A recombinant vector, expression plasmid, recombinant Schizochytrium mutant, and method for increasing microbial DHA content.

By knocking out the LIP1 gene in the lipodroplet protein of Schizochytrium, the hydrolysis process of lipase was blocked, which solved the problem of reduced DHA content and achieved an increase in DHA yield and purity as well as the stability of the fermentation process.

CN121294490BActive Publication Date: 2026-06-30OCEAN UNIV OF CHINA

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
OCEAN UNIV OF CHINA
Filing Date
2025-12-11
Publication Date
2026-06-30

Smart Images

  • Figure CN121294490B_ABST
    Figure CN121294490B_ABST
Patent Text Reader

Abstract

This invention relates to the field of genetic engineering technology, specifically to a recombinant vector, expression plasmid, recombinant Schizochytrium mutant, and a method for increasing the DHA content of microorganisms. The method involves knocking out the lipase-encoding protein in microbial lipid droplets using homologous recombination technology. LIP1 The gene can effectively inhibit the production of lipase in microbial lipid droplets, thereby blocking the hydrolysis process of triglycerides of polyunsaturated fatty acids stored in lipid droplets into glycerol and free fatty acids in the later stage of microbial culture, and preventing DHA from being lost from the TAG storage bank. Experimental verification shows that in microorganisms represented by Schizochytrium, the DHA content can be increased by 21.8% compared with the wild type. This not only improves the yield and purity of DHA, but also ensures the stability of the microbial fermentation process, making it easy to promote and apply.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a recombinant vector, expression plasmid, recombinant Schizochytrium mutant, and a method for increasing the DHA content of microorganisms. Background Technology

[0002] Docosahexaenoic acid (DHA), an important omega-3 long-chain polyunsaturated fatty acid, has extremely high application value in areas such as infant development and adult health maintenance. Traditionally, DHA has mainly relied on extraction from fish oil, but this method is increasingly limited by multiple factors such as the scarcity of marine fishery resources, inconsistent fish oil quality, and susceptibility to environmental pollution. Currently, microbial fermentation production is attracting increasing attention.

[0003] Schizochytrium sp., a typical marine heterotrophic oil-producing microorganism, has become a core cell factory for industrial DHA production due to its highly efficient accumulation capacity of lipids (50%–70% of cell dry weight) and its unique advantage in synthesizing DHA via fatty acid synthase and polyketide synthase pathways. However, the metabolic stability of lipid droplets, the lipid storage organelle, becomes a key challenge in the industrial fermentation process using Schizochytrium. Studies have found that in the later stages of fermentation, lipases present in the lipid droplets hydrolyze TAG (triglycerides) into glycerol and free fatty acids, leading to the loss of DHA from the TAG storage pool and significantly reducing the content and yield of the target product, DHA.

[0004] While the academic community has made some progress in understanding the biogenetic mechanisms of schistocyticurum lipid droplets, research into their lipolysis process remains relatively weak. To date, the specific key lipase gene targets responsible for triglyceride (TAG) hydrolysis in schistocyticurum lipid droplets have not been clearly identified, nor has an effective method been found to knock out these target genes using precise gene editing technology, thereby blocking TAG hydrolysis and increasing DHA accumulation.

[0005] Therefore, it is of great significance to study a method that can accurately locate the key lipase gene that regulates TAG hydrolysis in the lipid droplets of Schizochytrium and inhibit its function through genetic engineering to reduce DHA loss. Summary of the Invention

[0006] The purpose of this invention is to address the problem in existing technologies where, during the later stages of Schizochytrium culture, lipases in the lipid droplets hydrolyze triglycerides storing polyunsaturated fatty acids into glycerol and free fatty acids, leading to a decrease in DHA content in Schizochytrium. This invention provides a recombinant vector, expression plasmid, recombinant Schizochytrium mutant, and a method for increasing microbial DHA content. Using Schizochytrium as the primary research object, this invention achieves increased polyunsaturated fatty acid content by knocking out key genes encoding lipase proteins in lipid droplet proteins, providing a target basis for metabolic engineering modification and contributing to the improvement of quality and efficiency in the microbial oil industry.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] The first aspect of this invention provides a method for increasing the DHA content of microorganisms by knocking out the enzyme encoding lipase in microbial lipid droplet proteins using homologous recombination technology. LIP1 Genes, the ones mentioned LIP1 The amino acid sequence of the lipase encoded by the gene is shown in SEQ ID NO:1, and the nucleotide sequence of the LIP1 gene is shown in SEQ ID NO:2.

[0009] This invention utilizes homologous recombination technology to knock out the enzyme encoding lipase in microbial lipid droplet proteins. LIP1 The gene (encoding the lipase amino acid sequence shown in SEQ ID NO:1 and the gene nucleotide sequence shown in SEQ ID NO:2) can effectively inhibit the production of lipase in microbial lipid droplets, thereby blocking the hydrolysis process of triglycerides of polyunsaturated fatty acids stored in lipid droplets into glycerol and free fatty acids in the later stage of microbial culture, and preventing the loss of DHA from the TAG storage bank. Experimental verification shows that in microorganisms represented by Schizochytrium, the DHA content can be increased by 21.8% compared with the wild type. This not only improves the yield and purity of DHA, but also ensures the stability of the microbial fermentation process, making it easy to promote and apply.

[0010] Furthermore, the specific steps include:

[0011] Step 1: Construct homologous recombination vectors;

[0012] Step 2: Electroporate the homologous recombination vector into the microbial protoplast;

[0013] Step 3: Incubate in GPY medium containing nordrin (NTC);

[0014] Step 4: The gene knockout was confirmed to be successful by PCR amplification and analysis of fatty acid composition after fermentation culture.

[0015] Furthermore, in step 3, the concentration of norsinolate in the GPY culture medium is 80-120 μg / mL.

[0016] Furthermore, the homologous recombination vector comprises an upstream homologous arm, a downstream homologous arm, and a norsulitis resistance gene located between them; wherein, the nucleotide sequence of the upstream homologous arm is shown in SEQ ID NO:3; the nucleotide sequence of the downstream homologous arm is shown in SEQ ID NO:4; and the nucleotide sequence of the norsulitis resistance gene is shown in SEQ ID NO:5.

[0017] Furthermore, the lengths of both the upstream and downstream homologous arms are 1.0 kb to 1.5 kb.

[0018] Furthermore, the microorganism is Schizochytrium.

[0019] A second aspect of the present invention provides a recombinant vector comprising an upstream homologous arm as shown in SEQ ID NO:3, a downstream homologous arm as shown in SEQ ID NO:4, and a norsinoxin resistance gene as shown in SEQ ID NO:5.

[0020] This invention provides a recombinant vector comprising the upstream homologous arm shown in SEQ ID NO:3, the downstream homologous arm shown in SEQ ID NO:4, and the norsinosin resistance gene shown in SEQ ID NO:5. This recombinant vector provides a key tool for the efficient construction of LIP1 gene knockout recombinant microorganisms. Through its mediated precise gene knockout, the hydrolysis process of triglycerides in microbial lipid droplets can be effectively blocked, providing solid technical support for the construction of strains that efficiently produce DHA from microorganisms.

[0021] A third aspect of the present invention provides an expression plasmid containing a green fluorescent protein tag and LIP1 Gene sequence, wherein the nucleotide sequence of the fluorescent protein tag is shown in SEQ ID NO:6.

[0022] A fourth aspect of the present invention provides a recombinant Schizochytrium mutant whose genome encodes a lipase with the amino acid sequence shown in SEQ ID NO:1. LIP1 The gene is inactivated or knocked out.

[0023] The fifth aspect of the present invention provides the application of the recombinant Schizochytrium mutant as described above in the production of DHA.

[0024] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0025] 1. This invention uses homologous recombination technology to knock out the enzyme encoding lipase in microbial lipid droplet proteins. LIP1 The gene (encoding the lipase amino acid sequence shown in SEQ ID NO:1 and the gene nucleotide sequence shown in SEQ ID NO:2) can effectively inhibit the production of lipase in microbial lipid droplets, thereby blocking the hydrolysis process of triglycerides of polyunsaturated fatty acids stored in lipid droplets into glycerol and free fatty acids in the later stage of microbial culture, and preventing the loss of DHA from the TAG storage bank. Experimental verification shows that in microorganisms represented by Schizochytrium, the DHA content can be increased by 21.8% compared with the wild type. This not only improves the yield and purity of DHA, but also ensures the stability of the microbial fermentation process, making it easy to promote and apply.

[0026] 2. This invention provides a recombinant vector comprising the upstream homologous arm shown in SEQ ID NO:3, the downstream homologous arm shown in SEQ ID NO:4, and the norsinosin resistance gene shown in SEQ ID NO:5. This recombinant vector provides a key tool for the efficient construction of LIP1 gene knockout recombinant microorganisms. Through its mediated precise gene knockout, the hydrolysis process of triglycerides in microbial lipid droplets can be effectively blocked, providing solid technical support for the construction of strains that produce DHA efficiently from microorganisms.

[0027] 3. This invention also provides an expression plasmid, a recombinant Schizochytrium mutant and its applications, providing a target basis for metabolic engineering modification and helping to improve the quality and efficiency of the microbial oil industry. Attached Figure Description

[0028] Figure 1 To verify the knockout of ATCC 20888 of Schizochytrium LIP1 Agarose gel electrophoresis image of the gene.

[0029] Figure 2 for LIP1 Diagram of protein domains encoded by a gene.

[0030] Figure 3 This is a phylogenetic tree of the LIP1 protein.

[0031] Figure 4 The graph shows the biomass changes of the wild-type and mutant strain △LIP1 of Schizochytrium ATCC 20888 within 120 h of fermentation culture.

[0032] Figure 5 Figures showing the cell dry weight and total fatty acid content of Schizochytrium ATCC 20888 wild-type and mutant strain △LIP1 after 72 h of fermentation.

[0033] Figure 6 Gas chromatography-mass spectrometry (GC-MS) images of wild-type and mutant strain ΔLIP1 of Schizochytrium ATCC 20888 after 72 h of fermentation. Figure 6 A in the figure represents the gas chromatography-mass spectrometry (GC-MS) chromatogram of the wild-type (WT) strain. Figure 6 B in the figure is a gas chromatography-mass spectrometry (GC-MS) chromatogram of the mutant strain (△LIP1).

[0034] Figure 7 The fatty acid composition of wild-type and mutant strain △LIP1 of Schizochytrium ATCC 20888 after 72 h of fermentation.

[0035] Figure 8 for Yarrowia lipolytica Laser confocal microscopy fluorescence imaging of Po1f wild-type (WT) and transformant (PLIP1) ( Figure 8 In this context, A represents the dark field. Figure 8 B in the diagram represents the bright field. Figure 8 In this context, C represents the overlap between the bright and dark fields. Detailed Implementation

[0036] The present invention will now be described in detail with reference to the accompanying drawings.

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0038] Example 1: Lipase in lipid droplets LIP1 gene knockout

[0039] The method for constructing a mutant strain of Schizochytrium includes the following steps:

[0040] Construction of recombinant plasmid KN-LIP1

[0041] Using the genome of *Schizochytrium ATCC 20888* as a template, PCR amplification was performed using primer pairs LIP1-up-F / R and LIP1-do-F / R. The final result was... LIP1 DNA fragments of the upstream and downstream homologous arms of the gene. The primer sequences for LIP1-up-F / R and LIP1-do-F / R are shown below:

[0042] LIP1-up-F:CTATGACCATGATTACGCCACCTAGGGCGCGGGGGGCTGCGCGG;

[0043] LIP1-up-R:TTGGTCTAGAATCGTCGACCCGCTCCTCCCTCGCGCGGGG;

[0044] LIP1-do-F:TCTAGAGGATCCCCGGGTACCAAAAGCAACCGTCCCCAAA;

[0045] LIP1-do-R:TGTACTGAGAGTGCACCATACCCATATGGGCGAAAAGTATCCTGCAC.

[0046] Using pKO-NTC plasmid as a backbone, pKO-NTC was double-digested with restriction endonucleases PstI and HindIII, and the linearized vector was obtained by gel recovery. LIP1-up was ligated into the vector using ABclonal's 2×MultiF Seamless Assembly Mix. After confirming successful ligation of LIP1-up, the recombinant plasmid containing LIP1-up was further digested with KpnI and NdeI, and LIP1-do was ligated into the vector again using ABclonal's 2×MultiF Seamless Assembly Mix. Sequencing of E. coli transformants confirmed the correct recombinant plasmid, which was then preserved for later use. Thus, the construction of the recombinant plasmid KN-LIP1 was completed.

[0047] The two seamless cloning steps described above are completed as follows: the ligation system is ligated at 50 ℃ for 30 min, and then the ligation system is transformed into competent E. coli DH5α cells; E. coli transformation is performed, and the cells are cultured at 200 rpm and 37 ℃ for 1 h, then centrifuged at 4000 rpm for 2 min, and finally spread on LB solid medium containing 100 μg / mL ampicillin, and incubated overnight upside down in a 37 ℃ incubator for 12-16 h until transformants grow.

[0048] (2) Construction of the Schizochytrium mutant △LIP1

[0049] The recombinant plasmid KN-LIP1 was double-digested with restriction enzymes AflII and NdeI, and the linearized vector was recovered from the gel. The linearized vector was then used for the study of Schizochytrium. LIP1 For gene knockout experiments, the linearized vector was stored at -20 ℃.

[0050] Preparation of competent cells of Schizochytrium

[0051] A single colony of *Schizochytrium ATCC 20888* was picked from a solid culture plate and inoculated into 50 mL of GPY liquid medium. The culture was incubated at 28 °C and 180 rpm for 36 h in a shaker. After microscopic observation to ensure the seed culture was free of contamination, the following steps were performed.

[0052] Pour 35 mL of bacterial culture into a 50 mL centrifuge tube, centrifuge at 5000 × g for 5 min, and discard the supernatant.

[0053] Add 30 mL of 0.8 M sorbitol solution and gently pipette to mix and resuspend the bacterial culture. Centrifuge at 4 °C, 4000 × g for 5 min and discard the supernatant.

[0054] Add 5 mL of transformation solution and 50 μL of 1 M DTT solution to the collected bacterial cells, mix well by pipetting, and let stand on ice for 30 min. Centrifuge at 4 ℃, 4000 × g for 5 min, and discard the supernatant.

[0055] Add 30 mL of 0.8 M sorbitol solution at 4 °C to the bacterial cells, mix well by pipetting, centrifuge at 4 °C, 4000 ×g for 5 min, and discard the supernatant. (Repeat this step twice)

[0056] Resuspend the cells in 1 mL of 0.8 M sorbitol solution at 4 °C, and aliquot the resuspended cell suspension into 1.5 mL centrifuge tubes and place them on ice. The preparation of competent cells is now complete.

[0057] Electrotransformation of Schizochytrium competent cells

[0058] Take 80 μL of the prepared competent cells, add 20 μL (5 μg) of linearized KN-LIP1 vector fragment, gently pipette to mix, and then add to a pre-cooled electroporation cuvette with a 2 mm gap. Incubate on ice for 30 min.

[0059] Before the electric shock, wipe the outer wall of the shock cup dry and transfer it to the electroconversion device for electric shock. The electric shock parameters are: 1500 V, 400 Ω, 25 μF.

[0060] ③ After electroporation, add 1 mL of 0.8 M sorbitol solution (4 ℃) to the electroporation cuvette, mix the cells in the cuvette, and transfer to a 1.5 mL sterile centrifuge tube. Incubate at 28 ℃ and 150 rpm for 4 h. Centrifuge at 4000 rpm for 2 min, aspirate 800 μL of supernatant, mix the remaining cells by pipetting, and spread them on solid GPY plates containing 80 μg / mL NTC antibiotic. Incubate at 28 ℃ for 2-5 days, waiting for transformant colonies to grow.

[0061] ④ Transfer the transformants to liquid GPY medium containing 80 μg / mL NTC using a sterile inoculation loop for re-screening. Add 1 mL each of bacterial culture and preservation solution to the preservation tube, mix well, and store in the laboratory at -80 ℃.

[0062] PCR verification of transformants

[0063] Genomic DNA was extracted from the successfully transformed strain △LIP1 for PCR verification, using genomic DNA from strain ATCC 20888 as a control template. NTC Has the resistance fragment been introduced into the Schizochytrium genome? (Selection) LIP1 Partial gene fragments were validated using PCR with LIP1-F and LIP1-R primers, and the products were verified by agarose gel electrophoresis to validate the transformant strains. LIP1 Whether the gene was successfully knocked out. For example... Figure 1 As shown, no amplification was observed in the transformant overexpression strain. LIP1 The correct gene fragment was amplified by the wild-type strain. LIP1 Gene fragments, preliminarily identified as having... LIP1 Gene knockout was successful. The sequences of LIP1-F, LIP1-R, NTC-F, and NTC-R are as follows:

[0064] LIP1-F:ATGCCGCGCGGAGCCGCC;

[0065] LIP1-R:GTCTAGACACTTCGGACGAGGA;

[0066] NTC-F:TTAGGCGTCGTCCTGGGCGCC;

[0067] NTC-R: ATGAAGATCTCGGTCATCCCCGAGCA.

[0068] Analysis of lipase protein in Schizochytrium ATCC 20888

[0069] The protein sequence encoding lipase in Schizochytrium was analyzed using SMART domains. The results are as follows: Figure 2 As shown, the results indicate that the most important domain of the lipase protein in *Schizochytrium* is a hydrolase domain located at 1018-1083 bp of the protein sequence, reflecting that this protein mainly functions as a hydrolase. Then, the NCBI BLAST website was used to further analyze the protein... LIP1 The protein sequences of the gene were analyzed, and the eight protein sequences with the highest sequence similarity were selected. A phylogenetic tree was constructed using MEGA 11 software, and the specific results are shown in Figure 3. This tree is related to the Schizochytrium lipase. LIP1The most similar sequences are Hondaea fermentalgiana The lipase family member N in this species is a protein that mainly functions in lipid hydrolysis; at the same time, many other similar sequences are also related to lipid hydrolysis.

[0070] Fermentation culture of Schizochytrium mutant strain △LIP1

[0071] Seed culture of vigorous and uncontaminated wild-type and mutant strains was selected by microscopic observation and passaged to ensure that Schizochytrium was in a good and healthy growth state.

[0072] Seed cultures of wild-type and mutant strains with good growth and no contamination were selected for fermentation. 1L of fermentation medium contained the following components: 100 g glucose, 5 g yeast extract, 1.43 g MgSO4, 1 g KH2PO4, 0.5 g (NH4)2SO4, 0.264 g KCl, 0.04 g CaCl2, 0.001 g vitamin B1, and 0.001 g vitamin B2. 12 Add the seed culture to the fermentation medium, and inoculate with the seed culture at a volume of 2.5% of the medium volume.

[0073] The biomass change curve of the cultured strain is as follows: Figure 4 As shown, the dry weight and total fatty acid content of cells cultured for 72 hours are as follows: Figure 5 As shown in the figure. The above experiments conclude that, compared to the wild type, except for a slower initial growth rate in the mutant strain △LIP1, it did not significantly affect the growth of *Schizochytrium*. Furthermore, both the wild type and the mutant strain △LIP1 reached the exponential growth phase at 72 h. Therefore, cells at 72 h were selected for subsequent determination of cell dry weight and total fatty acid content, and the results are shown in the figure. Figure 5 As shown, the biomass of strain △LIP1 was only slightly lower than that of the wild-type strain, but the total fatty acid content increased from 65.89% in the wild-type to 71.81%.

[0074] Fatty acid composition analysis of the Schizochytrium mutant strain △LIP1

[0075] Oil extraction was performed on *Schizochytrium* cultured for 72 h using the following method:

[0076] 40 ml of the fermentation broth in the fermentation medium was collected in a centrifuge tube, centrifuged at 8000 ×g for 5 min, and the supernatant was discarded. 10 ml of 50% (v / v) HCl was added to the centrifuge tube, and the mixture was acid-hydrolyzed at 80 °C for 4 h. Then, 8 ml of extraction buffer (methanol:chloroform = 1:1) was added, and the mixture was inverted to ensure complete extraction. The mixture was transferred to a shaker and centrifuged for 20 min. 50% (v / v) of 0.1 M NaCl solution was added, the mixture was vortexed, and centrifuged at 8000 ×g for 5 min. The lower layer was transferred to a flask and evaporated to dryness using a rotary evaporator at 80 °C. The weight of the produced oil could then be determined.

[0077] The oil was then methylated and analyzed for its fatty acid composition using gas chromatography-mass spectrometry (GC-MS) with a ThermoScientific™ TRACE™ ISQ QD300 instrument. Figure 6 and Figure 7 As shown, the △LIP1 strain has roughly the same types of fatty acids as the WT strain. Among them, DHA (C22:6), docosapentaenoic acid (DPA, C22:5), palmitic acid (C16:0), and myristic acid (C14:0) have the highest proportions. Compared with the WT strain, the proportion of palmitic acid (C16:0), the most important saturated fatty acid, in the △LIP1 strain decreased by 6.78%, while the proportion of DHA increased by 8.15%. Compared with the wild type, the DHA content increased by 21.8%, which is a significant improvement.

[0078] Schizochytrium lipase LIP1 Genes in lipolysin (Yarlion) Yarrowia lipolytica) Location analysis in

[0079] Through Yarrowia lipolytica Lipase expressed in Po1f LIP1 The gene was analyzed for subcellular localization to verify its association with lipid droplet formation and lipid accumulation. The specific steps are as follows:

[0080] (1) Construction of recombinant plasmid 1312-GFP-LIP1

[0081] Using the genome of *Schizochytrium ATCC 20888* as a template, PCR amplification was performed using primer pairs PLIP1-F and PLIP1-R to obtain the LIP1 DNA fragment. The primer sequences of PLIP1-F and PLIP1-R are shown below:

[0082] PLIP1-F:GTGGGAACCCGAAAACTAAGATGCCGCGCGGAGCCGCC;

[0083] PLIP1-R:GGATCTGCTTGCTCACCATGTCTAGACACTTCGGACGAGGA.

[0084] Using the 1312-GFP plasmid as a backbone, the 1312-GFP was digested with the restriction enzyme BamHI, and the linearized vector was obtained by gel recovery. Seamless cloning was performed using ABclonal's 2×MultiF Seamless Assembly Mix. LIP1 The gene was inserted into the vector, and the correct recombinant plasmid was obtained by sequencing the E. coli transformants. The bacteria were then preserved for later use. At this point, the construction of recombinant plasmid 1312-GFP-LIP1 was completed. (The seamless cloning steps are the same as in Example 1).

[0085] After the recombinant plasmid 1312-GFP-LIP1 was prepared, it was digested with the restriction enzyme Not I, and then the target fragment was recovered by gel extraction and stored at -20 ℃ for later use.

[0086] (1) LIP1 Genes in Yarrowia lipolytica Expressions in Po1f

[0087] ① First activate Yarrowia lipolytica strain Po1f was streaked onto YPD agar plates and cultured at 28 ºC for 2 days. Single colonies were picked from the YPD agar plates and transferred to 5.0 mL YPD liquid culture tubes, and cultured at 28 ºC and 200 rpm for 2 days.

[0088] ② The bacterial concentration in the test tube reaches 5×10⁻⁶. 6 After reaching a cell concentration of 2 × 10⁶ cells / ml, 2.5 mL of the culture was inoculated into a 50.0 mL YPD medium shake flask (28 ºC, 200 rpm, 5 h) to achieve a cell concentration of 2 × 10⁶ cells / ml. 7 cells / mL;

[0089] ③ Examine the bacterial suspension under a microscope. Select a healthy bacterial suspension free from contamination. Centrifuge 35 mL of the suspension at 3000 rpm for 5 min, discard the supernatant, add 30.0 mL of TE buffer to the cell pellet to suspend the cells, centrifuge at 3000 rpm for 5 min, and discard the supernatant. Add another 30.0 mL of TE buffer to the cell pellet, centrifuge at 3000 rpm for 5 min, and discard the supernatant.

[0090] ④ Add 30.0 mL of 0.1 M lithium acetate solution to the cell pellet, centrifuge at 3000 rpm for 5 min, and discard the supernatant;

[0091] ⑤ Add 1.0 mL of 0.1 M lithium acetate solution to the bacterial precipitate, mix well by pipetting, transfer to a 1.5 mL centrifuge tube, incubate in a 28 ºC water bath for 1 h, centrifuge at 3000 rpm for 5 min after the water bath, and discard the supernatant;

[0092] ⑥ Add 400.0 µL of 0.1 M lithium acetate solution to the bacterial cells and gently mix by pipetting. Yarrowia lipolytica Po1f competent cells have been successfully prepared.

[0093] ⑦ Boil 1.0 mL of fish sperm DNA sample in boiling water for 5 min beforehand, and immediately place it in ice to cool to room temperature; take 100.0 µL of the above-mentioned competent cells of Yeast Extract, add 15.0 µL of fish sperm DNA and 15.0 µL of the target DNA fragment to be transformed, and add only competent cells to the control group. Incubate in a water bath at 28 ºC for 15 min.

[0094] ⑧ After the water bath, add 350.0 µL of 50% (w / v) PEG 4000 (dissolved in 0.1 M lithium acetate solution) filtered with a sterile filter tip and 16.0 µL of 1 M DDT, and incubate in a water bath at 28 ºC for 1 h;

[0095] ⑨ Add 40.0 µL of DMSO dropwise, mix slowly by pipetting, and incubate in a 39 ºC water bath for 10 min; add 600.0 µL of 0.1 M lithium acetate solution, mix slowly by pipetting, centrifuge at 4000 rpm for 2 min, discard 550.0 µL of supernatant, and gently mix the remaining bacterial culture.

[0096] ⑩ will Yarrowia lipolytica Po1f solution was diluted to different concentration gradients and spread onto YNB solid plates (with leucine solution added). The plates were incubated at 28 ºC for 3-5 days, and the colony growth status was observed.

[0097] Verification: Single colonies grown on YNB plates after transformation were inoculated into liquid culture medium tubes and incubated at 180 rpm, 28 ºC for 1–2 days. Cells were then collected at 12,000 rpm for 1 min. Yeast genomic DNA was extracted using a yeast genomic DNA extraction kit. PCR was performed on the DNA using PLIP1-F and PLIP1-R primers. Agarose gel electrophoresis showed no band for Po1f and the transformant fragment size was correct, confirming the transformation. Yarrowia lipolytica Po1f conversion LIP1 The gene was successful.

[0098] The successfully transformed Po1f cells were inoculated into shake flasks and cultured at 180 rpm and 28 ℃ for 3 days. Microscopic examination showed no contamination. 1.0 mL of the bacterial suspension was centrifuged at 4000 rpm for 5 min, and the cells were resuspended in sterile water. The cells were then observed under 488 nm excitation light using a laser confocal fluorescence microscope. LIP1 Subcellular localization of genes in yeast cells. Figure 8 The results showed that the wild type did not have the localization of green fluorescent protein, while the PLIP1 transformant showed obvious fluorescence and was localized on the lipid droplets of the Po1f strain. This suggests that the protein may play an important role in the formation of lipid droplets and lipid metabolism within them.

[0099] Sequence SEQ ID NO:1:

[0100]

[0101] Sequential SEQ ID NO:2:

[0102]

[0103] Sequential SEQ ID NO:3:

[0104]

[0105] Sequence SEQ ID NO:4:

[0106]

[0107] Sequence SEQ ID NO:5:

[0108] TTAGGCGTCGTCCTGGGCGCCCGAAAACCAGTACCAGTACATGGCGGTCTCGTTGGAGACCTGGGGGCGGGTCTTGTAGGTAAAGAGGTCGATGCCGCCGAGGGTAAAGCCGCACTTGGCGTAGAGGTTGCAGGCGGGGACGTTGTTGGTCTGGGTCTCGAGGCGGATGCCGAGGAGCTGGCGCGAGAGGGCCCACTTCTTGGCAAACTCGATGAGCGAGTGGGCGACGCCCTTGCCGCGGTGGGTGTGGCTCACCACGATGTGCTCGATGCTGGCGAGGTCGTTCCAGGTGGAGTTGAGCTCGATCTTGCCCACGAGCTCCTGGTCGATGAAGGCGCCGTAGCAGGCCGAGTCCTCGTCCGAGTCGTCGTCCGAGATGTAGTCCTTGCGGTAGGGCGAGACCGAGCGGGTCGAGAGCTCAAAGCCCTGGTCCGAGAGGTGGACGTCAAACACCTCGCGGACGATAAAGTGGTTCTCGGCGTCGAGGGTCTCGGCGACCTGCTCGGGGATGACCGAGATCTTCAT。

[0109] Sequence SEQ ID NO:6:

[0110] .

[0111] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0112] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for increasing the DHA content of microorganisms, characterized in that, Knockout of lipase-encoding proteins in microbial lipodroplets using homologous recombination technology LIP1 Genes, the ones mentioned LIP1 The amino acid sequence of the lipase encoded by the gene is shown in SEQ ID NO:

1. LIP1 The nucleotide sequence of the gene is shown in SEQ ID NO:2; the microorganism is Schizochytrium.

2. The method for increasing the DHA content of microorganisms according to claim 1, characterized in that, Specifically, the following steps are included: Step 1: Construct homologous recombination vectors; Step 2: Electroporate the homologous recombination vector into the microbial protoplast; Step 3: Incubate in GPY medium containing norhizin; Step 4: The gene knockout was confirmed to be successful by PCR amplification and analysis of fatty acid composition after fermentation culture.

3. The method for increasing the DHA content of microorganisms according to claim 2, characterized in that, In step 3, the concentration of norsinolate in the GPY culture medium is 80-120 μg / mL.

4. The method for increasing the DHA content of microorganisms according to claim 2, characterized in that, The homologous recombination vector contains an upstream homologous arm, a downstream homologous arm, and a norsinoxin resistance gene located between them. The nucleotide sequence of the upstream homologous arm is shown in SEQ ID NO:3; the nucleotide sequence of the downstream homologous arm is shown in SEQ ID NO:4; and the nucleotide sequence of the norsinosin resistance gene is shown in SEQ ID NO:

5.

5. The method for increasing the DHA content of microorganisms according to claim 4, characterized in that, The lengths of both the upstream and downstream homologous arms are 1.0 kb to 1.5 kb.

6. A recombinant vector, characterized in that, It includes the upstream homologous arm shown in sequence SEQ ID NO:3, the downstream homologous arm shown in sequence SEQ ID NO:4, and the norsinoxin resistance gene shown in sequence SEQ ID NO:

5.

7. A recombinant Schizochytrium mutant, characterized in that, Its genome encodes lipases with amino acid sequences as shown in SEQ ID NO:

1. LIP1 The gene is inactivated or knocked out.

8. The application of the recombinant Schizochytrium mutant as described in claim 7 in the production of DHA.