A genetic transformation system of yellow flag and application thereof
Patent Information
- Application Number
- CN202511885307.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-08-28
- Estimated Expiration
- 2045-12-15
AI Technical Summary
目前,已有少量的关于黄菖蒲离体再生的研究报道,但是仍缺少完整的离体再生和遗传转化体系
(1)本发明提供了一个完整的黄菖蒲遗传转化体系,以开花50d后、生长良好、饱满的蒴果中的幼胚为外植体,通过对促进愈伤形成、促进愈伤分化、生根等各个阶段所用培养基组分、组分配比以及侵染条件的优化,获得了最适黄菖蒲遗传转化、离体再生的体系;
Smart Images

Figure CN121344073B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a genetic transformation system for Iris tectorum and its application. Background Technology
[0002] Yellow calamus ( Iris pseudacorus Yellow iris (Iris tectorum) is a perennial herbaceous plant belonging to the genus Iris in the family Iridaceae. It has bright yellow flowers, a beautiful bloom, and high ornamental value. It is mainly used for urban greening, water beautification and purification, and is also commonly grown in pots or used in flower arrangements and foliage. Yellow iris is also a medicinal herb; its dried rhizomes can relieve toothache, regulate menstruation, and treat diarrhea.
[0003] Yellow iris has limitations such as limited flower color, short ornamental period, and long breeding cycle, hindering its widespread application in landscaping and the cultivation of new varieties. Targeted improvement using genetic engineering breeding technology is of great significance for enriching the ornamental characteristics of yellow iris and enhancing its application value. Establishing a stable in vitro regeneration and genetic transformation system will provide a new approach for targeted molecular breeding of yellow iris. Currently, there are a few research reports on the in vitro regeneration of yellow iris, but a complete in vitro regeneration and genetic transformation system is still lacking. Summary of the Invention
[0004] The purpose of this invention is to provide a genetic transformation system for iris and its application, so as to fill the gap in the current lack of a complete in vitro regeneration and genetic transformation system for iris.
[0005] To achieve the above objectives, this invention provides a genetic transformation system for Iris tectorum, comprising the following steps: S1. Callus induction: Take the well-grown, plump capsules of Iris tectorum 50 days after flowering, disinfect them, cut them longitudinally, take out the immature embryos and place them on the callus induction medium, and culture them in the dark at 25±1℃. S2. Induction of differentiation: After successfully induced callus tissue was infected with Agrobacterium, it was placed on a co-culture medium and cultured in the dark at a temperature of 25±1℃. Then, the washed callus tissue was inoculated into a selection medium for further culture.
[0006] S3. Inducing rooting: The selected resistant buds are placed in a rooting medium and cultured at 25±1℃ under alternating light and dark conditions for 16 hours and 8 hours until rooting. The adventitious buds after rooting are tested for positive results again. After the test is completed, the positive seedlings are hardened off and transplanted.
[0007] Preferably, in step S1, the embryo is removed by squeezing it out from the germination pore at the top of the young seed; the callus induction medium consists of the following components: MS medium + 30 g / L sucrose + 6.0 g / L agar powder + 2.0 mg / L 2,4-dichlorophenoxyacetic acid + 0.2 mg / L 6-benzylaminopurine, and the other component is distilled water.
[0008] Preferably, the co-culture medium in S2 consists of the following components: MS medium + 6 g / L agar + 30 g / L sucrose + 1.5 mg / L 2,4-dichlorophenoxyacetic acid + 0.5 mg / L 6-benzylaminopurine + 100 μmol / L acetosyringone.
[0009] Preferably, the screening medium in S2 consists of the following components: MS medium + 30 g / L sucrose + 6.0 g / L agar powder + 0.5 mg / L 6-benzylaminopurine + 0.6 mg / L naphthaleneacetic acid + 1.0 mg / L furanylaminopurine + 71.6 mg / L kanamycin and 300 mg / L carbenicillin.
[0010] Preferably, the kanamycin and carbenicillin are identical to the antibiotic marker gene carried on the expression vector of Agrobacterium carrying the target gene fragment.
[0011] Preferably, after being placed on a co-culture medium, the S2 culture is cultured at 25±1℃ in the dark for 2 days; after being inoculated into a screening medium, it is cultured at 25±1℃ under alternating light and dark conditions of 16h and 8h until adventitious buds emerge.
[0012] Preferably, in S2, Agrobacterium infection is performed using an activation process to OD. 600 Agrobacterium culture with a concentration of 0.6-0.8 was centrifuged, and the supernatant was discarded. The cells were then resuspended in 1 / 2 MS medium with 100 μmol / L acetylsyl syringone until the OD value reached 0.6-0.8. 600 Value 0.6-0.8, infection time 15 min; 1 / 2 MS culture medium: 100 μmol / L acetylsyleugenol volume ratio 1:1.
[0013] Preferably, the rooting medium in S3 consists of the following components: MS medium + 30 g / L sucrose + 6 g / L agar powder + 1.0 mg / L 3-indolebutyric acid, with the other component being distilled water.
[0014] Application of the above-described genetic transformation system of Iris tectorum in the breeding of Iris tectorum varieties and the study of gene function.
[0015] Therefore, the genetic transformation system of Iris tectorum provided by this invention and its application have the following specific technical effects: (1) This invention provides a complete genetic transformation system for Iris tectorum. Using the young embryos in the well-grown and plump capsules 50 days after flowering as explants, the system is optimized by optimizing the culture medium components, component ratios and infection conditions used in each stage of promoting callus formation, callus differentiation and rooting. The optimal system for genetic transformation and in vitro regeneration of Iris tectorum is obtained. (2) The genetic transformation system provided by this invention has a rapid callus formation, good activity, low browning rate, high differentiation rate, and high positive callus transformation rate. It is suitable for the genetic transformation of Iris pseudacorus and has great theoretical significance and application and promotion value for the genetic transformation, gene function research and directional molecular breeding of Iris pseudacorus and other Iris species.
[0016] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0017] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 These are photographs of some callus tissues taken during the determination of the optimal hormone concentration in the callus proliferation process in Example 1 of the present invention; wherein A is callus tissue infected by endophytes; B is callus tissue with good proliferation; and C is browned callus tissue. Figure 2 These are photographs of partial callus differentiation during the process of determining the optimal growth regulator concentration in Example 1 of the present invention; wherein parts A, B, and C are photographs of callus at different stages. Figure 3 These are partial callus photographs taken during the optimal kanamycin screening process in Example 2 of this invention; wherein A represents 0 mg / L Kan; B represents 25 mg / L Kan; C represents 50 mg / L Kan; D represents 75 mg / L Kan; E represents 100 mg / L Kan; and F represents 125 mg / L Kan. Figure 4 These are photographs obtained by a live imaging instrument of some plants during the screening process of resistant seedlings in Example 2 of this invention; where WT-Plants are wild-type plants; OE-Plants 1-OE-Plants 3 are different transgenic plants; Figure 5This is an agarose gel electrophoresis image obtained during PCR molecular detection in Example 2 of the present invention; where M is the marker; lane 1 is ddH2O; lane 2 is the negative control (non-transgenic plant); and lanes 3-9 are different transgenic plants. Detailed Implementation
[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0020] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0021] The instruments, equipment, reagents, and materials used in the examples were all obtained commercially.
[0022] Example 1 The specific steps for establishing the in vitro regeneration system of Iris tectorum embryos are as follows: (1) Obtaining sterile explants.
[0023] After flowering for 50 days, harvest the well-grown and plump capsules of the yellow iris and disinfect them. The specific steps are as follows: soak in a 10% detergent solution for 15 minutes, rinse with running water for 30 minutes, rinse with sterile water 2-3 times, then rinse with 75% (v / v) ethanol (inverted) for 30 seconds, rinse with sterile water 2-3 times, soak in a 10% sodium hypochlorite solution for 30 minutes, and rinse with sterile water 5-6 times until the sodium hypochlorite on the surface of the capsules is cleaned off. Wipe them clean on sterilized paper towels.
[0024] Place the sterilized capsules on sterile filter paper, and use tweezers and a scalpel to cut the capsules lengthwise. Remove the plump, tender seeds and place them on a petri dish containing sterile filter paper. Extrude the embryos from the germination pores at the top and carefully inoculate them onto callus induction medium using tweezers.
[0025] (2) Determination of the optimal hormone concentration during the callus induction process of Iris tectorum embryos.
[0026] The callus induction medium was MS medium (M8521, Solarbio Life Sciences, China) with 30 g / L sucrose (AR, Shanghai Test) and 6.0 g / L agar powder (A8190, Solarbio Life Sciences, China) adjusted to pH 5.8 as the basal medium. Different concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D) (0.5, 1.0, 1.5, 2.0 mg / L) and 6-benzylaminopurine (6-BA) (0.1, 0.2, 0.5, 1.0 mg / L) were added to the basal medium, resulting in 16 treatments with four levels of two-factor inoculation. Each treatment was repeated three times, with 15 culture dishes inoculated per replicate, and 10 immature embryos inoculated per dish. Each culture dish was placed in the dark and cultured at a temperature of 25±1℃. After 50 days, the callus induction rate and germination rate were calculated. The callus induction rate was calculated as: (number of callus tissues / total number of embryos of each type) × 100%; the germination rate was calculated as: (number of germinated embryos / total number of embryos of each type) × 100%. The statistical results are shown in Table 1.
[0027] Immature embryos were inoculated onto callus induction media containing different concentrations of 2,4-D and 6-BA. After 7 days, the tops of some embryos began to swell and turn yellow. After 30 days, callus granules began to appear. With the extension of time, the state and granularity of the callus became more obvious, and the callus was fully formed after 50 days. The results in Table 1 show that the callus induction rate was the highest, at 96.25%, when the concentration of 2,4-D was 2.0 mg / L and the concentration of 6-BA was 0.2 mg / L. Therefore, in subsequent experiments, the concentration of 2,4-D in the callus induction medium was 2.0 mg / L and the concentration of 6-BA was 0.2 mg / L.
[0028] Table 1. Effects of different hormone concentrations on callus induction
[0029] Note: Different letters following the numerical value represent... p The difference was statistically significant at the <0.05 level, as determined by the Duncan test.
[0030] (2) Determination of the optimal hormone concentration during callus proliferation.
[0031] Well-formed, dense callus tissue was selected and divided into small pieces with a diameter of less than 5 mm. These pieces were then inoculated into callus proliferation medium. The callus proliferation medium consisted of MS medium supplemented with 30 g / L sucrose and 6.0 g / L agar powder as the basic medium, with different concentrations of 2,4-D (0.5, 1.0, 1.5, 2.0 mg / L) and 6-BA (0.2, 0.5 mg / L) added, resulting in eight treatment combinations. All groups were cultured at 25 ± 1℃ under alternating 16 h light and 8 h dark conditions. After 30 days of culture, the proliferation coefficient and browning rate were calculated for each treatment. The proliferation coefficient was calculated as: (mass of proliferated callus / mass of callus before proliferation); the browning rate (%) was calculated as: (number of browned callus / total number of inoculated callus) × 100%. The statistical results are shown in Table 2. Photographs of some callus tissues are also provided. Figure 1 As shown, when the concentrations of 2,4-D were 1.5 mg / L and 6-BA were 0.5 mg / L, the callus proliferation coefficient was the highest (5.13), and the browning rate was relatively low, indicating a better callus condition. Therefore, in subsequent experiments, the concentrations of 2,4-D and 6-BA in the callus proliferation medium were 1.5 mg / L and 0.5 mg / L, respectively.
[0032] Table 2. Effects of different hormone concentrations on callus proliferation
[0033] Note: Different letters following the numerical value represent... p The difference was statistically significant at the <0.05 level, as determined by the Duncan test.
[0034] (3) Effects of different growth regulator concentrations on callus redifferentiation.
[0035] Differentiation induction medium consisted of MS medium supplemented with 30 g / L sucrose and 6.0 g / L agar powder as the basic medium, with different concentrations of 6-BA (0.5, 1.0, 1.5, 2.0 mg / L), naphthaleneacetic acid (NAA) (0.2, 0.4, 0.6 mg / L), and furanopurine (KT) (0.0, 1.0, 2.0 mg / L) added respectively, according to L9(3 4 The orthogonal experimental design included nine treatments (as shown in Table 3).
[0036] Dense, well-grown callus tissue was selected and divided into small pieces with a diameter of less than 5 mm. These pieces were then inoculated into differentiation induction medium. The inoculated callus tissues were cultured at 25±1℃ under alternating 16h light and 8h dark conditions. After 30 days, the differentiation rate and browning rate of each treatment were calculated. Differentiation rate (%) = (number of callus shoots / total number of inoculated callus tissues) × 100%; Browning rate (%) = (number of browned callus tissues / total number of inoculated callus tissues) × 100%. The statistical results are shown in Table 3. Photographs of some callus tissue differentiation are also included. Figure 2 As shown, the callus treated with 0.5 mg / L 6-BA, 0.6 mg / L NAA, and 1.0 mg / L KT exhibited the highest differentiation rate (75.00%) and the lowest browning rate (3.33%), consistent with the optimal hormone combination obtained from range analysis. These results indicate that the optimal hormone combination for tissue redifferentiation treatment is A1B3C2. Therefore, in subsequent experiments, the concentrations of 6-BA in the differentiation induction medium were 0.5 mg / L, NAA 0.6 mg / L, and KT 1.0 mg / L.
[0037] Table 3. Effects of different hormone concentrations on callus redifferentiation
[0038] (4) Effect of growth regulator concentration on adventitious bud rooting.
[0039] The rooting medium consisted of MS medium supplemented with 30 g / L sucrose and 6 g / L agar powder as the basic medium, with different concentrations of 3-indolebutyric acid (IBA) (0.2, 0.5, and 1.0 mg / L) added, for a total of three treatments (Table 4). Differentiated calluses were selected and placed on the rooting medium. After culturing at 25±1℃ under alternating light and dark conditions for 16 h and 8 h, root growth was observed, and the rooting coefficient and rooting rate were calculated. Rooting rate (%) = number of adventitious buds / number of inoculated adventitious buds × 100%; rooting coefficient = total number of roots formed by plants under each hormone treatment / number of plants.
[0040] The results are shown in Table 4. When the IBA concentration was 0.2 mg / L, the root system was weak and slow-growing; when the IBA concentration increased to 0.5 mg / L, the root system was still weak but the growth rate accelerated; when the IBA concentration increased to 1.0 mg / L, the root system was robust, the growth rate was fast, and the rooting coefficient was high. The adventitious bud rooting rate and rooting coefficient gradually increased with increasing IBA concentration. Therefore, in subsequent experiments, the IBA concentration in the rooting medium was 1.0 mg / L.
[0041] Table 4. Effects of different IBA concentrations on rooting of tissue culture seedlings
[0042] Note: Different letters following the numerical value represent... p The difference was statistically significant at the <0.05 level, as determined by the Duncan test.
[0043] Example 2 The specific steps of the Agrobacterium-mediated genetic transformation method for Iris pseudacorus are as follows: (1) Effects of different concentrations of kanamycin (Kan) on callus differentiation.
[0044] When using Agrobacterium-mediated transformation of plants, antibiotics are needed to screen for positive transformants. However, increasing the concentration of antibiotics can affect the normal growth and differentiation of plant tissues, leading to a decrease in plant regeneration capacity. Therefore, selecting appropriate antibiotics and determining the optimal concentration are crucial steps in improving transformation efficiency.
[0045] In this experiment, Kan was used as a selector to screen positive transformants and detect transgenic progeny. To investigate the effect of Kan on callus differentiation, different concentrations (0, 25, 50, 75, 100 and 125 mg / L) of Kan were added to MS medium containing 30 g / L sucrose, 6.0 g / L agar powder, 0.5 mg / L 6-BA, 0.6 mg / L NAA and 1.0 mg / L KT. The callus with good growth and dense structure obtained in step (2) of Example 1 was cut into small pieces and inoculated onto the above medium and cultured at 25±1℃ under alternating light and dark conditions of 16 h light and 8 h dark.
[0046] After 40 days of culture, the differentiation rate and browning rate of callus tissue were statistically analyzed. The results are shown in Table 5. As the Kan concentration increased, the differentiation rate of callus tissue gradually decreased, while the browning rate gradually increased, indicating that Kan gradually intensified its damage to callus tissue. Figure 3 Linear fitting analysis of the browning rate of callus tissue revealed that the median lethal concentration of Kan for callus tissue was 71.6 mg / L. Figure 3 Therefore, during the genetic transformation of Iris tectorum, 71.6 mg / L of Kan was added to the differentiation induction medium for antibiotic positive screening. 71.6 mg / L of Kan is the critical tolerance concentration for the redifferentiation of Iris tectorum callus.
[0047] Table 5. Effects of Kan on callus redifferentiation and growth
[0048] Note: Different letters following the numerical value represent... p The difference was statistically significant at the <0.05 level, as determined by the Duncan test.
[0049] (2) The inhibitory effect of different concentrations of carbenicillin (Carb) on Agrobacterium and its effect on callus growth.
[0050] The control of Agrobacterium is crucial for successful transformation. In this experiment, Carb was used as an antibiotic to inhibit Agrobacterium growth. After co-culture, callus tissue was washed 2-3 times with sterile water (until the water was clear), then washed with 250 mg / L Carb for 15 min, and finally washed 4-6 times with sterile water (until the water was clear). After drying the callus tissue, it was inoculated into callus proliferation media with different Carb concentrations (0, 100, 200, 300, 400, 500 mg / L). After culturing at 25±1℃ for 30 days under alternating 16h light and 8h dark conditions, the inhibition rate and lethality rate were calculated. Inhibition rate = (number of callus tissues without Agrobacterium growth / total number of callus tissues inoculated for each treatment) × 100%; lethality rate = (number of callus tissues that died after inoculation / total number of callus tissues inoculated for each treatment) × 100%. The statistical results are shown in Table 7. As the Carb concentration gradually increased, the contamination rate gradually decreased, and the inhibitory effect on Agrobacterium significantly increased. With increasing Carb concentration, browning initially decreased and then increased; however, excessively high Carb concentrations increased the toxicity to callus tissue. Therefore, low Carb concentrations could not inhibit Agrobacterium, while high Carb treatment resulted in severe callus browning. Based on these results, a Carb concentration of 300 mg / L completely inhibited Agrobacterium with a low browning rate, representing the most effective inhibitory concentration.
[0051] Table 7. Antibacterial rate and lethality of callus tissue treated with different Carb concentrations
[0052] Note: Different letters following the numerical value represent... p The difference was statistically significant at the <0.05 level, as determined by the Duncan test.
[0053] (3) Activation of Agrobacterium tumefaciens carrying plant expression vector and preparation of Agrobacterium tumefaciens infection solution.
[0054] 100 μL of Agrobacterium GV3101 glycerol-preserved bacteria containing the pCAMBIA1304 vector was inoculated into 5 mL of LB broth containing 25 mg / L kanamycin (Kan) and 20 mg / L rifampin (Rif). The culture was incubated overnight at 28°C and 200 rpm until the bacteria reached the logarithmic growth phase. 1 mL of the bacterial culture was then transferred to 50 mL of antibiotic-free LB broth and incubated further at 28°C and 200 rpm until the bacterial growth reached OD. 600=0.6-0.8. Centrifuge the revived Agrobacterium culture at 4000 rpm for 10 min and collect the bacterial precipitate. Prepare 1 / 2 MS medium and add 100 μmol / L acetylsylgenone as a resuspending solution. Add the bacterial precipitate at a 1:1 ratio and resuspend the bacteria to achieve an OD value of 0.6-0.8. 600 The value is between 0.6 and 0.8. After being placed in the dark at room temperature for 2-3 hours, it can be used for subsequent experiments.
[0055] To test the effects of Agrobacterium tumefaciens bacterial concentration, infection time, and co-culture time on genetic transformation efficiency in order to screen for optimal infection conditions, a three-factor, four-level L3 model was developed. 16 (4 3 An orthogonal array was used to design the infection condition combinations, as shown in Table 6. Callus tissue was placed in resuspensions of different bacterial concentrations and infected at different time points. After infection, the bacterial suspensions were inoculated into co-culture medium for co-culture at different time gradients. After washing, the co-cultured callus tissue was inoculated into selection medium, which was the optimal differentiation induction medium supplemented with 71.6 mg / L Kan and 300 mg / L Calb.
[0056] Co-culture medium: MS medium + 6 g / L agar + 30 g / L sucrose + 1.5 mg / L 2,4-dichlorophenoxyacetic acid + 0.5 mg / L 6-benzylaminopurine + 100 μmol / L acetosyringone.
[0057] Range analysis was performed on the callus differentiation rate and transformation rate after Agrobacterium infection under different conditions. The callus differentiation rate (%) was calculated as (number of callus buds / total number of inoculated callus tissues) × 100%; the transformation rate (%) was calculated as (number of GFP fluorescent callus tissues / total number of inoculated callus tissues) × 100%. The results showed that co-culture time was the main factor affecting both callus differentiation rate and transformation rate. The influence of transformation conditions on callus differentiation rate was in the order of co-culture time > infection time > bacterial concentration, while the influence of transformation conditions on transformation rate was in the order of co-culture time > bacterial concentration > infection time.
[0058] Based on the above range analysis results, the optimal treatment combination is D3E3F2 (bacterial concentration of 0.8, infection time of 15 min, and co-culture for 2 days). Under these transformation conditions, the differentiation rate and transformation rate reached the highest values, which were 89.67% and 91.33%, respectively.
[0059] Table 6 Different bacterial concentrations (OD) 600 Orthogonal experimental analysis of (value), infection time, and co-culture time
[0060] (4) Screening and culture of resistant callus and resistant seedlings.
[0061] Infected callus tissue was inoculated onto callus redifferentiation medium supplemented with 300 mg / L Carb and 71.6 mg / L Kan. After culturing at 25±1℃ under alternating light and dark conditions for one month, resistant adventitious shoots were screened out. The shoots were then placed in a plant in vivo imaging instrument for GFP fluorescence detection. Those that emitted green fluorescence were considered resistant adventitious shoots. Figure 4 The adventitious shoots were then placed on redifferentiation medium at 25±1℃ under alternating light and dark conditions for 16 hours and 8 hours, respectively, to induce regeneration. Once the adventitious shoots reached 2-3 cm in length, they were cut off and placed on rooting medium supplemented with 300 mg / L Carb and 71.6 mg / L Kan. After approximately 20 days of rooting, the rooted adventitious shoots were again subjected to GFP fluorescence detection. The fluorescently resistant seedlings were then hardened off and transplanted.
[0062] Redifferentiation medium: MS medium + 30 g / L sucrose + 6 g / L agar powder + 1.0 mg / L 3-indolebutyric acid.
[0063] (5) PCR molecular detection of transgenic plants.
[0064] Genomic DNA was extracted from leaves of transgenic regenerated plants using the CTAB method. PCR amplification (239 bp fragment length) was performed using specific primers: pCAMBIA1304-F (sequence shown in SEQ ID NO.1) and pCAMBIA1304-R (sequence shown in SEQ ID NO.2). The reaction mixture consisted of 1.0 μL DNA template, 12.5 μL 2×Es Taq Master Mix (Dye), 1.0 μL each of forward and reverse primers, and 9.5 μL ddH2O, for a total of 25 μL. The PCR program was as follows: 94℃ pre-denaturation for 10 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ annealing for 1 min, for a total of 28 cycles; extension at 72℃ for 10 min. The amplified products were subjected to 1.2% agarose gel electrophoresis. The results are shown below. Figure 5 As shown, the pCAMBIA 1304 plasmid and transgenic positive plants showed a clear target band at approximately 239 bp, with the band position consistent with expectations. Non-transgenic plants, however, did not show the target band, indicating that this genetic transformation system can obtain positive plants, with a positive rate of 88.5%. Figure 5 ).
[0065] SEQ ID NO.1: GACGCTCACACCGATACCA SEQ ID NO.2: GCACACTGATACTCTTCACTC Therefore, this invention provides a complete genetic transformation system for *Iris tectorum*. Using the immature embryos in well-developed, plump capsules 50 days after flowering as explants, the system optimizes the culture medium components, component ratios, and infection conditions used at each stage, including promoting callus formation, callus differentiation, and rooting. This yields the most suitable system for genetic transformation and in vitro regeneration of *Iris tectorum*. Using this genetic transformation system, callus formation is rapid, with good activity, low browning rate, high differentiation rate, and high positive callus conversion rate. It is suitable for the genetic transformation of *Iris tectorum* and has significant theoretical and practical value for genetic transformation, gene function research, and targeted molecular breeding of *Iris tectorum* and other *Iris* species.
[0066] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A genetic transformation system for Iris tectorum, characterized in that, The steps are as follows: S1. Callus induction: Take the well-grown, plump capsules of Iris tectorum 50 days after flowering, disinfect them, cut them longitudinally, take out the immature embryos and place them on the callus induction medium, and culture them in the dark at 25±1℃. S2. Induction of differentiation: After successfully induced callus tissue was infected with Agrobacterium tumefaciens, it was placed on co-culture medium and cultured in the dark at a temperature of 25±1℃. Then, the washed callus tissue was inoculated into selection medium for further culture. S3. Inducing rooting: The selected resistant buds were placed in a rooting medium and cultured at 25±1℃ under alternating light and dark conditions for 16 hours and 8 hours until rooting. The adventitious buds after rooting were tested for positive results again. After the test, the positive seedlings were hardened off and transplanted. The embryo is removed in S1 by squeezing it out from the germination pore at the top of the young seed. The callus induction medium consists of the following components: MS medium + 30 g / L sucrose + 6.0 g / L agar powder + 2.0 mg / L 2,4-dichlorophenoxyacetic acid + 0.2 mg / L 6-benzylaminopurine, with distilled water as the other component; The S2 co-culture medium consists of the following components: MS medium + 6 g / L agar + 30 g / L sucrose + 1.5 mg / L 2,4-dichlorophenoxyacetic acid + 0.5 mg / L 6-benzylaminopurine + 100 μmol / L acetosyringone; The screening medium in S2 consists of the following components: MS medium + 30 g / L sucrose + 6.0 g / L agar powder + 0.5 mg / L 6-benzylaminopurine + 0.6 mg / L naphthaleneacetic acid + 1.0 mg / L furanylaminopurine + 71.6 mg / L kanamycin and 300 mg / L carbenicillin.
2. The genetic transformation system for *Iris tectorum* according to claim 1, characterized in that, The kanamycin and carbenicillin mentioned are consistent with the antibiotic marker genes carried on the expression vector of Agrobacterium carrying the target gene fragment.
3. The genetic transformation system for *Iris tectorum* according to claim 1, characterized in that: After being placed on a co-culture medium, the S2 culture medium was cultured at 25±1℃ in the dark for 2 days. After being inoculated into a screening medium, the culture medium was cultured at 25±1℃ under alternating light and dark conditions for 16 hours and 8 hours until adventitious buds emerged.
4. The genetic transformation system of *Iris tectorum* according to claim 1, characterized in that: The Agrobacterium infection in S2 is performed by activation to OD. 600 Agrobacterium culture with an OD600 of 0.6-0.8 was centrifuged and the supernatant was discarded. The cells were then resuspended in 1 / 2 MS medium with 100 μmol / L acetosyringone until the OD600 value was 0.6-0.
8. The cells were then infected for 15 min. The volume ratio of 1 / 2 MS medium to 100 μmol / L acetosyringone was 1:
1.
5. The genetic transformation system for *Iris tectorum* according to claim 1, characterized in that, The rooting medium in S3 consists of the following components: MS medium + 30 g / L sucrose + 6 g / L agar powder + 1.0 mg / L 3-indolebutyric acid, with distilled water as the other component.
6. The application of the Iris tectorum genetic transformation system as described in any one of claims 1-5 in the breeding and gene function research of Iris tectorum varieties.