of southern my country. During its approximately three-month development period, lychee fruits experience three to four physiological fruit drop peaks, often resulting in situations where "the tree is full of flowers but half-full of fruit, or even no harvest at all," severely limiting the development of the lychee industry. Therefore, fruit drop is a critical problem that urgently needs to be solved in lychee production and an important research topic in the field of fruit development.

[0003] Plant organ abscission is a complex physiological process influenced by multiple factors, involving the interaction of plant hormones, responses to environmental factors, and the formation and changes of abscission zones. Numerous studies have shown that the abscission process is precisely regulated by endogenous hormones, with auxin acting as an inhibitor of abscission and primarily promoting plant growth and development. The VAS1 gene encodes a pyridoxal phosphate-dependent aminotransferase that regulates plant growth and development by converting indole-3-pyruvate (IPA) to tryptophan (Trp) and thus controlling the concentration of indoleacetic acid (IAA).

[0004] In Arabidopsis thaliana, the vas1 mutant was found to increase auxin production, and under shading conditions, VAS1 overexpression produced less auxin and reduced plant height and seed setting rate compared to the wild type. In Solanaceae plants, mutations in the Pad-1 gene, a homolog of VAS1, led to IAA accumulation in the ovary, inducing parthenocarpy. In rice, transgenic families overexpressing OsVAS1 showed reduced auxin content and exhibited shorter plant height, fewer panicle branches, and a larger flag leaf angle, while the osvas1 mutant showed increased auxin content, taller plants, thicker stems, fewer tillers, and a more upward-pointing flag leaf angle. Furthermore, in soybeans, GmVAS1 participates in regulating lateral root development by affecting auxin content. However, there are no reports on the role of the VAS1 gene in regulating fruit abscission in plant organs. Summary of the Invention

[0005] This invention uses litchi as the research object to clone the CDS sequence of the litchi LcVAS1a gene and analyze its expression pattern in the process of young fruit abscission. Through Arabidopsis heterologous overexpression and litchi on-site verification, it is proved that the litchi LcVAS1a gene promotes fruit abscission.

[0006] To achieve the above-mentioned objectives, the following technical solution is provided:

[0007] A litchi LcVAS1a gene is provided, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] Furthermore, the amino acid sequence encoded by the LcVAS1a gene is shown in SEQ ID NO.2.

[0009] Furthermore, the promoter nucleotide sequence of the LcVAS1a gene is shown in SEQ ID NO.3.

[0010] Analysis of the expression pattern of LcVAS1a gene during litchi fruit abscission, the analysis included cloning the LcVAS1a gene from the litchi pedicel abscission region, the nucleotide sequence of which is shown in SEQ ID NO.1, and detecting the expression changes of LcVAS1a gene after girdling of leaves by qRT-PCR.

[0011] Analysis of the litchi-specific expression sites of the LcVAS1a gene, including obtaining the litchi LcVAS1a promoter (its nucleotide sequence is shown in SEQ ID NO.3), constructing its nucleic acid molecule into the pCAMBIA1391 plant expression vector to obtain the recombinant vector Pro. LcVAS1a ::GUS was transformed into Agrobacterium GV3101 to obtain recombinant microorganisms. Positive plants were obtained through Agrobacterium-mediated Arabidopsis genetic transformation, and GUS staining and destaining were performed to observe the expression pattern.

[0012] The application of the LcVAS1a gene in the cultivation of transgenic Arabidopsis thaliana lines includes the following: the nucleic acid molecule encoding litchi LcVAS1a, the sequence of which is shown in SEQ ID NO.1, is constructed into the pCAMBIA1302 plant expression vector to obtain the recombinant vector 35S:LcVAS1a, which is then transformed into Agrobacterium GV3101 to obtain the recombinant microorganism. Positive transgenic plants are obtained through Agrobacterium-mediated Arabidopsis thaliana genetic transformation, and transgenic Arabidopsis thaliana lines overexpressing the LcVAS1a gene are screened out.

[0013] The application of the LcVAS1a gene in reducing litchi fruit drop includes constructing the LcVAS1a gene into the pTRV2 vector, the sequence of which is shown in SEQ ID NO.1, obtaining the recombinant vector pTRV2-LcVAS1a, transforming it into Agrobacterium GV3101 to obtain recombinant microorganisms, and silencing the LcVAS1a gene in the litchi fruit stalk abscission region using the gene virus.

[0014] The application of the litchi LcVAS1a gene described above in regulating plant organ abscission, wherein the LcVAS1a gene is shown in SEQ ID NO.1.

[0015] Provide a primer pair, including LcVAS1a gene-specific primer pairs CTGTCAACGGTTTGCAAGGAG and AGTTCAACGCCTCCCTTAGTAG, or LcVAS1a gene heterologous transgene primer pairs GGACTCTTGACCATGGTAATGGGTTCCTGTCAACGGTTT and GTCAGATCTACCATGGTCTGAACCATTCC GTCTCTAACCAG, or LcVAS1a gene promoter sequence primer pairs TCGACGGATCCCCGGGAATTCAAAGGATTTTAATGATTTGGATACCAT and GTGGACTCCTCTTAGAATTCCTGCATCCACA CAAAACAAGTC, or LcVAS1a virus-induced gene silencing primer pairs GCCTCCATGGGGATCCGTT CCTGTCAACGGTTTGC, CTTCGGGACATGCCCGGGCCCCCGGATCACACAGGG.

[0016] Compared with the prior art, the beneficial effects of the present invention are:

[0017] (1) This invention provides a litchi auxin synthesis-related gene LcVAS1a that promotes plant organ abscission. The expression level of this gene in the fruit stalk abscission zone of the girdled leaf treatment was significantly higher than that in the control, suggesting that this gene is closely related to litchi fruit abscission.

[0018] (2) This invention is the first to identify and verify the key role of the LcVAS1a gene in litchi fruit abscission. Further experiments show that heterologous overexpression of the litchi LcVAS1a gene can promote the abscission of Arabidopsis flower organs. In addition, silencing the expression level of LcVAS1a in the litchi pedicel abscission zone can inhibit the abscission of young fruits. The invention also verifies that LcVAS1a is a key factor in promoting litchi fruit abscission, clarifying that the litchi LcVAS1a gene plays an important role in regulating plant organ abscission. Therefore, the litchi LcVAS1a gene provided by this invention can provide direction and technical support for litchi variety improvement and breeding. Attached Figure Description

[0019] The above and other objects, features and advantages of this application will become more apparent from the more detailed description of exemplary embodiments thereof in conjunction with the accompanying drawings.

[0020] Figure 1This is a graph showing the gene expression level analysis of LcVAS1a in the litchi pedicel abscission zone in Example 1 of this application. A represents the effect of girdling plus defoliation (GPD) treatment on the abscission of young 'Wuyejiu' litchi fruits; B represents the gene expression level of LcVAS1a in the litchi pedicel abscission zone analyzed by qRT-PCR technology. GPD (Girdling Plus Defoliation) is a treatment that cuts off the tree's nutrient supply, inducing fruit drop. Data are expressed as mean ± standard deviation. The LSD test was used, with different lowercase letters representing significant differences at the P < 0.05 level.

[0021] Figure 2 This is an analysis diagram of the LcVAS1a promoter-specific expression sites in Example 2 of this application. In the diagram, the numbers represent the positions of the flowers from top to bottom, starting from the white petals that are exposed at the top of the inflorescence.

[0022] Figure 3 This is a diagram showing the observation results of heterologous overexpression of the litchi LcVAS1a gene promoting the abscission of Arabidopsis flower organs in Example 3 of this application. In this diagram, A represents the expression level of LcVAS1a in different transgenic Arabidopsis lines, with the error bar representing the mean standard deviation; B represents the expression level of LcVAS1a in different complemented mutant Arabidopsis lines, with the error bar representing the mean standard deviation; C represents the inflorescences of wild-type (Col-0), heterologous overexpression of LcVAS1a (35S:LcVAS1a), vas1 mutant, and 35S:LcVAS1a complemented mutant; D represents a comparison of inflorescences in Col-0, 35S:LcVAS1a, vas1 mutant, and 35S:LcVAS1a complemented mutant lines; the numbers indicate the position of the flower from top to bottom, starting from the flower with white petals emerging from the top of the inflorescence.

[0023] Figure 4 This is a schematic diagram illustrating the effect of VIGS silencing of the LcVAS1a gene on the fruit drop rate of 'Sanyuehong' in Example 4 of this application. In the diagram, A represents the expression level of LcVAS1a in the stalk region after silencing, and B represents the statistical data of fruit drop rate after LcVAS1a gene silencing. The asterisk indicates a significant difference (*P<0.05). Detailed Implementation

[0024] Preferred embodiments of the invention will now be described in more detail. While preferred embodiments of the invention have been shown, it should be understood that the invention can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that the invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0025] The terminology used in this application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The singular forms “a,” “the,” and “the” used in this application and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise. It should also be understood that the term “and / or” as used herein refers to and includes any or all possible combinations of one or more of the associated listed items.

[0026] It should be understood that although the terms "first," "second," "third," etc., may be used in this application to describe various information, this information should not be limited to these terms. These terms are only used to distinguish information of the same type from one another. For example, without departing from the scope of this application, first information may also be referred to as second information, and similarly, second information may also be referred to as first information. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of this application, "multiple" means two or more, unless otherwise explicitly specified.

[0027] Example 1

[0028] Obtaining the LcVAS1a gene and analyzing its expression pattern during litchi fruit abscission.

[0029] The experimental material was the 'Wuyejiu' litchi variety. Thirty branches of similar thickness and fruit yield were selected and treated approximately 30 days after flowering. Thirty branches underwent girdling plus defoliation (GPD), with a girdling approximately 10 cm from the base of the fruit cluster, about 0.5 cm wide and reaching the xylem. All leaves above the girdling point were removed to interrupt carbon nutrient supply to the young fruit. Thirty branches served as a control (no treatment). From each treatment, 15 branches were selected for fruit drop rate statistics, and the remaining branches were used for sample collection. Fruit drop rates were counted daily from the day of treatment until all young fruit had fallen off. The results showed that girdling plus defoliation significantly induced a large amount of fruit drop in 'Wuyejiu' litchi. Figure 1 A).

[0030] Samples were collected from the abscission zone (AZ) of litchi fruit stalks at 0, 1, 2, 3, and 4 days after treatment. RNA was extracted, and the expression level of the LcVAS1a gene was detected by qRT-PCR. The results showed that the expression level of the LcVAS1a gene was significantly higher than that of the control after girdling of leaves. Figure 1B). Therefore, we hypothesize that this gene is closely related to litchi fruit abscission. The specific steps for the differential expression analysis of the LcVAS1a gene in the pedicel abscission zone of the girdled leaf treatment (GPD) are as follows:

[0031] 1. Extraction of RNA from litchi

[0032] RNA was extracted from the pedicel region using the ultrafast plant RNA extraction kit from Beijing Huayueyang Biotechnology Co., Ltd. Detailed procedures were followed according to the kit's instruction manual. The concentration and purity of the extracted RNA were determined using a Nanodrop 2000 micro spectrophotometer, and RNA integrity was assessed by agarose gel electrophoresis.

[0033] 2. Reverse transcription of cDNA

[0034] RNA samples were reverse transcribed into cDNA using the TransScript One-Step gDNA Removal and cDNA Synthesis Super Mix kit. The reversed samples were stored at -20°C for later use and diluted 20-fold before qRT-PCR.

[0035] 3. qRT-PCR

[0036] Specific primers for the LcVAS1a gene were designed using Primer 5.0 software, with litchi EF-1a as an internal reference gene. qRT-PCR was performed using a fluorescent dye kit. qPCR Green Master Mix (YEASEN) was used in a 10 μL reaction mixture (1 μL upstream primer, 1 μL downstream primer, 3 μL cDNA, and 5 μL SYBR fluorescent dye). The instrument used was a Bio-Rad ABI 7500 Real-Time PCR System (Applied Biosystems, USA). The program was: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 40 cycles, using 2... -△△C The T-method was used to calculate gene expression levels. Primer sequences are shown in Table 1.

[0037] Table 1. LcVAS1a qRT-PCR primer sequences

[0038]

[0039] The obtained CDS sequence of the LcVAS1a gene is shown in SEQ ID NO.1, with an open reading frame of 1185 bp encoding 394 amino acids, as shown in SEQ ID NO.2. The promoter nucleic acid sequence of LcVAS1a is shown in SEQ ID NO.3. The gene is named LcVAS1a.

[0040] LcVAS1a CDS sequence (SEQ ID NO.1):

[0041]

[0042] Amino acid sequence encoded by LcVAS1a (SEQ ID NO.2):

[0043] MGSCQRFARRAVETDIPVMVQLQELIQGAKNAVSLAQGVVYWQPPKKALEKVKELVWDPLVSKYGADEGMPLLREALTKKLHQENKLYKSSVMVTAGANQAFVNTVLTLCDPGDSVVMFAPYYFNAYMSFQMTGITNIIVGPANPNTLRPDADWLEKILSETKPTPKLVTVVNPGNPSGTYIPEPLLKRISDLCRNAGSWLVVDNTYEYFMYDGLEHSCVEGNHIVNIFSFSKAYGMMGWRVGYIAYPTEVEGFSQQLLKVQDNIPICASILSQYLALFSLEVGPEWVTEQVKDLVKNRDIILEALSPLGEDAVRGGEGAIYLWARLPARYHDDYAVVYWLAHRHGVVVVPGGASGCPGHLRISFGGLIEDDCKAAADQLKKGLEELVRDGMVQ

[0044] LcVAS1a promoter sequence (SEQ ID NO.3):

[0045]

[0046] Example 2

[0047] Analysis of specific expression sites of the LcVAS1a gene

[0048] 1. Primer design for the LcVAS1a gene promoter sequence

[0049] Genomic DNA was extracted from the leaves of the litchi 'Feizixiao' variety using the CTAB method. Using the obtained 'Feizixiao' litchi leaf DNA as a template, PCR was performed with ApexHF HSDNA Polymerase FS enzyme for sequence amplification. Specific expression site analysis was conducted using the pCAMBIA1391 vector (with hygromycin as the selection marker for transformed plants) containing the β-glucuronidase (GUS) reporter gene, with EcoRI as the restriction enzyme site. Primers containing homologous arms (containing restriction enzyme sites) of the vector were designed using Primer 5.0 software based on the promoter sequence of the LcVAS1a gene. Primer sequences are shown in Table 2.

[0050] Table 2. Primer Design for LcVAS1a Gene Promoter Sequence

[0051]

[0052] 2. PCR reaction system, procedure, and product detection for gene cloning

[0053] (1) The PCR reaction system is shown in Table 3:

[0054] Table 3 PCR reaction system

[0055]

[0056]

[0057] (2) PCR reaction procedure

[0058] The PCR reaction procedure is as follows: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 15 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, 34 cycles, 72℃ extension for 5 min, and storage at 4℃.

[0059] (3) PCR product detection and recovery

[0060] PCR products were detected by 1.2% agarose gel electrophoresis at 135V and 110A for 15 minutes. The agarose gel was then imaged using a gel imaging system to confirm the presence of the target gene fragment. If a bright band appeared and was of the correct size, the gel containing the target fragment was quickly cut using a UV gel cutter with a scalpel. The gel was then recovered using a DNA gel extraction kit (FastPure Gel DNA Extraction Mini Kit, Novizan), following the instructions in the kit's manual. The recovered product was stored at -20°C.

[0061] 3. Pro LcVAS1a ::GUS Carrier Construction

[0062] In-fusion ligation kit ( IIOne Step Cloning Kit (Novazia) will be Pro LcVAS1a The ::GUS clone fragment was ligated into the pCAMBIA1391 vector. The ligation system is shown in Table 4. After mixing, the mixture was reacted at 37°C for 30 min.

[0063] Table 4 In-fusion Connection System

[0064]

[0065] After the reaction was completed, E. coli DH5α (Qingke Biotechnology) was transformed, and positive clones were screened by PCR identification. The verified single clones were sent to Youkang Biotechnology Co., Ltd. for sequencing.

[0066] 4. Transformation of Agrobacterium

[0067] After sequencing and identification, the successfully constructed recombinant expression vector Pro was used via a chemical freeze-thaw method. LcVAS1a ::GUS was transferred into Agrobacterium GV3101 (Weidi), and positive clones were screened by PCR identification.

[0068] 5. Agrobacterium-mediated genetic transformation of Arabidopsis thaliana and screening of transgenic lines

[0069] The obtained Agrobacterium containing recombinant plasmids was cultured in LB liquid medium and amplified for later use. After the Agrobacterium solution was amplified to approximately 0.8 OD600, the cells were collected by centrifugation at 5000 rpm for 10 min at room temperature. The cells were then resuspended in a 5% sucrose solution containing 0.1% silwet-77 until the OD600 was approximately 1.0. The pollinated pods of wild-type Arabidopsis thaliana Col-0 plants were removed, and the inflorescences were immersed in the Agrobacterium solution for 1 min. The infected plants were then cultured overnight in the dark before being returned to normal conditions for further culture. To improve infection efficiency, the Arabidopsis thaliana was infected every 4-5 days, for 3-4 infections, followed by normal culture until seed maturity. After maturity, the Arabidopsis seeds were harvested, which are the transgenic T0 generation seeds.

[0070] 6. Screening of transgenic positive seedlings and GUS histochemical staining

[0071] After obtaining T0 generation transgenic seeds, resistant seedlings were screened on MS medium containing hygromycin B (Hyg, 50 mg / L) resistance. After vernalization at 4℃ for 2-3 days, they were transferred to a light incubator. When roots and two cotyledons appeared, positive seedlings were selected and transferred to nutrient soil for further cultivation. After 45 days of growth, the plant material (inflorescences, pods, stem leaves, etc.) was cut and placed in 10 mL centrifuge tubes containing GUS staining solution (Huayueyang). Staining was carried out at 37℃ in the dark for 2-6 hours, with the staining status checked every hour. After staining, the staining solution was discarded, and 100% ethanol was added for decolorization. The 100% ethanol was replaced approximately every hour. Once the chlorophyll was completely removed, the seedlings were placed in a clearing solution for 2 hours and observed and photographed under a stereomicroscope. Results are as follows: Figure 2 As shown, the GUS signal driven by the LcVAS1a promoter is strongly expressed in the Arabidopsis thaliana detachment region, further illustrating the association between LcVAS1a and organ detachment.

[0072] Example 3

[0073] Identification of the function of the litchi LcVAS1a gene by heterologous overexpression in Arabidopsis thaliana

[0074] 1. Design of primers for heterologous transgenic LcVAS1a gene

[0075] RNA was extracted from the 'Feizixiao' litchi using the ultrafast plant RNA extraction kit from Beijing Huayueyang Biotechnology Co., Ltd. Detailed procedures were followed according to the kit instructions. The concentration and purity of the extracted RNA were determined using a Nanodrop 2000 micro-spectrophotometer, and RNA integrity was checked by agarose gel electrophoresis. RNA samples were reverse transcribed using the TransScript One-Step gDNA Removal and cDNA Synthesis Super Mix kit. The reversed samples were stored at -20℃ for later use. Using the obtained cDNA as a template, PCR was performed with ApexHF HSDNA Polymerase FS enzyme for sequence amplification. Heterologous transgenesis was performed using the pCAMBIA1302 vector (promoter CaMV35S, selection marker for transformed plants: hygromycin). NcoI was used as the restriction enzyme site. Based on the CDS sequence of the LcVAS1a gene, primers containing homologous arms (containing restriction enzyme sites) were designed using Primer 5.0 software. Primers containing suitable restriction enzyme sites were designed at the start codon ATG and stop codon, respectively. Primer sequences are shown in Table 5.

[0076] Table 5 Primer Design for LcVAS1a Gene Heterologous Transgenic Transformation

[0077]

[0078] 2. The PCR reaction system, procedure, and product detection for gene cloning are the same as in Example 2 above.

[0079] 3. Construction of the 35S:LcVAS1a vector

[0080] In-fusion ligation kit ( The 35S:LcVAS1a clone fragment was ligated into the pCAMBIA1302 vector using the IIOne Step Cloning Kit (Novizan). The ligation system is shown in Table 6. After mixing, the mixture was reacted at 37°C for 30 min.

[0081] Table 6 In-fusion Connection System

[0082]

[0083] After the reaction was completed, E. coli DH5α (Qingke Biotechnology) was transformed, and positive clones were screened by PCR identification. The verified single clones were sent to Youkang Biotechnology Co., Ltd. for sequencing.

[0084] 4. Transformation of Agrobacterium

[0085] After sequencing and identification, the successfully constructed recombinant expression vector 35S:LcVAS1a was transformed into Agrobacterium GV3101 (Weidi) using the chemical freeze-thaw method, and positive clones were screened by PCR identification.

[0086] 5. Agrobacterium-mediated genetic transformation of Arabidopsis thaliana is the same as in Example 2 above.

[0087] 6. Screening and phenotypic observation of transgenic positive seedlings

[0088] After obtaining T0 generation transgenic seeds, resistant seedlings were screened in MS medium containing hygromycin B (Hyg, 50 mg / L) resistance. After vernalization at 4℃ for 2-3 days, they were transferred to a light incubator. Positive seedlings were selected when roots and two cotyledons appeared, and then transferred to nutrient soil for further cultivation. When the positive seedlings had approximately eight cotyledons, leaf samples were collected to extract transgenic plant RNA, which was quantitatively detected using qRT-PCR to obtain positive transgenic plants. Figure 3 A, 3B).

[0089] After obtaining T1 generation seeds, positive plants were screened again using MS medium containing Hyg and cultured until homozygous T3 generation, obtaining homozygous transgenic Arabidopsis lines. Under the same conditions, transgenic T3 generation lines and wild-type lines were planted. Phenotypic observation revealed that wild-type Arabidopsis Col-0 plants began to shed floral organs (calyx, petals, stamens) at the 7th node and completely shed them at the 8th node; while the 35S:LcVAS1a Arabidopsis line began to shed at the 4th node and completely shed at the 5th node, approximately 3 nodes later than the wild type; the vas1 mutant Arabidopsis began to shed at the 10th node and completely shed at the 11th node, while the 35S:LcVAS1a mutant replacement line began to shed at the 5th node and completely shed at the 6th node. Figure 3 (C, 3D). This indicates that heterologous overexpression of LcVAS1a can promote the abscission of Arabidopsis flower organs and suggests that it may have the same effect in the abscission of litchi fruit.

[0090] Example 4

[0091] Virus-induced gene silencing (VIGS) to verify the function of the LcVAS1a gene in litchi.

[0092] 1. LcVAS1a gene VIGS primer design

[0093] Using the 'Feizixiao' litchi isolated cDNA as a template, PCR was performed with ApexHF HSDNA Polymerase FS enzyme for sequence amplification. Gene silencing (VIGS) was performed using the pTRV2 vector with BamHI and SmaI restriction enzyme sites. The non-conserved functional region of LcVAS1a was selected, and primers containing vector homologous arms (containing restriction enzyme sites) were designed using Primer 5.0 software. The amplified target fragment length was 300-500 bp. Primer sequences are shown in Table 7.

[0094] Table 7 Primer sequences for LcVAS1a fragment amplification

[0095]

[0096] 2. The PCR reaction system, procedure, and product detection for gene cloning are the same as in Example 2 above.

[0097] 3. Construction of pTRV2-LcVAS1a vector

[0098] In-fusion ligation kit ( The LcVAS1a clone fragment was ligated to the pTRV2 vector using the IIOne Step Cloning Kit (Novizan). The ligation system is shown in Table 8. After mixing, the mixture was reacted at 37°C for 30 min.

[0099] Table 8 In-fusion Connection System After the reaction was completed, E. coli DH5α (Qingke Biotechnology) was transformed, and positive clones were screened by PCR identification. The verified single clones were sent to Youkang Biotechnology Co., Ltd. for sequencing.

[0100] 4. Transformation of Agrobacterium

[0101] After sequencing and identification, the successfully constructed recombinant expression vector pTRV2-LcVAS1a was transformed into Agrobacterium GV3101 (Weidi) using the chemical freeze-thaw method, and positive clones were screened by PCR identification.

[0102] 5. Silent litchi pedicel abscission zone LcVAS1a and statistical fruit drop rate

[0103] The obtained Agrobacterium containing the recombinant plasmid was cultured in LB liquid medium and amplified for later use; the Agrobacterium culture was amplified to OD200. 600 After reaching approximately 0.8, the bacterial cell pellet was resuspended in a suspension (10 mM MES, 10 mM MgCl2, and 150 μM acetylsylgenone) to adjust the OD of the bacterial culture. 600After reaching 1.0, pTRV2-LcVAS1a and pTRV2 were mixed with equal volumes of pTRV1 bacterial solution. The mixed infection solution was placed in the dark for 4-6 hours before being used to soak the flower spikes. During the peak blooming period of the female flowers of the 'Sanyuehong' litchi variety, 30 fruit-bearing branches with similar flower counts were selected, and the flower spikes were soaked in the infection solution for 1 minute, ensuring each flower was fully immersed. Litchi pedicel samples were collected at 21 and 28 days post-treatment, RNA was extracted, and qRT-PCR was used to quantify the LcVAS1a gene. The results showed that, compared with the control, VIGS treatment significantly reduced the expression level of LcVAS1a. Figure 4 A).

[0104] Fruit drop rates were assessed and tallied on days 14, 21, and 28 post-infection. Results showed that on day 21 after VIGS treatment, the relative fruit drop rate in the VIGS-treated group was 42.2%, significantly lower than the 54.6% in the control group. On day 28, the cumulative fruit drop rate in the VIGS-treated group increased to 66.2%, while the cumulative fruit drop rate in the control group was 75.6%. Figure 4 B). This indicates that reducing the expression level of LcVAS1a in the pedicel abscission zone can significantly inhibit the abscission of young fruits. The regulatory role of the LcVAS1a gene on young fruit abscission was verified in litchi, and LcVAS1a is a key factor promoting litchi fruit abscission.

[0105] In summary, the expression of the litchi LcVAS1a gene in the pedicel abscission zone was significantly upregulated as litchi fruit abscission intensified. Heterologous overexpression of the LcVAS1a gene through genetic transformation significantly promoted the abscission of Arabidopsis flower organs, and silencing the LcVAS1a gene in litchi stalks inhibited the abscission of young fruits, confirming that LcVAS1a is a positive regulator of abscission.

[0106] The embodiments of this application have been described above. These embodiments are merely examples for clearly illustrating the invention and are exemplary, not exhaustive, and are not limited to the disclosed embodiments. Those skilled in the art can make other variations or modifications based on the above description. It is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this invention should be included within the scope of protection of the claims of this invention. The terminology used herein is chosen to best explain the principles, practical applications, or improvements to the technology in the market of the embodiments, or to enable other those skilled in the art to understand the embodiments disclosed herein.

Claims

1. A type of lychee LcVAS1a Genes, characterized by, The LcVAS1a The gene nucleotide sequence is shown in SEQ ID NO.

1.

2. The litchi LcVAS1a gene according to claim 1, characterized in that, The LcVAS1a The amino acid sequence encoded by the gene is shown in SEQ ID NO.

2.

3. LcVAS1a The application of genes in the breeding of transgenic Arabidopsis thaliana lines is characterized by, The application includes encoding lychees. LcVAS1a The nucleic acid molecule, with the sequence shown in SEQ ID NO.1, was used to construct the recombinant vector 35S into the pCAMBIA1302 plant expression vector. LcVAS1a The recombinant vector 35S: LcVAS1a Recombinant microorganisms were obtained by transformation into Agrobacterium GV3101. Positive transgenic plants were then obtained through Agrobacterium-mediated Arabidopsis thaliana genetic transformation, and selected... LcVAS1a A transgenic Arabidopsis thaliana line with overexpressed genes; the transgenic Arabidopsis thaliana flower organs abscission time is earlier than that of the wild type.

4. Silence LcVAS1a The application of genes in reducing litchi fruit drop is characterized by, The LcVAS1a The gene sequence is shown in SEQ ID NO.

1.

5. The application of the litchi LcVAS1a gene in regulating plant organ abscission, characterized in that, Overexpression of the litchi LcVAS1a gene promotes abscission of Arabidopsis flower organs, while silencing the litchi LcVAS1a gene reduces abscission of litchi fruit. The litchi LcVAS1a gene is shown in SEQ ID NO.1.

Images