Premix solution, test strip, kit and application for amplifying DNA signal of sugarcane top rot

Abstract

The application provides a premix, test strip, kit and application for amplifying a DNA signal of sugarcane top rot, and belongs to the technical field of sugarcane top rot detection. The premix comprises ZFO@Pt / S1 DNA probes, S2 chains, H0 / S0 / MB and H1 chains; the nucleotide sequence of the S2 chain is shown in SEQ ID No. 1; and the nucleotide sequence of the H1 chain is shown in SEQ ID No. 2. The application realizes effective amplification of the detection signal of sugarcane top rot by using a premix to catalyze a hairpin self-assembly technology to amplify a small amount of target. When the test strip containing ZFO@Pt nanoparticles is used for detection, the color change can be observed by naked eyes for identification; the catalytic activity can be used to develop TMB for colorimetric analysis; and the photothermal effect can be used to complete photothermal detection by monitoring the temperature change under the irradiation of 808nm laser.

Description

Technical Field

[0001] This invention relates to the field of sugarcane top rot detection technology, and in particular to a premixed solution, test strip, reagent kit, and application for amplifying the DNA signal of sugarcane top rot. Background Technology

[0002] Sugarcane, a pillar crop for the global sugar industry and clean energy raw materials, has long faced severe damage from sugarcane top rot. Sugarcane top rot is a highly destructive fungal disease caused by Fusarium, primarily affecting the tops and young leaves of sugarcane. Once the fungus invades the growing point, it causes rotting, halting the growth of the main stem and leading to the proliferation of ineffective tillers. These ineffective tillers consume large amounts of nutrients and reduce the number of viable stems, impacting normal growth and development and ultimately resulting in a significant yield reduction. Studies have shown that top rot can reduce sugarcane yield by 10-30% and sucrose content by 15-30%. Early symptoms of sugarcane top rot are often subtle, leading to missed opportunities for optimal control, making diagnosis a challenging problem. Therefore, developing convenient and efficient on-site detection methods is urgently needed.

[0003] Currently, methods for detecting fungal pathogens include loop-mediated isothermal amplification (LAMP), electrochemical open-circuit voltage assay (EOCV), enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR), and quantitative PCR (qPCR). Among these, LAMP is used to detect leaf scald-type sugarcane disease. However, this technique relies on complex multi-primer design and requires precise temperature control, making it prone to non-specific amplification in multi-target systems. EOCV utilizes a biofuel cell constructed by combining a bioanode and cathode, leveraging its high power density to amplify the detection signal for top rot. This method offers high sensitivity, but its use of nucleases in the nucleic acid amplification phase and its detection method require auxiliary instruments, increasing operational complexity. ELISA, PCR, and qPCR all require external power sources, advanced and complex laboratory facilities, and professional assistance, thus limiting their widespread application. Therefore, there is a need to develop a method for detecting sugarcane top rot that is easy to operate and can be performed rapidly without the need for external detection equipment. Summary of the Invention

[0004] The purpose of this invention is to provide a premixed solution, test strip, reagent kit, and application for amplifying the DNA signal of sugarcane top rot. This invention achieves effective amplification of the detection signal of sugarcane top rot by using a premixed solution-catalyzed hairpin self-assembly technology to amplify a small number of targets.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a premixed solution for amplifying the DNA signal of sugarcane top rot, comprising a ZFO@Pt / S1 DNA probe, an S2 strand, an H0 / S0 / MB strand, and an H1 strand; The nucleotide sequence of the S2 chain is shown in SEQ ID No. 1; The nucleotide sequence of the H1 chain is shown in SEQ ID No. 2.

[0006] Preferably, the preparation method of the ZFO@Pt / S1 DNA probe includes the following steps: (1) After dissolving FeCl3·6H2O, add ZnCl2, sonicate, add sodium citrate and sodium acetate, sonicate, dry, wash, and vacuum dry to obtain ZFO; (2) Dissolve ZFO, sonicate, add H2PtCl6·6H2O, add NaBH4 during sonication, wash, dissolve, and obtain ZFO@Pt nanoparticle solution; (3) Mix the activated S1DNA with the ZFO@Pt nanoparticle solution, incubate, and block the active sites on its surface to obtain the ZFO@Pt / S1DNA probe. The nucleotide sequence of the S1DNA is shown in SEQ ID No. 3.

[0007] Preferably, the preparation method of H0 / SO / MB includes the following steps: The annealed H0 chain is mixed with activated carboxylated magnetic beads, reacted, and then the S0 chain is added to hybridize, blocking the non-specific binding sites on the surface of the magnetic beads. Magnetic separation is then performed to obtain the H0 / S0 / MB. The nucleotide sequence of the H0 chain is shown in SEQ ID No. 4; The nucleotide sequence of the S0 chain is shown in SEQ ID No. 5.

[0008] The present invention also provides the application of the premixed solution in the detection of sugarcane top rot.

[0009] The present invention also provides the application of the premixed solution in the preparation of products for detecting sugarcane top rot.

[0010] The present invention also provides a test strip for detecting sugarcane top rot, comprising a conjugate pad, an NC membrane, an absorbent pad, and a PVC base plate, wherein the conjugate pad, the NC membrane, and the absorbent pad are located on the PVC base plate, and the conjugate pad and the absorbent pad are located at both ends of the NC membrane. The NC membrane is provided with T-lines and C-lines, with the T-lines close to the bonding pad and the C-lines close to the absorbent pad. The T-line contains a conjugate of the capture probe and streptavidin; The C-line contains a conjugate of a quality control probe and streptavidin; The nucleotide sequence of the capture probe is shown in SEQ ID No. 6, and the nucleotide sequence of the quality control probe is shown in SEQ ID No. 7; The quality control probe is complementary to the S1 DNA sequence of the ZFO@Pt / S1 DNA probe.

[0011] The present invention also provides a kit for detecting sugarcane top rot, comprising the premixed solution and the test strip.

[0012] The present invention also provides a method for detecting sugarcane top rot, comprising the following steps: (a) Mix the DNA of the sample to be tested with the H0 / S0 / MB and H1 chains, incubate, magnetically separate, take the supernatant, add the S2 chain and ZFO@Pt / S1 DNA probe to obtain the test mixture; (b) After magnetic separation of the mixture to be tested, resuspend it and drop it onto the conjugate pad of the test strip, analyze it and determine whether the sample to be tested is infected with sugarcane top rot.

[0013] Preferably, in step (a), the volume ratio of the DNA of the sample to be tested to the H0 / S0 / MB and H1 chains is 1:2-3:1; the volume ratio of the DNA of the sample to be tested to the S2 chain and the ZFO@Pt / S1 DNA probe is 3-4:2-3:8-9.

[0014] Preferably, in step (b), the analytical method includes colorimetric analysis, photothermal analysis, and catalytic colorimetric analysis.

[0015] The beneficial effects of this invention compared to the prior art are as follows: This invention utilizes ZFO@Pt nanoparticles, designed for multiple uses, as signal tags on test strips. When using test strips containing these nanoparticles, color changes can be observed visually for identification. Furthermore, their catalytic activity can be used to develop TMB for colorimetric analysis. Additionally, their photothermal effect allows for photothermal detection by monitoring temperature changes under 808nm laser irradiation. The colorimetric method extracts the RGB intensity values ​​using software and then performs quantitative detection using the ratio of the T-line to the C-line. The photothermal method uses an infrared thermal imager to obtain the temperatures of the T-line and C-line, and then performs quantitative detection using their ratio.

[0016] This invention utilizes ZFO@Pt nanoparticles, which possess peroxidase-like activity, photothermal properties, and a brownish-black color, to achieve three detection modes for sugarcane top rot: color visualization, catalytic colorimetric method, and photothermal method. Quantitative detection is performed by analyzing the ratio of the T and C lines, enabling rapid and sensitive detection of sugarcane top rot genes. Furthermore, the test strip for detecting sugarcane top rot provided by this invention has the advantages of low cost, ease of operation, and no need for professional personnel, making it easy to achieve industrial-scale production. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a schematic diagram of the test strip assembly; Figure 2 This is a flowchart for testing sugarcane top rot using test strips, in which... Figure 2 In this context, A represents the preparation process of ZFO@Pt / S1. Figure 2 B in the diagram represents the principle of CHA-mediated DNA signal amplification. Figure 2 C in the diagram represents the principle of detecting sugarcane top rot; Figure 3 The results and standard curves for three detection modes when testing different concentrations of sugarcane top rot are shown. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] This invention provides a premixed solution for amplifying the DNA signal of sugarcane top rot, comprising a ZFO@Pt / S1 DNA probe, an S2 strand, an H0 / S0 / MB strand, and an H1 strand; The nucleotide sequence of the S2 chain is shown in SEQ ID No. 1; The nucleotide sequence of the H1 chain is shown in SEQ ID No. 2.

[0025] In this invention, the nucleotide sequence of the S2 chain is: CCCGCTCAGGAAACCCGCTCAGGAAACCCGCTCAGGAAACCCGCTCAGGAAACTAGTAATGATCGAAA (SEQ ID No. 1), and the nucleotide sequence of the H1 chain is: TAACGACACGGGCAAATATCTCGTTGTCGTTAACTCGGTAAACATCTACGCAGTC (SEQ ID No. 2). The H1 chain is preferably annealed, and the annealing temperature is preferably 78-82℃, more preferably 80℃; the annealing time is preferably 4-6 min, more preferably 5 min; the H1 chain is preferably a hairpin structure.

[0026] In this invention, the preferred method for preparing the ZFO@Pt / S1 DNA probe includes the following steps: (1) After dissolving FeCl3·6H2O, add ZnCl2, sonicate, add sodium citrate and sodium acetate, sonicate, dry, wash, and vacuum dry to obtain ZFO; (2) Dissolve ZFO, sonicate, add H2PtCl6·6H2O, add NaBH4 during sonication, wash, dissolve, and obtain ZFO@Pt nanoparticle solution; (3) Mix the activated S1DNA with the ZFO@Pt nanoparticle solution, incubate, and block the active sites on its surface to obtain the ZFO@Pt / S1DNA probe. The nucleotide sequence of the S1DNA is shown in SEQ ID No. 3.

[0027] In this invention, the nucleotide sequence of the S1DNA is: CTTATCATTACCGAG (SEQ ID No. 3), and the ZFO is ZnFe2O4.

[0028] In step (1) of this invention, the preferred mass ratio of FeCl3·6H2O, ZnCl2, sodium citrate, and sodium acetate is 4.00-4.10:1.00-1.05:1.0-1.5:10.5-11.0, more preferably 4.05:1.02:1.2:10.8; the preferred solvent used for dissolution is ethylene glycol, and the preferred mass-to-volume ratio of FeCl3·6H2O to ethylene glycol is 4.00-4.10g:118-122ml, more preferably 4.05g:120ml; the preferred ultrasonication time is... The drying time is preferably 0.4-0.6h, more preferably 0.5h; the drying temperature is preferably 180-210℃, more preferably 200℃; the drying time is preferably 10-15h, more preferably 12-14h, and even more preferably 13h; the washing is preferably performed by centrifugation using water and ethanol; the vacuum drying temperature is preferably 50-70℃, more preferably 55-65℃, and even more preferably 60℃; the vacuum drying time is preferably 10-15h, more preferably 12-14h, and even more preferably 13h.

[0029] In step (2) of this invention, water is preferably used for dissolution, more preferably ultrapure water; the ultrasonic time is preferably 15-25 min, more preferably 18-24 min, and even more preferably 20 min; the ultrasonic frequency is preferably 30-40 Hz, more preferably 34-38 Hz, and even more preferably 35 kHz; the ultrasonic temperature is preferably 3-5℃, more preferably 4℃; the mass ratio of ZFO, H2PtCl6·6H2O and NaBH4 is preferably 10:6-7:8-9, more preferably 10:6.2-6.8:8.2-8.8, and even more preferably 10:6.4:8.6; the ultrasonic temperature is preferably 3-5℃, more preferably 4℃; water and ethanol are preferably used for washing; water is preferably used for dissolution, more preferably ultrapure water.

[0030] In step (3) of the present invention, the preferred method for preparing the activated S1DNA is to mix S1DNA with TE buffer containing TCEP; the preferred volume ratio of the activated S1DNA to the ZFO@Pt nanoparticle solution is 14-16:38-42, more preferably 15:40; the preferred incubation temperature is 35-40℃, more preferably 37℃; the preferred incubation time is 3-5h, more preferably 4h; the preferred method for blocking the active sites on its surface is to perform vortex treatment with BSA, the preferred vortex temperature is 25-30℃, more preferably 26-28℃, even more preferably 27℃; the preferred vortex time is 0.8-1.2h, more preferably 1h.

[0031] In this invention, the preferred method for preparing H0 / SO / MB includes the following steps: The annealed H0 chain is mixed with activated carboxylated magnetic beads, reacted, and then the S0 chain is added to hybridize, blocking the non-specific binding sites on the surface of the magnetic beads. Magnetic separation is then performed to obtain the H0 / S0 / MB. The nucleotide sequence of the H0 chain is shown in SEQ ID No. 4; The nucleotide sequence of the S0 chain is shown in SEQ ID No. 5.

[0032] In this invention, the nucleotide sequence of the H0 chain is: GACTCCGTAGATCATTACCGAGTTTACAACAACGAGATATTTGCCCGTGTCGTTA (SEQ ID No. 4), and the nucleotide sequence of the S0 chain is CCTGAGCGGGCAAATATCTCGTTAATGATAA (SEQ ID No. 4). No. 5); the annealing temperature is preferably 78-82℃, more preferably 80℃; the annealing time is preferably 4-6 min, more preferably 5 min; the annealed HO chain has a hairpin structure; the volume ratio of the annealed HO chain to the activated carboxylated magnetic beads is preferably 1:2; the preferred method for preparing the activated carboxylated magnetic beads is: dissolving the carboxylated magnetic beads and adding them to a PBS solution containing EDC and NHS, incubating, and obtaining the activated carboxylated magnetic beads; PBS is used for dissolution; the molar concentration ratio of EDC and NHS is preferably 1:1.5-2.5, more preferably 1:2; the incubation temperature is preferably 35-40℃, more preferably 37℃; the incubation time is preferably... The reaction time is preferably 0.8-1.2 h, more preferably 1 h; the reaction temperature is preferably 35-40℃, more preferably 37℃; the reaction time is preferably 8-12 h, more preferably 10 h; the reaction is preferably accompanied by shaking treatment; the molar ratio of the annealed H0 chain to the SO chain is preferably 1:1; the hybridization temperature is preferably 35-40℃, more preferably 37℃; the hybridization time is preferably 1.8-2.2 h, more preferably 2 h; the method for blocking non-specific binding sites on the surface of magnetic beads is preferably adding BSA and allowing it to stand, the mass percentage of BSA is preferably 0.8-1.2%, more preferably 1%; the magnetic separation method preferably uses a magnet to separate solid materials.

[0033] The present invention also provides the application of the premixed solution in the detection of sugarcane top rot.

[0034] The present invention also provides the application of the premixed solution in the preparation of products for detecting sugarcane top rot.

[0035] The present invention also provides a test strip for detecting sugarcane top rot, comprising a conjugate pad, an NC membrane, an absorbent pad, and a PVC base plate, wherein the conjugate pad, the NC membrane, and the absorbent pad are located on the PVC base plate, and the conjugate pad and the absorbent pad are located at both ends of the NC membrane. The NC membrane is provided with T-lines and C-lines, with the T-lines close to the bonding pad and the C-lines close to the absorbent pad. The T-line contains a conjugate of the capture probe and streptavidin; The C-line contains a conjugate of a quality control probe and streptavidin; The nucleotide sequence of the capture probe is shown in SEQ ID No. 6, and the nucleotide sequence of the quality control probe is shown in SEQ ID No. 7; The quality control probe is complementary to the S1 DNA sequence of the ZFO@Pt / S1 DNA probe.

[0036] In this invention, the nucleotide sequence of the capture probe is TTTCGATCATTACTAG (SEQ ID No. 6), and the nucleotide sequence of the quality control probe is TTTTCTCGGTAATGAT (SEQ ID No. 6). No. 7); the binding pad and absorbent pad preferably have a 2mm overlap area with the NC membrane; the 5' ends of the capture probe and the quality control probe are preferably biotin-labeled; the preferred method for preparing the conjugate of the capture probe and streptavidin is: mixing the capture probe and streptavidin, incubating, to obtain the conjugate of the capture probe and streptavidin; the volume ratio of the capture probe to streptavidin is 1:1; the incubation temperature is preferably 3-5℃, more preferably 4℃; the incubation time is preferably 1.8-2.2h, more preferably 2h; the preferred method for preparing the conjugate of the quality control probe and streptavidin is: mixing the quality control probe and streptavidin, incubating, to obtain the conjugate of the quality control probe and streptavidin; the volume ratio of the quality control probe to streptavidin is 1:1; the incubation temperature is preferably 3-5℃, more preferably 4℃; the incubation time is preferably 1.8-2.2h, more preferably 2h.

[0037] The present invention also provides a kit for detecting sugarcane top rot, comprising the premixed solution and the test strip.

[0038] The present invention also provides a method for detecting sugarcane top rot, comprising the following steps: (a) Mix the DNA of the sample to be tested with the H0 / S0 / MB and H1 chains, incubate, magnetically separate, take the supernatant, add the S2 chain and ZFO@Pt / S1 DNA probe to obtain the test mixture; (b) After magnetic separation of the mixture to be tested, resuspend it and drop it onto the conjugate pad of the test strip, analyze it and determine whether the sample to be tested is infected with sugarcane top rot.

[0039] In step (a) of the present invention, the nucleotide sequence of the DNA of the sample to be tested is: GTTGTTAAACTCGGTAATGATCCCT (SEQ ID No. 8); the volume ratio of the DNA of the sample to be tested to the H0 / S0 / MB and H1 chains is preferably 1:2-3:1, more preferably 1:2.5:1; the volume ratio of the DNA of the sample to be tested to the S2 chain and the ZFO@Pt / S1 DNA probe is preferably 3-4:2-3:8-9, more preferably 3.5:2.5:8.5; the incubation temperature is preferably 35-40℃, more preferably 37℃; the incubation time is preferably 1-3h, more preferably 2h; the magnetic separation method preferably uses a magnet to separate solid materials.

[0040] In step (b) of the present invention, the resuspension solution used during resuspension is preferably a PBS resuspension solution containing PEG, Tween and sucrose; the analytical method preferably includes colorimetric analysis, photothermal analysis and catalytic colorimetric analysis.

[0041] Example 1: Preparation of test strips for detecting sugarcane top rot (1) Soak the sample pad in a mixed solution of 1% NaCl, 0.5% Tween, 1% BSA, 2% sucrose and 1% Triton for 1 hour, and then bake it in an oven at 37°C for 12 hours to obtain the pretreated sample pad. Store it in a sealed container for later use. (2) Using the strong binding force of streptavidin and biotin, the probes on the T line and C line were fixed on the NC membrane. 50 μL and 24 μM capture probe and quality control probe were mixed with 50 μL and 4 mg / mL streptavidin aqueous solution, respectively, and incubated at 4℃ for 2 h to obtain the conjugates of capture probe and streptavidin and the conjugates of quality control probe and streptavidin. The mixture was added to the synovial membrane apparatus and sprayed onto the NC membrane at a rate of 100 μL / s. The distance between the T line and C line was set to 5 mm. The membrane was then dried overnight in a 37℃ oven and cut into single strips with a width of 3.5 mm. The strips were stored at 4℃. (3) Attach the bonding pad, NC membrane, and absorbent pad to the PVC base plate. Note that the bonding pad and absorbent pad are located at both ends of the NC membrane and are tightly fitted 2mm above it. The T-line should be closer to the bonding pad, and the C-line closer to the absorbent pad. Figure 1 As shown.

[0042] Example 2: Preparation of ZFO@Pt (1) Dissolve 4.05g FeCl3·6H2O in 120mL ethylene glycol solution by ultrasonication, add 1.02g ZnCl2 and ultrasonicate for 0.5h to obtain an orange-yellow solution, add 1.2g sodium citrate and ultrasonicate for 0.5h, add 10.8g sodium acetate and continue ultrasonication until the solid is completely dissolved by ultrasonication, then transfer it to a high-pressure reactor and place it in a 200℃ oven for 12h. (2) After the reaction is completed, the product is naturally cooled to room temperature. The product is then centrifuged and washed with an equal volume of water and ethanol mixture until the supernatant becomes clear. Finally, the solid is placed in a vacuum drying oven and dried overnight to obtain ZFO. (3) Weigh 10 mg of ZFO solid and dissolve it in 10 mL of ultrapure water. Sonicate it to disperse it evenly. Add 325 μL of 38 mM H2PtCl6·6H2O solution. Place the mixed solution on a vortex apparatus and shake for 0.5 h. Under ultrasonic conditions at 4 °C, add 5 mL of 45.5 mM NaBH4 solution of ice. Continue to sonicate for 20 min. Wash it six times with an equal volume of water and ethanol mixture. Then disperse it in 2.5 mL of ultrapure water to obtain ZFO@Pt nanoparticle solution. Store it at 4 °C in the dark for later use.

[0043] Example 3: Preparation of ZFO@Pt / S1 DNA probe 263.2 μL of TE buffer containing 10 mM TCEP was mixed with S1DNA to activate its thiol groups, resulting in activated S1DNA. 15 μL of activated S1DNA was mixed with 40 μL of ZFO@Pt nanoparticle solution prepared in Example 2 and incubated at 37°C for 4 h. 40 μL of 20% BSA was added, and the mixture was vortexed at room temperature for 1 h to block the active sites on its surface, resulting in the ZFO@Pt / S1DNA probe.

[0044] Example 4 Preparation of H0 / SO / MB The H0 and H1 chains were annealed at 80℃ for 5 min and then naturally cooled to room temperature to obtain the H0 and H1 hairpin structures. Simultaneously, 30 μL of carboxylated magnetic beads were washed with PBS and then dispersed in an equal volume of PBS. An equal volume of PBS solution containing 10 mM EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) and 20 mM NHS (N-hydroxysuccinimide) was added, and the mixture was incubated at 37℃ for 1 h to activate the carboxyl groups on the magnetic beads. The beads were washed three times with PBS to obtain the activated magnetic beads. The volume ratio of H0 to the activated magnetic beads was 1:2, and the mixture was incubated overnight at 37℃ on a shaker. S0 was added, and the mixture was hybridized at 37℃ on a shaker for 2 h. The molar ratio of H0, H1, and S0 was 1:1:1. 1% BSA was added, and the mixture was allowed to stand at room temperature for 1 h to block the non-specific binding sites on the surface of the magnetic beads. The mixture was then magnetically separated and dispersed in PBS solution to obtain H0 / S0 / MB, which was stored at 4℃.

[0045] Example 5: Premixed solution for amplifying DNA signals from sugarcane top rot A premixed solution for amplifying the DNA signal of sugarcane top rot consists of the ZFO@Pt / S1 DNA probe prepared in Example 3, the S2 strand, and the H0 / S0 / MB and H1 strands prepared in Example 4.

[0046] Example 6 Detection of Sugarcane Top Rot (1) Take 15 μL of a concentration of 10 -8 ~10 -15 The target DNA of M was mixed with 25 μL of H0 / S0 / MB prepared in Example 4 and 15 μL of H1 hairpin structure strand, and incubated with shaking for 2 h. The supernatant was magnetically separated and the supernatant was retained. 10 μL of S2 strand and 10 μM of S2 strand and 40 μL of ZFO@Pt / S1 DNA probe prepared in Example 3 were added to the supernatant and incubated at 37 °C for 1 h to obtain the test mixture. (2) After magnetic separation of the mixture obtained in step (1), the solid is resuspended in 100 μL of PBS resuspension containing 0.5% PEG, 0.02% Tween and 5% sucrose. After resuspension, it is dropped onto the conjugation pad of the test strip prepared in Example 1. If there is a target substance, a brown-black line will appear on the T line, while the excess unreacted ZFO@Pt / S1DNA will be captured by the control line C. After the solution is completely absorbed, the resuspension solution is added to rinse and reduce the residual background signal. (3) Colorimetric mode analysis: Take a picture with a mobile phone and extract the RGB intensity values ​​of the T line and the C line; Photothermal mode analysis: Irradiate the test strip with an 808nm near-infrared laser and record the temperature change with a near-infrared thermal imager; Catalytic colorimetric mode analysis: Cut off the T line and C line of the test strip with scissors, add them to an acetic acid buffer (pH=4) containing 30mM H2O2 and 1.2mM TMB, take a picture with a mobile phone and extract the RGB intensity values; obtain the quantitative analysis of the target analyte.

[0047] The basic procedure and principle for quantitative analysis using the test strip prepared in Example 1 and the premixed solution in Example 5 are as follows: Figure 2 As shown.

[0048] Depend on Figure 2As can be seen from B in the text, this invention achieves target amplification through catalytic hairpin self-assembly technology. When a target is present, it opens the hairpin H0, exposing the sticky end, allowing H0 and H1 to hybridize through chain shift reaction, releasing the target and S0. At the same time, the target will continue to enter the next cycle of reaction. After multiple cycles, more S0 can be obtained. Then, after adding S2 and ZFO@Pt / S1 DNA probe, it will self-assemble to form a bamboo-like DNA signal amplification structure, thereby realizing signal amplification for the detection of shoot rot.

[0049] Depend on Figure 2 As indicated by C, this invention allows the reaction solution to be added to the test strip, causing it to develop color. The color development on the T line is due to the capture probe, which pairs with the S2 base, immobilized on the NC membrane surface. S0 can only be obtained when a target is present. S0 acts as a bridge, pairing with the ZFO@Pt / S1 DNA probe and S2, ultimately forming a bamboo-like DNA signal amplification structure, thus resulting in color development on the T line. Conversely, when there is no target, this structure cannot be formed due to the absence of S0, therefore no color development occurs on the T line. The unreacted ZFO@Pt / S1 DNA probe is captured by the control probe on the C line, thus developing color on the C line.

[0050] Example 7 Quantitative Detection of Sugarcane Samples To examine the practical application performance of the designed test strip sensing platform, we tested sugarcane tissue samples infected with pathogens, provided by the Guangxi Academy of Agricultural Sciences. Infected sugarcane tissue samples were taken, chopped with scissors, and ground in a mortar with liquid nitrogen. DNA was extracted using a fungal genomic DNA extraction kit. The detection performance of the test strip was evaluated by analyzing the T / C line ratio under different detection modes according to the method described in Example 6. A linear regression equation was established with the logarithm of the sugarcane top rot gene concentration as the abscissa and the T / C ratio as the ordinate, thereby completing the quantitative analysis of sugarcane top rot. The results are as follows: Figure 3 As shown.

[0051] Figure 3 The figures show the results and standard curves for three detection modes corresponding to different concentrations of sugarcane top rot detected by the test strip of this invention. In colorimetric mode, the target analyte concentration is 10... -13 -10 -7 Within the range M, the linear equation y = 0.1757lgC + 2.64(R) 2 =0.993); the detection limit was 32.1 fM (S / N=3). In photothermal mode, the target analyte concentration was 10... -14 -10 -7 Within the range M, the linear equation y = 0.1187lgC + 2.12(R) 2=0.994); the detection limit was 2.2 fM (S / N=3); in catalytic colorimetric mode, the target analyte concentration was within 10 -15 -10 -7 Within the range M, the linear equation y = 0.1959lgC + 2.91(R) 2 =0.993); the detection limit was 286 aM (S / N = 3).

[0052] In summary, the multi-mode test strip sensing platform not only has good analytical sensitivity for detecting sugarcane top rot, but also features multifunctional nanomaterials that are simple to synthesize, time-saving, and labor-saving. The detection operation does not require instruments, making it more convenient and faster. This demonstrates the potential application value of this platform in the detection of sugarcane top rot.

[0053] As can be seen from the above embodiments, the present invention provides a premixed solution, test strip, reagent kit, and application for amplifying the DNA signal of sugarcane top rot. Compared with traditional colloidal gold test strips, the lateral chromatography test strip for detecting sugarcane top rot has high sensitivity, simple operation, and can present three detection signals. The present invention utilizes ZFO@Pt nanoparticles with good biocompatibility, peroxidase-like activity, and photothermal properties as signal tags, and achieves signal amplification of target DNA through catalytic hairpin self-assembly technology, constructing a simple, easy-to-operate, and highly sensitive detection and analysis technique.

[0054] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A premix for amplifying DNA signal of sugarcane top-rot disease, characterized by, Includes ZFO@Pt / S1 DNA probe, S2 strand, H0 / S0 / MB and H1 strand; The nucleotide sequence of the S2 chain is shown in SEQ ID No. 1; The nucleotide sequence of the H1 chain is shown in SEQ ID No. 2; The nucleotide sequence of S1 DNA in the ZFO@Pt / S1DNA probe is shown in SEQ ID No. 3; The nucleotide sequence of the H0 chain in the H0 / S0 / MB is shown in SEQ ID No. 4, and the nucleotide sequence of the S0 chain is shown in SEQ ID No.

5.

2. The premixed liquid according to claim 1, characterized in that, The preparation method of the ZFO@Pt / S1 DNA probe includes the following steps: (1) After dissolving FeCl3·6H2O, add ZnCl2, sonicate, add sodium citrate and sodium acetate, sonicate, dry, wash, and vacuum dry to obtain ZFO; (2) Dissolve ZFO, sonicate, add H2PtCl6·6H2O, add NaBH4 during sonication, wash, dissolve, and obtain ZFO@Pt nanoparticle solution; (3) Mix the activated S1 DNA with the ZFO@Pt nanoparticle solution, incubate, add BSA for vortex treatment to block the active sites on its surface, and obtain the ZFO@Pt / S1 DNA probe.

3. The premixed liquid according to claim 1, characterized in that, The preparation method of H0 / S0 / MB includes the following steps: The annealed H0 chain was mixed with activated carboxylated magnetic beads and reacted. The SO chain was added for hybridization. BSA was added and allowed to stand to block the non-specific binding sites on the surface of the magnetic beads. Magnetic separation was performed to obtain the H0 / SO / MB.

4. The use of the premixed solution according to any one of claims 1-3 in the detection of sugarcane top rot.

5. The use of the premixed liquid according to any one of claims 1-3 in the preparation of products for detecting sugarcane top rot.

6. A test strip for detecting sugarcane top rot, characterized in that, The test strip is used to detect the sample to be tested after being treated with the premixed liquid according to any one of claims 1 to 3. The test strip includes a conjugate pad, an NC membrane, an absorbent pad and a PVC base plate. The conjugate pad, the NC membrane and the absorbent pad are located on the PVC base plate. The conjugate pad and the absorbent pad are located at both ends of the NC membrane. The NC membrane is provided with T-lines and C-lines, with the T-lines close to the bonding pad and the C-lines close to the absorbent pad. The T-line contains a conjugate of the capture probe and streptavidin; The C-line contains a conjugate of a quality control probe and streptavidin; The nucleotide sequence of the capture probe is shown in SEQ ID No. 6, and the nucleotide sequence of the quality control probe is shown in SEQ ID No. 7; The quality control probe is complementary to the S1 DNA sequence of the ZFO@Pt / S1 DNA probe according to claim 1.

7. A reagent kit for detecting sugarcane top rot, characterized in that, It includes the premixed solution according to any one of claims 1-3 and the test strip according to claim 6.

8. A method for detecting sugarcane top rot, characterized in that, Includes the following steps: (a) Mix the DNA of the sample to be tested with the H0 / S0 / MB and the H1 chain of claim 1, incubate, magnetically separate, take the supernatant, add the S2 chain of claim 1 and the ZFO@Pt / S1 DNA probe of claim 1 to obtain the test mixture; (b) After magnetic separation of the test mixture, resuspend and drop it onto the conjugate pad of the test strip as described in claim 6, analyze and determine whether the test sample is infected with sugarcane top rot.

9. The method according to claim 8, characterized in that, In step (a), the volume ratio of the DNA of the sample to be tested to the H0 / S0 / MB and the H1 chain of claim 1 is 1:(2-3):1; the volume ratio of the DNA of the sample to be tested to the S2 chain and the ZFO@Pt / S1 DNA probe of claim 1 is 3-4:2-3:8-9.

10. The method according to claim 8, characterized in that, In step (b), the analytical method includes color visualization colorimetry, photothermal analysis, or catalytic colorimetry; The color visualization colorimetric method involves taking a photo with a mobile phone and extracting the RGB intensity values ​​of the T-line and the C-line. The photothermal analysis method involves irradiating the test strip with an 808nm near-infrared laser while simultaneously recording temperature changes using a near-infrared thermal imager. The catalytic colorimetric method involves cutting the T and C lines of the test strip with scissors, adding them to an acetate buffer solution containing 30 mM H2O2 and 1.2 mM TMB, taking a picture with a mobile phone, and extracting the RGB intensity values.

Images