A logic gate fluorescent probe for simultaneously detecting pH and potassium ions, and a preparation method and application thereof

CN121320334BActive Publication Date: 2026-09-22SHENZHEN TECH UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511472149.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-15
Publication Date
2026-09-22
Estimated Expiration
2045-10-15

AI Technical Summary

Technical Problem

[0004]为了解决上述探针特异性低、容易造成假阳性的技术问题,本发明提供了一种同时检测pH和钾离子的逻辑门荧光探针及其制备方法与应用

Benefits of technology

(1)本发明提供了一种荧光探针,由SEQ ID NO.1~SEQ ID NO.5所示的DNA单链混合杂交而成镊子型纳米结构。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320334B_ABST
    Figure CN121320334B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of fluorescent nanomaterials, and particularly relates to a logic gate fluorescent probe for simultaneously detecting pH and potassium ions, and a preparation method and application thereof. The fluorescent probe comprises sequences shown in SEQ ID NO. 1 to SEQ ID NO. 5, and is formed into a fluorescent probe with a tweezers type nanostructure through base complementary pairing and hybridization. In the case that both weak acidic pH and high potassium ion concentration exist simultaneously, the fluorescent probe is completely folded, has a clear fluorescence resonance energy transfer effect, and emits clear red fluorescence. The DNA tweezers fluorescent probe of the present application has a simple synthesis method, and has higher specificity and accuracy in imaging in a weak acid high potassium tumor cell environment, and will have great application potential in the diagnosis of tumors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of fluorescent nanomaterials technology, specifically relating to a logic gate fluorescent probe for simultaneous detection of pH and potassium ions, its preparation method, and its application. Background Technology

[0002] Generally, cancer is characterized by rapid spread and evasion of the immune system's defenses. The underlying causes of cancer spread may be closely related to the high concentration of potassium ions and the highly acidic microenvironment outside tumor cells: an excessively high extracellular potassium ion concentration of approximately 40 mM to 50 mM can trigger functional thermoregulation of T cells, thereby suppressing T cell immune function; an excessively high extracellular acid concentration, with a pH of approximately 6.4–7.0, can lead to cellular acidosis, causing macrophage dysfunction and allowing the tumor to evade cellular immune responses. Simultaneously, acidosis can affect gene expression, making tumors more invasive and drug-resistant. The potassium ion concentration in normal tissues is approximately 5 mM, and the pH is approximately 7.4.

[0003] Due to the complexity of organisms, some pathological tissues other than tumor tissues, such as inflammatory tissues, also exhibit certain characteristics similar to tumor tissues, including weak acidity and high expression of certain enzymes. Current technologies use single-response probes, which may simultaneously image inflammatory tissues and cells when imaging tumor tissues and cells, resulting in low imaging specificity and a high risk of false positives. Therefore, there is a strong need to develop imaging probes with high specificity for tumor tissues and cells. Summary of the Invention

[0004] To address the technical problems of low probe specificity and susceptibility to false positives, this invention provides a logic gate fluorescent probe for simultaneous detection of pH and potassium ions, along with its preparation method and application.

[0005] Furthermore, the fluorescent probe includes the sequences shown in SEQ ID NO.1 to SEQ ID NO.5.

[0006] Further, the DNA single strands shown in SEQ ID NO.1 to SEQ ID NO.5 are mixed in a buffer solution, hybridized, and then annealed to obtain the fluorescent probe.

[0007] Furthermore, the buffer solution is a MOPSO buffer solution; The MOPSO buffer solution is formulated as follows: 10 mM 3-(N-morpholino)-2-hydroxypropanesulfonic acid, 140 mM NaCl, 1 mM MgCl2, 1.2 mM CaCl2, with water as the solvent.

[0008] Furthermore, the pH of the MOPSO buffer solution is 7.4.

[0009] Furthermore, the molar ratio of the DNA single strands is SEQ ID NO.1:SEQ ID NO.2:SEQ ID NO.3:SEQ ID NO.4:SEQ ID NO.5 = 1:1:1:1:2.

[0010] Furthermore, the procedure for post-hybridization annealing is as follows: Hold at 90 °C for 5 min, then cool to 20 °C at a rate of 1 °C / min.

[0011] Furthermore, the application of the fluorescent probe includes at least one of the following: 1) Application in the preparation of tumor cell imaging products; 2) Applications in the preparation of products for diagnosing cancer and / or predicting cancer prognosis.

[0012] Furthermore, the cancer in question is esophageal cancer.

[0013] Furthermore, the application of the fluorescent probe refers to tumor cell imaging in an environment with a pH of 6.4-7.0 and a potassium ion concentration of 40 mM-50 mM.

[0014] The principle of this invention is as follows: DNA logic gates are a class of molecular logic gates that use nucleic acids as basic reaction units. They output readable signals through interactions with input substances, and then use threshold values ​​to determine the truth or falsehood of the output signal, thus achieving logical operations. Logic gates use "1" to represent a "true value" or "high-level signal," and "0" to represent a "false value" or "low-level signal." The input and output of DNA logic gates are highly flexible; single-stranded DNA, ions, small molecules, proteins, and cells, as well as physical stimuli such as sound, light, and electricity, can all serve as inputs. The output is generally quantifiable data, such as concentration and quantity, fluorescence intensity, voltage, and current. AND, OR, and NOT gates are the foundation of all logical computations; even the most complex logic gates and circuits can be implemented through combinations of these three gates. Fluorescent probes based on DNA logic gates are intelligent sensing tools that combine the computational capabilities of DNA molecules with fluorescence signal output. They trigger the generation or quenching of fluorescence signals through the specific reactions of DNA logic gates, achieving highly sensitive and selective detection of target molecules such as nucleic acids, proteins, and small molecules. In this invention, we designed and prepared a material that can be fixed on the cell membrane surface and can target the extracellular K+ of cancer cells. + and H + Nanoprobes that respond logically to changes have great potential for improving the accuracy of tumor cell imaging.

[0015] Nature has its own K + and H +Responsive DNA secondary structures include C-quadruplex structures, also known as i-motif structures and G-quadruplex structures. C-quadruplex structures are a class of DNA sequences rich in the cytosine base C, which can form a quadruplex structure under acidic conditions. Under neutral or alkaline conditions, the C-quadruplex structure unwinds to form a naturally extended single-stranded structure. This structure is highly sensitive to pH, exhibiting a rapid and reversible conformational change response to pH variations. Therefore, the C-quadruplex structure can be regulated by controlling minute changes in pH. On the other hand, G-quadruplexes are formed by the self-assembly of DNA or RNA sequences rich in the guanine base G through Hoogsteen hydrogen bonds. The formation and stability of G-quadruplexes are highly dependent on potassium ions; therefore, potassium ions can be utilized... + Induced G4 conformational changes can be used to design DNA nanomachines or ion sensors.

[0016] In this invention, we construct a dynamic DNA tweezer nanostructure using the complementary base pairing principle of DNA. This DNA tweezer nanostructure is a molecular machine capable of continuously switching between "on" and "off" states. The C-quadruplex and G-quadruplex sequences provided in this invention serve as the response to H... + and K + The dynamic drive unit of the DNA tweezers comprises three functional elements: a DNA tweezers frame consisting of three single-stranded DNA strands; a sequence for dynamically controlling the "open" and "close" of the DNA tweezers, containing a pH-sensitive C-quadriplex structure and a K-sensitive structure. + The probe consists of a sensitive G-quadruplex; a pair of FRET signals located at the ends of the two arms of the DNA tweezers; and Cy3 and Cy5 fluorescent groups. Changes in the FRET signal between Cy3 and Cy5 are used to reflect the state of the DNA tweezers. By detecting changes in the FRET signal between the Cy3 and Cy5 fluorescent pairs, the state of the dynamic DNA tweezers, as well as the pH and potassium ion concentration of the environment, can be monitored. The probe of this invention uses a weakly acidic pH (6.4–7.0) and a high potassium ion concentration (40 mM–50 mM) as two input signals to construct an AND logic gate. When both input signals are "1", the output signal is "1", enabling highly selective imaging of tumor cells.

[0017] Accordingly, the logic gate fluorescent probe for simultaneous detection of pH and potassium ions provided by the present invention consists of five sequences: SEQ ID NO.1 to SEQ ID NO.5.

[0018] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention provides a fluorescent probe, which is a tweezer-type nanostructure formed by hybridization of DNA single strands shown in SEQ ID NO.1~SEQ ID NO.5.

[0019] (2) The fluorescent probe designed in this invention has the ability to simultaneously detect pH and K. + The fluorescent probe can only fully fold its structure when both weak acidity and high potassium ion concentration are simultaneously met, thus ensuring the specificity of the imaging.

[0020] (3) Compared with other fluorescent probes that require complex chemical synthesis or material preparation processes, the synthesis method of the present invention is simple. Attached Figure Description

[0021] Figure 1 In the diagram, a is a schematic diagram of the structural transformation of the fluorescent probe; b is the truth table corresponding to the schematic diagram.

[0022] Figure 2 This diagram illustrates the mechanism of action of the fluorescent probe and four different input and output scenarios.

[0023] Figure 3 In the diagram, a is a schematic diagram of the components of the fluorescent probe, and b is a detailed structural schematic diagram of the C quadruplex and G quadruplex; the arrows for each DNA strand indicate the 5' to 3' direction of the DNA.

[0024] Figure 4 The diagram shows the assembly and identification of fluorescent probes; a is a schematic diagram of the assembly process of DNA tweezers and fluorescent probes; b is a polyacrylamide gel electrophoresis, where lanes ① to ⑤ represent different DNA structures, and the rightmost lane represents the marker.

[0025] Figure 5The following graphs illustrate the results of validating the response of a DNA tweezers logic gate fluorescent probe to weakly acidic pH and potassium ions in solution: a) Fluorescence emission spectrum measured at pH = 6.4 and potassium ion concentrations of 0 mM–50 mM; b) Fluorescence emission spectrum measured at pH = 6.6 and potassium ion concentrations of 0 mM–50 mM; c) Fluorescence emission spectrum measured at pH = 6.8 and potassium ion concentrations of 0 mM–50 mM; d) Fluorescence emission spectrum measured at pH = 7.0 and potassium ion concentrations of 0 mM–50 mM; e) Fluorescence emission spectrum measured at pH = 7.4 and potassium ion concentrations of 0 mM–50 mM; f) Curves showing the relationship between the A / D ratio obtained from a, b, c, d, and e and the potassium ion concentration; g) Graphs showing the potassium ion concentrations extracted from f at 5 mM, 40 mM, and 50 mM, respectively. The graph shows the relationship between the A / D ratio and pH and potassium ion concentration under the condition of mM. In the graph, the logic gate output is "1" in the orange-red area and "0" in the blue area. h is a heatmap of the A / D ratio when the threshold is set to 1.5. A is the first letter of Acceptor, representing the emission intensity of Cy5 at a wavelength of 670 nm. D is the first letter of Donor, representing the emission intensity of Cy3 at a wavelength of 565 nm.

[0026] Figure 6 The images show the results of imaging the fluorescent probe on the surface of ECA-109 cell membranes. Input 1 represents a pH range of 6.4–7.0; that is, Input 1 = 1 when the experimental conditions are pH 6.4–7.0, and Input 1 = 0 when the experimental conditions are pH 7.4. Input 2 represents a potassium ion concentration of 40 mM–50 mM; that is, Input 2 = 1 when the experimental conditions are potassium ion concentration of 40 mM–50 mM, and Input 2 = 0 when the experimental conditions are potassium ion concentration of 5 mM. The figures in the table are confocal fluorescence images after anchoring the DNA tweezers fluorescent probe to the surface of the ECA-109 cell membrane and incubating it under the corresponding conditions; Bright field indicates bright field; Cy3 indicates the Cy3 fluorescence channel; FRET indicates the FRET fluorescence channel; Merge indicates a combined image of Cy3 and FRET. The wavelength range of the Cy3 channel is 550 nm to 600 nm, and the wavelength range of the FRET channel is 690 nm to 720 nm.

[0027] Figure 7 The graph shows the response of the fluorescent probe in Comparative Example 1 to weakly acidic pH and potassium ions; a shows the difference between the G quadruple sequence in this comparative example and the example; b refers to... Figure 5 c (refer to) Figure 5 ;d reference Figure 5 e reference Figure 5 ;f reference Figure 5 ;g reference Figure 5 h reference Figure 5 .

[0028] Figure 8 Figure a shows the response of the fluorescent probe in Comparative Example 2 to weakly acidic pH and potassium ions; Figure a illustrates the difference between the G-quadruplex sequence in this comparative example and the example; Figure b refers to... Figure 5 c (refer to) Figure 5 ;d reference Figure 5 e reference Figure 5 ;f reference Figure 5 ;g reference Figure 5 h reference Figure 5 .

[0029] Figure 9 Figure a shows the response of the fluorescent probe in Comparative Example 3 to weakly acidic pH and potassium ions; Figure a illustrates the difference between the G-quadruplex sequence in this comparative example and the example; Figure b refers to... Figure 5 c (refer to) Figure 5 ;d reference Figure 5 e reference Figure 5 ;f reference Figure 5 ;g reference Figure 5 h reference Figure 5 . Detailed Implementation

[0030] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0031] The inventive concept of this invention is as follows: This invention designs five DNA single strands, forming a fluorescent probe with a tweezer-like nanostructure through base complementary pairing. SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.4 constitute the DNA tweezer framework; SEQ ID NO.3 contains sequences forming C-quadruplexes and G-quadruplexes; and SEQ ID NO.5 contains cholesterol molecules capable of anchoring to the cell membrane, such as… Figure 1 As shown. The DNA tweezers fluorescent probe of the present invention contains nucleic acid structures that are specifically responsive to pH and potassium ions: a C-quadruplex structure and a G-quadruplex structure.

[0032] The DNA tweezers fluorescent probe designed in this invention features a C-rich single-stranded DNA sequence folding to form a C-quadruplex, and a G-rich sequence folding to form a G-quadruplex. This brings the two "handles" of the DNA tweezers closer together, causing the Cy3 and Cy5 fluorescent pairs at the two ends to approach each other, emitting a strong FRET signal, i.e., an output signal of "1". When both weakly acidic pH and high potassium ion concentration are absent, or only one of them is present, the spatial distance between the Cy3 and Cy5 fluorescent molecules at the two ends of the DNA tweezers is too large to produce a strong FRET signal, i.e., an output signal of "0". Figure 1 and Figure 2 As shown.

[0033] The efficiency of FRET is highly dependent on the distance between the donor and acceptor. When the distance between the donor and acceptor is shortened to less than 10 nm, the energy transfer efficiency increases dramatically. Under the simultaneous stimulation of the tumor microenvironment's weakly acidic pH and high potassium ion concentration, the two fluorescent groups Cy5 and Cy3 on the logic gate fluorescent probe of the DNA tweezers decrease in spatial distance after the DNA tweezers are fully folded, resulting in a significant fluorescence resonance energy transfer effect and emitting obvious red fluorescence, thereby achieving specific and accurate imaging of tumor cells.

[0034] Key terms and abbreviations are as follows: Cholesteryl: cholesterol.

[0035] FRET: Fluorescence resonance energy transfer effect.

[0036] MOPSO: 3-(N-morpholino)-2-hydroxypropanesulfonic acid The technical solution of the present invention will be further studied using the following embodiments.

[0037] Example 1: 1. Lyophilized powders of five single-stranded DNA molecules (S1, S2, S3, S4, and S5) that make up the DNA tweezers were prepared by Sangon Biotech Shanghai Co., Ltd. Their corresponding base sequences and modifications are shown in Table 1. Figure 3 As shown, five DNA single strands were used to prepare 100 μM stock solutions using double-distilled water.

[0038] Table 1. Sequences and descriptions of the fluorescent probes Note: In Table 1, sequences with a single or double underline represent the main skeleton sequences.

[0039] 2. Synthesis of fluorescent probes.

[0040] Take 2 μL of S1 stock solution, 2 μL of S2 stock solution, 2 μL of S3 stock solution, 2 μL of S4 stock solution, and 4 μL of S5 stock solution respectively, and add them to 88 μL of 3-(N-morpholino)-2-hydroxypropanesulfonic acid (MOPSO) buffer solution. Mix thoroughly to achieve a final molar ratio of S1:S2:S3:S4:S5 of 1:1:1:1:2 to ensure correct assembly of the DNA tweezers fluorescent probe. The MOPSO buffer solution is formulated as follows: 10 mM 3-(N-morpholino)-2-hydroxypropanesulfonic acid, 140 mM NaCl, 1 mM MgCl2, 1.2 mM CaCl2, pH 7.4.

[0041] Annealing hybridization was performed in a PCR instrument. The annealing program was as follows: first, hold at 90 °C for 5 min, then cool down to 20 °C at a rate of 1 °C / min. The mixture was then placed in a 200 μL PCR tube, vortexed, and then subjected to programmed annealing hybridization in the PCR instrument to obtain 100 μL of 2 μM DNA tweezer fluorescent probe.

[0042] Example 2 The application of a DNA tweezers logic gate fluorescent probe is as follows: 1. Polyacrylamide gel electrophoresis was used to verify the successful synthesis of the DNA tweezers fluorescent probe.

[0043] (1) Preparation of experimental materials.

[0044] Group ①: DNA containing only S1.

[0045] Group ②: DNA structure obtained after hybridization of S1 and S4.

[0046] Group ③: DNA structures obtained after hybridization of S1, S3 and S4.

[0047] Group ④: DNA structures obtained after hybridization of S1, S2, S3 and S4.

[0048] Group ⑤: DNA tweezers fluorescent probe prepared in Example 1.

[0049] Groups ① to ④ served as control groups. The only difference between them and the DNA tweezers fluorescent probes in Example 1 was the composition of the raw material single strands. All groups were prepared according to the method in Example 1, with any missing parts supplemented by buffer solution, and were prepared using the hybridization annealing procedure in Example 1.

[0050] (2) The experimental materials prepared above were separated and analyzed by electrophoresis in a non-denaturing polyacrylamide gel.

[0051] Electrophoresis was performed at a constant voltage of 140V for 50 minutes in 1×TBE buffer. After electrophoresis, the gel was placed in the light-proof gel dye GelRed and stained with low-speed shaking for 10 minutes. Finally, it was imaged using a Bio-Rad Gel-Doc gel imaging system.

[0052] The results are as follows Figure 4 As shown, based on the principle of nucleic acid gel electrophoresis, the smaller the molecular weight, the faster the migration. Therefore, the migration rates are in the following order: Group ① > Group ② > Group ③ > Group ④ > Group ⑤. It can be seen that by sequentially increasing the number of DNA single strands constituting the DNA tweezers fluorescent probe, the migration rate of the product decreases, indicating the successful assembly of the DNA tweezers fluorescent probe described in this invention.

[0053] 2. Investigate the response of the DNA tweezers fluorescent probe in solution to weakly acidic pH and potassium ions.

[0054] Experimental materials: DNA tweezers fluorescent probes with a concentration of 0.1 μM prepared in Example 1.

[0055] Experiments were conducted using pH and potassium ions as two variables. Solutions with different potassium ion concentrations and pH values ​​of 6.4, 6.6, 6.8, 7.0, and 7.4 were prepared, with potassium ion concentrations of 0 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, and 50 mM, respectively.

[0056] The DNA tweezers fluorescent probe was incubated in the prepared solution at 37°C for 1 hour, and then the fluorescence spectrum was measured at room temperature. The excitation wavelength was 530 nm, and the emission wavelength was 550 nm to 750 nm. The excitation bandwidth was 5 nm, and the emission bandwidth was 5 nm.

[0057] The results are as follows Figure 5 As shown, with the potassium ion concentration gradually increasing from 0 mM to 50 mM, the emission peak of Cy5 at the 650 nm to 700 nm wavelength range of the DNA tweezers fluorescent probe significantly increased within the pH range of 6.4–7.0; however, at pH 7.4, the emission peak of Cy5 remained almost unchanged. This indicates that only under the simultaneous presence of weakly acidic conditions and high potassium ion concentrations can the G-quadruplex and C-quadruplex in the middle of the DNA tweezers fold together, allowing the Cy3 and Cy5 at the ends of the DNA tweezers to approach and trigger the FRET effect, i.e., enhancing the emission of Cy5. At pH 7.4, even increasing the potassium ion concentration to 50 mM did not produce a significant FRET effect.

[0058] The emission intensity at 670 nm in each emission spectrum is taken as the A value, and the emission intensity at 565 nm in each emission spectrum is taken as the D value. The ratio of A to D, i.e., the A / D value, is calculated. The A / D value reflects the strength of the FRET effect; the larger the A / D value, the stronger the FRET effect. A graph showing the relationship between the A / D value and potassium ion concentration is shown below. Figure 5 The results shown in f clearly demonstrate the variation of the FRET effect with potassium ion concentration under different pH conditions. Figure 5 g is from Figure 5 The graph shows the relationship between the A / D ratio and pH and potassium ion concentration under conditions of 5 mM, 40 mM, and 50 mM potassium ion extraction. The graph clearly shows the logic gate threshold setting range, i.e., 1.13-2.11. The red data points in the graph represent the A / D values ​​of the DNA tweezers fluorescent probe under conditions of pH 6.4-7.0 and potassium ion concentrations of 40 mM-50 mM, which are higher than the A / D values ​​under other conditions. These results indicate that the DNA tweezers fluorescent probe prepared in this invention simultaneously exhibits responsiveness to both weakly acidic pH and high potassium ion concentrations, and can induce the FRET effect and emit strong Cy5 fluorescence under specific conditions where both factors are simultaneously satisfied. Furthermore, the threshold setting range is very wide, indicating that this probe is a high-performance logic gate probe. For example, by setting the threshold at an A / D value of 1.5, from... Figure 5 The h indicator clearly shows the output signals as "0" and "1". The orange-red portion represents an output signal of "1", and the blue portion represents an output signal of "0". The difference between the two cases is significant and immediately apparent, demonstrating the excellent logic gate probe performance of this probe.

[0059] 3. Investigate the logic gate output performance of the DNA tweezers logic gate fluorescent probe on the cell membrane surface.

[0060] ECA109 cells were cultured in RPMI 1640 medium containing 10% inactivated fetal bovine serum, 100 U / mL penicillin, and 100 ng / mL streptomycin at 37 °C and 5% CO2. Esophageal cancer cells (ECA109 cells / mL) were seeded in 35 mm confocal dishes and cultured for 24 h. The medium was then aspirated, and the cells were washed three times with PBS.

[0061] DNA tweezers fluorescent probes were added to MOPSO solution to prepare a 0.5 μM DNA tweezers fluorescent probe solution. 0.5 mL of the DNA tweezers fluorescent probe solution was added to 9 confocal dishes containing cells and incubated at room temperature for 10 min to anchor the DNA tweezers fluorescent probes to the cell membrane surface.

[0062] Nine solutions were prepared simultaneously, namely: (1) A MOPSO buffer solution with pH 6.4 containing 5 mM KCl.

[0063] (2) A MOPSO buffer solution with pH 6.4 containing 40 mM KCl.

[0064] (3) MOPSO buffer solution with pH 6.4 containing 50 mM KCl.

[0065] (4) MOPSO buffer solution with pH 7.0 containing 5 mM KCl.

[0066] (5) MOPSO buffer solution with pH 7.0 containing 40 mM KCl.

[0067] (6) MOPSO buffer solution with pH 7.0 containing 50 mM KCl.

[0068] (7) MOPSO buffer solution with pH 7.4 containing 5 mM KCl.

[0069] (8) A MOPSO buffer solution with pH 7.4 containing 40 mM KCl.

[0070] (9) A MOPSO buffer solution with pH 7.4 containing 50 mM KCl.

[0071] Excess solution was removed from the nine confocal dishes, and the four solutions prepared above were added to the nine confocal dishes respectively. The dishes were incubated at 37°C for 20 min. The samples were imaged using a laser confocal scanning microscope. The emission signals of Cy3 and FRET were continuously excited and collected using a 488 nm laser. The wavelength range of the Cy3 channel was 550–600 nm, and the wavelength range of the FRET channel was 690–720 nm.

[0072] According to the structure of the DNA tweezers fluorescent probe designed according to the present invention, the FRET channel can only emit obvious fluorescence when both Input 1 and Input 2 are "1". Input 1 represents a pH of 6.4~7.0, and Input 2 represents a potassium ion concentration of 40 mM~50 mM. The FRET channel can only emit obvious fluorescence when the experimental conditions of pH 6.4~7.0 and potassium ion concentration of 40 mM~50 mM are met simultaneously. Among the nine solutions designed above, (2), (3), (5), and (6) simultaneously meet the requirements of pH 6.4~7.0 and potassium ion concentration of 40 mM~50 mM.

[0073] Experimental results are as follows Figure 6As shown. Among the nine solutions, only the FRET channels in solutions (2), (3), (5), and (6) emitted obvious fluorescence, and the output was considered to be "1". Under the other conditions, the FRET channels did not emit obvious fluorescence, and the output was considered to be "0". This experimental result is consistent with the original design of the present invention, indicating that the DNA tweezers fluorescent probe prepared by the present invention has responsiveness to both weak acid pH and high potassium ion concentration, and can induce the FRET effect and emit strong Cy5 fluorescence in the presence of both factors. This indicates that the DNA tweezers fluorescent probe prepared by the present invention can specifically image cancer cells in the tumor microenvironment under weak acid pH and high potassium ion concentration conditions.

[0074] Comparative Example 1: The application of a DNA tweezers logic gate fluorescent probe is as follows: 1. Sequence design and preparation of DNA tweezers The only difference between the DNA tweezers used in this comparative example and the DNA tweezers in Example 1 is the G quadruple sequence of SEQ ID NO. 3 (the double-underlined sequence in Table 1). The G quadruple sequence used in this comparative example is GGGTTTTTGGGTTTGGGTTTTTGGG, SEQ ID NO. 6, which is the original sequence of Example 1 with two added T nucleotides. By adding T nucleotides, the stability of the G quadruple can be reduced. Therefore, we plan to examine the change in the responsiveness of the DNA tweezers constructed with this new sequence to weakly acidic pH and potassium ions in this comparative example compared to the responsiveness in Example 2. The preparation method of the DNA tweezers in this comparative example is exactly the same as that in Example 1, and therefore will not be described again.

[0075] 2. Investigate the response of the DNA tweezers fluorescent probe in solution to weakly acidic pH and potassium ions.

[0076] Experimental materials: DNA tweezers fluorescent probes with a concentration of 0.1 μM, composed of the new sequence and prepared according to the method in Example 1.

[0077] Experiments were conducted using pH and potassium ions as two variables. Solutions with different potassium ion concentrations and pH values ​​of 6.4, 6.6, 6.8, 7.0, and 7.4 were prepared, with potassium ion concentrations of 0 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, and 50 mM, respectively.

[0078] The DNA tweezers fluorescent probe was incubated in the prepared solution at 37°C for 1 h, and then the fluorescence spectrum was measured at room temperature. The excitation wavelength was 530 nm, and the emission wavelength was 550 nm to 750 nm. The excitation bandwidth was 5 nm, and the emission bandwidth was 5 nm.

[0079] The results are as follows Figure 7 As shown, compared with Example 2 Figure 5 A comparison of the results shows that with increasing potassium ion concentration, the enhancement of the emission peak at Cy5 in the 650 nm–700 nm wavelength range decreases; especially under pH 7.0 conditions, the increase in the A / D value is relatively low, with a maximum value of only 1.30, while the A / D value is 2.17 under the same conditions in Example 2. This results in a very narrow threshold setting range of 1.02–1.16. Compared to the probe in Example 2, the probe in this comparative example is less practical and may be difficult to distinguish between the output signals "0" and "1" in actual use.

[0080] Comparative Example 2: The application of a DNA tweezers logic gate fluorescent probe is as follows: 1. Sequence design and preparation of DNA tweezers The only difference between the DNA tweezers used in this comparative example and the DNA tweezers in Example 1 is the G quadruple sequence of SEQ ID NO. 3 (the double-underlined sequence in Table 1). The G quadruple sequence used in this comparative example is GGGTTTGGGTTTGGGTTTTGGG, SEQ ID NO. 7, which is the original sequence of Example 1 with one less T nucleotide. Reducing the T nucleotide can improve the stability of the G quadruple, and therefore we plan to examine the changes in the responsiveness of the DNA tweezers constructed with this new sequence to weakly acidic pH and potassium ions compared to the responsiveness in Example 2 in this comparative example. The preparation method of the DNA tweezers in this comparative example is exactly the same as that in Example 1, and therefore will not be described again.

[0081] 2. Investigate the response of the DNA tweezers fluorescent probe in solution to weakly acidic pH and potassium ions.

[0082] Experimental materials: DNA tweezers fluorescent probes with a concentration of 0.1 μM, composed of the new sequence and prepared according to the method in Example 1.

[0083] Experiments were conducted using pH and potassium ions as two variables. Solutions with different potassium ion concentrations and pH values ​​of 6.4, 6.6, 6.8, 7.0, and 7.4 were prepared, with potassium ion concentrations of 0 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, and 50 mM, respectively.

[0084] The DNA tweezers fluorescent probe was incubated in the prepared solution at 37°C for 1 hour, and then the fluorescence spectrum was measured at room temperature. The excitation wavelength was 530 nm, and the emission wavelength was 550 nm to 750 nm. The excitation bandwidth was 5 nm, and the emission bandwidth was 5 nm.

[0085] The results are as follows Figure 8 As shown, compared with Example 2 Figure 5 A comparison of the results shows that, with increasing potassium ion concentration, the enhancement of the emission peak at Cy5 in the 650 nm–700 nm wavelength range is slightly higher than in Example 2; especially under the conditions of pH 7.4 and potassium ion concentration of 40 mM–50 mM, the A / D value increases significantly. On the other hand, under the conditions of potassium ion concentration of 5 mM and pH 6.4–7.0, the A / D value increases significantly, reaching a maximum of 1.77, while the A / D value in Example 2 under the same conditions is 1.12. This results in a narrower threshold setting range of 1.81–2.23. Compared to the probe in Example 2, the probe in this comparative example has relatively poor practicality.

[0086] Comparative Example 3: The application of a DNA tweezers logic gate fluorescent probe is as follows: 1. Sequence design and preparation of DNA tweezers The only difference between the DNA tweezers used in this comparative example and the DNA tweezers in Example 1 is the G quadruple sequence of SEQ ID NO. 3 (the double-underlined sequence in Table 1). The G quadruple sequence used in this comparative example is GGGTTTGGGTTTGGGTTTGGG, SEQ ID NO. 8, which is the original sequence of Example 1 with two fewer T nucleotides. Reducing the number of T nucleotides can improve the stability of the G quadruple, and therefore we plan to examine the changes in the responsiveness of the DNA tweezers constructed with this new sequence to weakly acidic pH and potassium ions compared to the responsiveness in Example 2 in this comparative example. The preparation method of the DNA tweezers in this comparative example is exactly the same as that in Example 1, and therefore will not be described again.

[0087] 2. Investigate the response of the DNA tweezers fluorescent probe in solution to weakly acidic pH and potassium ions.

[0088] Experimental materials: DNA tweezers fluorescent probes with a concentration of 0.1 μM, composed of the new sequence and prepared according to the method in Example 1.

[0089] Experiments were conducted using pH and potassium ions as two variables. Solutions with different potassium ion concentrations and pH values ​​of 6.4, 6.6, 6.8, 7.0, and 7.4 were prepared, with potassium ion concentrations of 0 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, and 50 mM, respectively.

[0090] The DNA tweezers fluorescent probe was incubated in the prepared solution at 37°C for 1 h, and then the fluorescence spectrum was measured at room temperature. The excitation wavelength was 530 nm, and the emission wavelength was 550 nm to 750 nm. The excitation bandwidth was 5 nm, and the emission bandwidth was 5 nm.

[0091] The results are as follows Figure 9 As shown, compared with Example 2 Figure 5 Comparing the results obtained in Example 2 and Example 3, it can be seen that with the increase of potassium ion concentration, the enhancement of the emission peak at Cy5 in the wavelength range of 650 nm to 700 nm is significantly higher than that in Example 2. This indicates that reducing the number of Ts in the G quadruplex sequence does indeed increase the structural stability. However, this leads to an unfavorable consequence: under the conditions of potassium ion concentration of 5 mM and pH of 6.4 to 7.0, the A / D value increases significantly, reaching a maximum of 3.16 ± 0.06. This is very close to the A / D value (3.22 ± 0.09) under the conditions of pH of 7.4 and potassium ion concentration of 40 mM to 50 mM. The upper and lower intervals used to distinguish the "1" and "0" output signals overlap. Figure 9 Since h is not a valid threshold setting range, there is no available threshold setting range. Therefore, this probe is not practical.

[0092] Furthermore, these three comparative examples lead to the conclusion that the sequence SEQ ID NO.3 in the protected embodiments of this invention is not an arbitrary sequence, but rather obtained through detailed screening.

[0093] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. If such modifications and variations fall within the scope of equivalents of this invention, then this invention also intends to include these modifications and variations.

Claims

1. A fluorescent probe for simultaneously detecting pH and potassium ions, characterized in that, It is prepared by hybridization of single-stranded DNA as shown in SEQ ID NO.1 to SEQ ID NO.5; the fluorescent probe is tweezer-type. The nucleotide sequence of SEQ ID NO.1 is shown below: 5'-GCTAGTCAGACTGTGTTTTTGGTCGCTCTTACAAGGCAGCACGGTCGCTGCC-Cy5-3'; The nucleotide sequence of SEQ ID NO.2 is shown below: 5'-Cy3-CGCGTCCTGCCGTCATCCGAAGCATTCCAGGTTTTTGCTAGTCAGACTGTG-3'; The nucleotide sequence of SEQ ID NO.3 is shown below: 5'-GACGGCAGGACGCGTTGGGTTTTGGGTTTGGGTTTTGGGTTCGCCGTCCCCCTTTCCCCCTTTCCCCCTTTCCCTCTCGGCGTTGGCAGCGACCGTGC-3'; The nucleotide sequence of SEQ ID NO.4 is shown below: 5'-TGCCTTTGTAAGAGCGACCAAAAACCTGGAATGCTTCGGAT-3'; The nucleotide sequence of SEQ ID NO.5 is shown below: 5'-Cholesteryl-CACAGTCTGACTAGC-3'-Cholesteryl; The fluorescent probe can generate fluorescent signals in an environment with pH 6.4~7.0 and potassium ion concentration of 40 mM~50 mM.

2. A method for preparing a fluorescent probe for simultaneous detection of pH and potassium ions, characterized in that, The single-stranded DNA shown in SEQ ID NO.1 to SEQ ID NO.5 of claim 1 is mixed in a buffer solution, hybridized, and then annealed to obtain the fluorescent probe.

3. The preparation method according to claim 2, characterized in that, The buffer solution is a MOPSO buffer solution; The MOPSO buffer solution is formulated as follows: 10 mM 3-(N-morpholino)-2-hydroxypropanesulfonic acid, 140 mM NaCl, 1 mM MgCl2, 1.2 mM CaCl2, with water as the solvent.

4. The preparation method according to claim 3, characterized in that, The pH of the MOPSO buffer solution is 7.

4.

5. The preparation method according to claim 2, characterized in that, The molar ratio of the DNA single strands is SEQ ID NO.1:SEQ ID NO.2:SEQ ID NO.3:SEQ ID NO.4:SEQ ID NO.5 = 1:1:1:1:

2.

6. The preparation method according to claim 2, characterized in that, The procedure for post-hybridization annealing is as follows: Hold at 90 °C for 5 min, then cool to 20 °C at a rate of 1 °C / min.

7. The application of the fluorescent probe as described in claim 1, characterized in that, Includes at least one of the following: 1) Application in the preparation of tumor cell imaging products; 2) Use in the preparation of products for diagnosing cancer and / or predicting cancer prognosis; wherein the cancer is esophageal cancer.

8. The application of the fluorescent probe as described in claim 7, characterized in that, Tumor cell imaging refers to tumor cell imaging in an environment with pH 6.4~7.0 and potassium ion concentration of 40 mM~50 mM.

Citation Information

Patent Citations

  • Fluorescent nanoprobe for simultaneously detecting Na+ and K+ based on aptamer as well as preparation method and application of fluorescent nanoprobe

    CN112852822A