An aptamer specifically recognizing a calicheamicin, screening method and application thereof

Abstract

The application provides an aptamer specifically recognizing a phalloidin, a screening method and application, and relates to the technical field of biological detection. The application uses a Capture-SELEX technology in combination with a structured single-stranded DNA library, analyzes candidate aptamers obtained from multiple angles such as thermodynamics, affinity and specificity, successfully screens out a nucleic acid aptamer Apt-PHD with high affinity and high specificity for the phalloidin, and the nucleotide sequence is as shown in SEQ ID NO. 1. The aptamer has the characteristics of high specificity, high affinity, stable structure, easy synthesis and low cost, can be used for rapid detection of the phalloidin in a sample, provides a reliable molecular recognition tool for preparation of a phalloidin detection product, and lays a foundation for subsequent development of a multi-mode detection platform.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, and in particular to an aptamer, screening method and application for specifically recognizing phalloidin. Background Technology

[0002] Mushroom poisoning is a significant global public health issue, posing a serious threat to food safety and human health. Phallolidein (PHD) is a cyclic heptapeptide toxin produced by the deadly mushroom *Amanita phalloides*, exhibiting potent hepatotoxicity and cholestatic effects. PHD irreversibly binds to F-actin, disrupting cytoskeleton integrity, impairing cell function, and in severe cases, leading to hepatic hemorrhage and hypovolemic shock. Oral ingestion typically causes mild acute toxicity, while intravenous injection carries an extremely high lethality (LD50 in rodents). 50 (1.2-2.1 mg / kg). Currently, no maximum residue limits (MRLs) have been established for PHD, indicating a significant gap in food safety regulation.

[0003] Existing analytical methods mainly include chromatographic techniques (HPLC, LC-MS) and immunological detection. Chromatographic methods can achieve precise quantification, but the instruments are expensive, the operation is complex, and the cycle is long, making them unsuitable for rapid on-site detection. Immunological methods utilize the specific binding of antigens and antibodies, which can achieve a certain level of sensitivity, but antibody preparation is time-consuming and costly, and is susceptible to cross-reactivity and batch-to-batch variations. In particular, there is a lack of commercially available antibodies for PHD, and their low molecular weight and rigid cyclic structure further increase the difficulty of molecular recognition.

[0004] To address these issues, aptamers, as single-stranded oligonucleotide fragments, have become effective alternative molecular recognition elements to antibodies by folding into target-specific three-dimensional structures. Aptamers possess advantages such as high affinity, good chemical stability, ease of chemical modification, and reusability, making them particularly suitable for detecting small molecule toxins in complex food matrices. While traditional SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technology is widely used for screening aptamers for mycotoxins, veterinary drug residues, and pesticides, it suffers from long screening cycles, low enrichment efficiency, and bias. Capture-SELEX, by immobilizing the target on a solid-phase support (such as magnetic beads), effectively separates bound and unbound sequences, reduces non-specific interference, and enhances the enrichment efficiency of high-affinity aptamers. Introducing structured ssDNA libraries can further improve sequence diversity and binding performance. Summary of the Invention

[0005] To address the aforementioned technical issues, this invention utilizes Capture-SELEX technology combined with a structured single-stranded DNA library to analyze the obtained candidate aptamers from multiple perspectives, including thermodynamics, affinity, and specificity. This successfully screened out the nucleic acid aptamer Apt-PHD, which exhibits both high affinity and high specificity for phalloidin.

[0006] The first object of the present invention is to provide an aptamer that specifically recognizes phalloidin, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Specifically, the nucleotide sequence of the aptamer is CCTCTCTATGGGCAGTCGGTGATTGGGATGGCTTTTTGTCTCTCTGTGTCTTTTGCTTATCGACTAAGGCACAGGGAGAATGAGGAACCCAGTGCAG.

[0008] Furthermore, the 3' or 5' end of the aptamer is modified with a functional group or molecule.

[0009] Furthermore, the functional groups or molecules are fluorescein, enzyme labeling, biotin, phosphate groups, radioactive isotopes, or nanoluminescent materials.

[0010] A second objective of this invention is to provide a single-stranded DNA library for screening aptamers that specifically recognize phalloidin, wherein the single-stranded DNA library is 5'-CCTCTCTATGGGCAGTCGGTGAT-N10-TTTTGTCTCTCTGTGTCTTTT-N20-GGAGAATGAGGAACCCAGTGCAG-3', wherein N10 is a sequence consisting of 10 arbitrary bases and N20 is a sequence consisting of 20 arbitrary bases.

[0011] A third objective of this invention is to provide the application of the above-described single-stranded DNA library in screening aptamers that specifically recognize phalloidin.

[0012] Furthermore, it includes the following steps:

[0013] Step S1: Add phalloidin to the random single-stranded DNA library, mix and incubate to allow the random single-stranded DNA library and phalloidin to fully bind and form an incubation mixture; mix streptavidin-coated magnetic beads with the incubation mixture, and after incubation, separate the solid and liquid phases and take the supernatant to obtain ssDNA that binds to the target.

[0014] Step S2: Use the obtained ssDNA as a template for PCR amplification, and prepare the amplification product into single-stranded DNA to obtain the next round of screening library;

[0015] Step S3: Replace the random single-stranded DNA library from step S1 with the next round of screening library described in step S2, and repeat multiple rounds of screening according to step S1, increasing the screening pressure during the process;

[0016] After step S4, the screening library obtained in the last round of screening in step S3 is subjected to high-throughput sequencing to detect the affinity and specificity of the obtained sequence with phalloidin, and to obtain aptamers for specific recognition of phalloidin.

[0017] Furthermore, in step S3, the method for increasing the screening pressure is to reduce the library concentration.

[0018] A fourth object of the present invention is to provide a composition comprising the above-described aptamer that specifically recognizes phalloidin.

[0019] A fifth object of the present invention is to provide a kit comprising an aptamer that specifically recognizes phalloidin as described in any one of claims 1-3.

[0020] A sixth object of the present invention is to provide the use of the above-described aptamer for specifically recognizing phalloidin, the above-described composition, or the above-described kit in the detection of phalloidin.

[0021] The beneficial effects of this invention are:

[0022] This invention utilizes in vitro screening technology to obtain aptamers, resulting in a faster and more efficient process. Its chemical synthesis is simple, and it is easy to label various functional groups or reporter molecules according to requirements. Furthermore, the aptamers exhibit excellent stability and are suitable for long-term storage. The introduction of high-throughput sequencing technology greatly improves the screening efficiency of aptamers, saving time and costs. This invention successfully screened the aptamer Apt-PHD for phalloidin, which possesses high affinity and high specificity. Combined with colorimetric detection, the detection limit for phalloidin is as low as 18.0 pg / mL. Based on the obtained high-affinity aptamer, portable detection devices can be further developed. Such devices are suitable for rapid detection in the field or on-site, providing an effective technical means for preventing edible fungus poisoning and strengthening food safety monitoring and early warning. Attached Figure Description

[0023] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein:

[0024] Figure 1 This is a schematic diagram of the screening process for aptamers that specifically recognize phalloidin according to the present invention.

[0025] Figure 2 This is a phylogenetic tree of candidate sequences obtained from high-throughput sequencing in an embodiment of the present invention;

[0026] Figure 3 These are the secondary structure prediction results of candidate aptamers in this embodiment of the invention, where AE corresponds to PHD-1, PHD-2, PHD-3, PHD-4, PHD-8 and PHD-9, respectively.

[0027] Figure 4 These are the affinity analysis results of the SGI fluorescence displacement experiment of the candidate aptamers in the embodiments of the present invention;

[0028] Figure 5 These are the thermodynamic analysis results of the isothermal titration calorimetric experiments of candidate aptamers PHD-3 and PHD-4 in the embodiments of the present invention;

[0029] Figure 6 This is the specificity analysis result of comparing the fluorescence response of candidate aptamers PHD-3 and PHD-4 with different interfering toxins in the embodiments of the present invention;

[0030] Figure 7 This is a circular dichroism spectrum diagram showing the changes in the circular dichroism spectral density before and after the binding of candidate aptamers PHD-3 and PHD-4 in an embodiment of the present invention.

[0031] Figure 8 The results of the docking simulation between aptamer PHD-3 and PHD molecules in this embodiment of the invention;

[0032] Figure 9 This represents the linear relationship between the binding sensitivity of different concentrations of phalloidin to the nucleic acid aptamer Apt-PHD in the embodiments of the present invention. Detailed Implementation

[0033] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0034] Example

[0035] I. Randomized Library, Primer and Capture Probe Design

[0036] A structured ssDNA library (97 nt) was constructed with the sequence: 5'-CCTCTCTATGGGCAGTCGGTGAT-N10-TTTTGTCTCTCTGTGTCTTTT-N20-GGAGAATGAGGAACCCAGTGCAG-3' (N10 represents a sequence composed of 10 arbitrary bases, and N20 represents a sequence composed of 20 arbitrary bases). PCR amplification primers were derived from the library sequence: the forward primer was 5'-FAM-CCTCTCTATGGGCAGTCGGTGAT-3', and the reverse primer was 5'-phosphate-CCTCTTACTCCTTGGGTCACGTC-3'. A capture probe was biotin-modified at its 5' end and immobilized on magnetic beads using streptavidin; the specific capture probe was 5'-AAAAGACACAGAGAGACAAAA-biotin-3'.

[0037] II. Preparation, library immobilization, and Capture-SELEX screening of streptavidin magnetic nanoparticles

[0038] (1) Preparation of avidin-labeled magnetic nanoparticles: Anhydrous sodium acetate, ferric chloride hexahydrate, and 1,6-hexanediamine were added to ethylene glycol and heated and stirred to form a homogeneous colloidal solution. Fe3O4 amino magnetic nanoparticles were prepared by reacting at 198℃ for 6 hours. The particles were ultrasonically dispersed, magnetically separated, washed, dried, and ground to obtain amino Fe3O4 magnetic powder. 10 mg of magnetic powder was dissolved in 5 mL of 10 mmol / L PBS, ultrasonically dispersed, and then reacted with avidin in glutaraldehyde. The mixture was washed and a 2 mg / mL avidin-coupled magnetic bead solution was prepared.

[0039] (2) ssDNA library immobilization: The ssDNA library and biotinylated capture probes were hybridized in binding buffer at a 1:1.5 molar ratio. After gradient cooling, the hybridization products were immobilized with avidin-functionalized magnetic beads (Am-MBs@avidin) at 37°C with shaking for 2 hours. The library was stably immobilized on the magnetic beads through biotin-avidin interaction, and non-specific adsorbed sequences were removed by washing with PBS.

[0040] (3) Directed screening of PHD aptamers: The total volume of the first round of screening was 400 μL, with 100 μM PHD and immobilized ssDNA library added, and incubated at 37℃ and 130 rpm for 2 hours. Free PHD competitively binds, and the specifically bound aptamers are dissociated and form PHD / ssDNA complexes, which are retained in the supernatant. Magnetic beads are removed after separation, and the supernatant is used as a PCR template.

[0041] (4) PCR amplification: PCR amplification was performed using the supernatant template. The system included primers, dNTPs, and Mg. 2+The amplification cycle conditions for Taq enzyme were as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 30 s, cycling to the optimized cycle, and then extending at 72℃ for 2 min, and storing at 4℃.

[0042] (5) Polyacrylamide gel electrophoresis verification: PCR products were subjected to 8% non-denaturing gel electrophoresis, and enzyme digestion products were electrophoresed in 8% denaturing gel containing 7 M urea to detect the integrity of the bands and the molecular weight position (approximately 80 bp).

[0043] (6) PCR product purification and enzyme digestion: Use a purification kit to remove impurities and use a nano-titrator to determine the concentration. Add enzyme digestion buffer and nuclease in proportion, react at 37°C until completion, and then inactivate the enzyme at 75°C for 10 min.

[0044] (7) Purification of enzyme digestion products: Add 1 / 10 volume of 3 M NaAC, then add 2 volumes of anhydrous ethanol and mix well. Precipitate overnight at -20℃, centrifuge the precipitate, wash with 70% ethanol, dry and dissolve in 1×TE buffer as the next round of screening library.

[0045] As the number of screening rounds increases, the screening pressure is gradually increased to obtain aptamer sequences with high affinity and high specificity. The library dosage in the first round is 1 nmol, which is then reduced to 100 pmol in subsequent rounds.

[0046] III. High-throughput sequencing and sequence analysis

[0047] High-throughput sequencing (HTS) was performed on the PCR products obtained from rounds 14 and 15 of Capture-SELEX (Sangon Biotechnology Co., Ltd., Shanghai, China). Sequencing data were processed using MEGA 12 software, and homology analysis was performed on the top 50 sequences sorted by enrichment rate.

[0048] like Figure 2 As shown, multiple sequence alignment and phylogenetic clustering divided these candidate sequences into four independent families. From these families, six aptamers (PHD-1, PHD-2, PHD-3, PHD-4, PHD-8, and PHD-9) were ultimately selected as candidate aptamers. Secondary structure prediction using Mfold and NUPACK showed that these aptamers possess stable stem-loop structures with negative ΔG values, indicating thermodynamic conformational stability, which is conducive to binding with target molecules. Figure 3 ).

[0049] IV. Affinity Analysis of Candidate Aptamers

[0050] After high-throughput sequencing (HTS) screening, the binding affinity of candidate aptamers was first screened by SYBR Green I (SGI) fluorescence displacement assay, and then thermodynamically verified by isothermal titration calorimetry (ITC).

[0051] In SGI fluorescence experiments, the aptamer was thermally denatured (95°C, 10 min) and then rapidly cooled on ice (10 min) to refold. The aptamer was serially diluted in binding buffer from 10–300 nM, and SGI (final concentration 1×) was added. After incubation at room temperature for 5 min, PHD was added to a final concentration of 1 µM, and incubation continued for 20 min. Fluorescence spectra (λex = 490 nm, λem = 527 nm) were recorded using a microplate reader. Relative fluorescence changes (ΔF = F0 – F1, where F0 is the blank signal and F1 is the experimental signal) were used to construct binding curves. The apparent dissociation constant (Kd) was obtained by fitting a one-point binding nonlinear regression model using GraphPad Prism 8.0. All experiments were repeated three times. Figure 4 As shown, PHD-3 and PHD-4 exhibited the strongest PHD binding affinity compared to other candidate aptamers.

[0052] Isothermal titration calorimetry (ITC) experiments were performed on a MicroCal PEAQ-ITC system (Malvern Instruments, UK). Candidate aptamers were dissolved in 10 mM Tris-HCl buffer (pH 7.4). Prior to analysis, the aptamers were thermally denatured at 95°C for 10 min and then cooled to room temperature for 30 min to facilitate refolding. All solutions were degassed before titration to remove air bubbles. The aptamer concentration was 100 μM, and the PHD concentration was 10 μM. In the control experiment, the target solution was replaced with an equal volume of buffer solution to determine the heat of dilution. A 13-injection titration protocol was used: an initial delay of 60 s, with an initial injection of 0.4 μL, followed by a 150 s delay; then 12 consecutive injections of 4 μL each, spaced 150 s apart. Data were processed using MicroCal PEAQ-ITC Analysis software to obtain binding thermodynamic parameters. Results are as follows: Figure 5 As shown in Table 1, aptamer PHD-3 exhibits a higher PHD binding affinity than PHD-4.

[0053] Table 1. Affinity results of aptamers PHD-3 and PHD-4

[0054] PHD-3 SEQ ID NO.1 42.67±6.74 0.292 ± 0.0034 PHD-4 SEQ ID NO.2 64.62±13.08 0.687 ± 0.0067

[0055] V. Specificity Analysis of Candidate Aptamers

[0056] The specificity of candidate aptamers was evaluated under the same conditions as the affinity assay, with the aptamer concentration fixed at 100 nM. Potential interfering agents included T-2 toxin, DON, OTA, AFB1, and α-AMT. Non-specific binding was assessed by comparing the relative fluorescence response to the response of PHD, with a blank control containing no target. All experiments were repeated three times. Results are as follows: Figure 6 As shown, PHD-3 exhibited the highest specificity, with extremely low cross-reactivity and non-specific binding. In contrast, PHD-4 showed some cross-reactivity and non-specific binding.

[0057] VI. Circular dichroism characterization of candidate aptamers

[0058] The conformational dynamics of candidate aptamers and their structural changes upon binding with PHD were analyzed by circular dichroism (CD) spectroscopy using a Chirascan spectropolarimeter (Applied Photophysics, UK). During the experiment, the sample cell was continuously purged with 99.99% dry nitrogen. Background spectra of the buffer solution and PHD were subtracted. The aptamer solution (5 µM) was placed in a 1 cm quartz cuvette and scanned in the 230–320 nm range at room temperature. Each spectrum was calculated as a cumulative average of three measurements, and all measurements were repeated three times. Results are shown below. Figure 7 As shown, PHD-3 exhibits typical B-type DNA spectral characteristics, with a negative band at approximately 237 nm and a positive band at approximately 280 nm. Upon binding to PHD, its ellipticity changes significantly, indicating that interferon binding induces enhanced helicity and base stacking in the stem-loop structure. In contrast, PHD-4 shows only a slight spectral shift, consistent with its lower binding affinity.

[0059] VII. Molecular docking simulation of aptamer PHD-3

[0060] Molecular docking simulations were performed on aptamer PHD-3 to elucidate the interaction mechanism between the selected aptamer and PHD. The crystal structure of PHD was retrieved from the NCBI database (PubChem CID: 92043320; resolution 2.7 Å), and all water molecules were removed before docking. The secondary structure of the aptamer was predicted using Mfold, and its lowest-energy 3D conformation was generated using RNAcomposer, converting uracil residues to thymine to reflect the DNA sequence. Docking simulations were performed using AutoDock Tools 1.5.6 and AutoDock Vina 1.1.2, with each simulation run 100 times independently. The conformation with the lowest binding energy was selected for analysis. The binding interaction was visualized and mapped in PyMOL 2.3.1. The results are shown below. Figure 8As shown, the docking results reveal the molecular recognition mechanism of PHD-3. The lowest energy model locates PHD within the stem-loop connecting groove, forming a well-defined binding pocket through hydrogen bonds, van der Waals forces, and hydrophobic interactions, with a docking score of -8.6 kcal / mol.

[0061] Based on the above results, it is shown that PHD-3 exhibits the strongest affinity for PHD, and therefore it is named Apt-PHD as the specific recognition element of this invention.

[0062] VIII. Application of the Apt-PHD colorimetric kit for preparing phalloidin

[0063] The performance of a colorimetric aptamer sensor based on gold nanoparticle aggregation in sodium chloride solution for detecting Apt-PHD was evaluated. In the absence of PHD, the adsorbed aptamer stabilized the gold nanoparticles, with the plasmon resonance peak located at approximately 520 nm. PHD binding led to aptamer desorption, which in turn caused the gold nanoparticles to aggregate in the presence of sodium chloride, shifting the absorption peak to approximately 620 nm. The absorbance ratio exhibited a linear response in the concentration range of 0.01–100 ng / mL (y = 3.73x + 0.69, R0). 2 = 0.99517), and the detection limit is 18.0 pg / mL, indicating that the sensor has high sensitivity and clear visual detection capability. Figure 9 ).

[0064] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. An aptamer that specifically recognizes phalloidin, characterized in that: The nucleotide sequence of the aptamer is shown in SEQ ID NO.

1.

2. The aptamer according to claim 1, characterized in that: The 3' or 5' end of the aptamer is modified with a functional group or molecule.

3. The aptamer according to claim 2, characterized in that: The functional groups or molecules are fluorescein, enzyme labeling, biotin, phosphate groups, radioactive isotopes, or nanoluminescent materials.

4. A composition, characterized in that: The composition comprises an aptamer that specifically recognizes phalloidin as described in any one of claims 1-3.

5. A reagent kit, characterized in that: The kit contains an aptamer that specifically recognizes phalloidin as described in any one of claims 1-3.

6. The use of the aptamer for specifically recognizing phalloidin according to any one of claims 1-3, the composition according to claim 4, or the kit according to claim 5 in the detection of phalloidin.

Images