Proteinophilic bacterial strain and use thereof

Abstract

The application discloses a proteinophilic bacterium strain and application thereof, and relates to the technical field of brewing microorganisms. Proteiniphilum The proteinophilic bacterium (Proteus sp.) strain K 5-3-1 is preserved in the China General Microbiological Culture Collection Center on June 5, 2023, and the preservation number is CGMCC NO. 27523. The new strain provided in the application is separated from pit mud in a Luzhou-flavor liquor pit, can produce acetic acid in a high yield, and can be applied to the field of liquor brewing.

Description

Technical Field

[0001] This invention relates to the field of brewing microbial technology, specifically to a protein-loving bacterial strain and its applications. Background Technology

[0002] Strong-aroma baijiu is one of the most popular basic-aroma baijiu types in my country's consumer market, boasting a large consumer base. Beyond being a commodity, it also serves as an important carrier of traditional Chinese culture and humanistic sentiments. Its brewing process utilizes mud pits as fermentation containers. The inner walls of these pits are covered with a specific fermentation clay, also known as pit mud, which contains a rich variety of fermentation microorganisms with complex community structures. Therefore, the quality of the pit mud directly affects the quality and taste of strong-aroma baijiu. As a fermentation carrier, pit mud typically possesses excellent physicochemical properties and a rich microbial community structure, containing a large number of brewing functional microorganisms such as Clostridium, lactic acid bacteria, caproic acid bacteria, Bacillus, and yeast. It also contains various microbial decomposition products, metabolic products, and a variety of volatile flavor compounds, such as alcohols, esters, acids, and ketones, collectively contributing to the rich and mellow body of strong-aroma baijiu. The full exploration and utilization of the microbial resources in the pit mud is of great significance for understanding the flavor mechanisms of baijiu brewing and improving its quality.

[0003] Proteinophiles ( Proteiniphilum *Sp.* (a type of microorganism) are widely present in the cellar mud and mash of baijiu brewing pits, especially in the microbial community of old cellar mud where their abundance is relatively high. They are a dominant genus and important functional microorganisms in the brewing process of strong-aroma baijiu, with acetic acid as their main metabolic product. Some proteinophilic bacteria can also produce propionic acid and a small amount of isovaleric acid, which are important aroma compounds in strong-aroma baijiu. However, due to their obligate anaerobic nature and the not yet fully understood isolation and culture conditions, only a few strains can be isolated to obtain live pure cultures. Therefore, there is still vast potential for research, development, and utilization of this type of microbial resource in the brewing industry. Summary of the Invention

[0004] The purpose of this invention is to provide a new strain of protein-loving bacteria that can enhance the flavor of strong-aroma baijiu during the brewing process.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention provides a new strain of proteinophilic bacteria, belonging to the genus *Proteophila* (…). Proteiniphilum The specimen (sp.) is deposited at the China General Microbiological Culture Collection Center (CGMCC), on June 5, 2023, with accession number CGMCC NO. 27523.

[0007] The 16S rDNA nucleotide sequence of the proteinophilic bacterium K5-3-1 is shown in SEQ ID NO:1.

[0008] The method for isolating and screening the proteinophilic bacterium K5-3-1 described in this invention includes diluting the mud from a strong-aroma baijiu fermentation pit and spreading it onto a fastidious anaerobic agar medium under anaerobic conditions. After anaerobic culture at 37°C for 48 h, a pure culture is obtained by three replicates of four-zone streak purification culture. The genomic DNA of the pure culture is amplified by 16S rDNA, and its sequence is compared and analyzed on EzBioCloud to obtain the proteinophilic bacterium K5-3-1.

[0009] The proteinophilic bacterium K 5-3-1 can produce acetic acid, with an acetic acid production capacity of 2482.5 ppm.

[0010] The advantages of this invention are as follows: This invention has isolated a protein-loving bacterium strain K 5-3-1 from the cellar mud of strong-aroma baijiu fermentation pits. This bacterium produces high levels of acetic acid, which can improve and enhance the flavor and quality of strong-aroma baijiu. It can be applied in the field of baijiu brewing and provides a new strain resource for the brewing and production of strong-aroma baijiu. Attached Figure Description

[0011] Figure 1 The image shown is a scanning electron microscope image of the proteinophilic bacterial strain K5-3-1 of this invention.

[0012] Figure 2 The image shows a phylogenetic tree of the 16S rDNA of the proteinophilic bacterium species K5-3-1.

[0013] Figure 3 The figure shown is a graph of polar lipid analysis results for the proteinophilic bacterial species K5-3-1.

[0014] Figure 4 The image shows the chromatogram of the main organic acids in the fermentation broth of the proteinophilic bacterium K5-3-1. Detailed Implementation

[0015] The following specific examples illustrate the implementation of the present invention. These examples are provided only to illustrate the present invention and are not intended to limit the scope of the present invention.

[0016] Unless otherwise specified, the chemical reagents used in the following examples are all commercially available, and the technical means used in the examples are conventional means used by those skilled in the art.

[0017] The components of the fastidious anaerobic bacteria agar medium used in the examples were: 23.0 g mixed peptone, 5.0 g NaCl, 1.0 g soluble starch, 1.0 g glucose, 1.0 g C3H3NaO3, 1.0 g L-arginine, 0.5 g sodium succinate, 0.5 g cysteine ​​hydrochloride, 0.4 g NaHCO3, 0.25 g soluble pyrophosphate, 0.01 g heme chloride, 0.001 g vitamin K, 15.0 g agar, and 1000 mL distilled water. The components of the fastidious anaerobic bacteria broth medium were: 15.0 g mixed peptone, 10.0 g yeast extract, 2.5 g NaCl, 0.5 g sodium thioglycolate, 0.5 g cysteine ​​hydrochloride, 0.4 g NaHCO3, 0.005 g heme chloride, 0.001 g resazurin, and 0.0005 g vitamin K. g, 0.75 g agar, 1000 mL distilled water.

[0018] Example 1: Isolation and physiological and biochemical characteristics of proteinophilic bacterial strain K5-3-1

[0019] I. Isolation of the new bacterial strain K5-3-1

[0020] All reagents used in the experiment were deoxygenated overnight in an anaerobic workstation. Under anaerobic conditions, 25 g of strong-aroma baijiu cellar mud sample was weighed and added to 225 mL of sterile physiological saline. The mixture was thoroughly shaken and mixed to prepare a 1:10 sample dilution. 1 mL of the sample dilution was added to 9 mL of sterile physiological saline to prepare a 1:100 sample dilution. The above operation was repeated to perform serial dilutions of the sample. The 1:100 to 1:10000 dilutions were plated on fastidious anaerobic agar medium and anaerobically incubated upside down at 37℃ for 48 h. Single colonies on the plates were picked for four-zone streak purification. After three repeated four-zone streak purification cultures, pure cultured bacteria were obtained and named K 5-3-1.

[0021] II. Physiological and biochemical characteristics of the new strain K5-3-1

[0022] 1. Morphological characteristics of the strain

[0023] The isolated proteinophilic bacterial strain K 5-3-1 was anaerobically cultured on fastidious anaerobic agar medium at 37℃ for 48 h. The colonies were pale yellow, round, moist, opaque, and had neat edges. Scanning electron microscopy revealed that the bacteria were rod-shaped and arranged singly or in pairs.

[0024] 2. Physiological and biochemical characteristics of the strain

[0025] Physiological and biochemical characteristics of the bacterial strain were analyzed using the API 20A and API ZYM identification systems. The isolated proteinophilic strain K 5-3-1 was found to be able to utilize glucose, mannitol, lactose, sucrose, maltose, salicylate, xylose, aesculin, glycerol, cellobiose, mannose, mesotriose, raffinose, rhamnose, and trehalose. It was positive for acid phosphatase, alkaline phosphatase, esterase (C4), lipoesterase (C8), trypsin, naphthol-AS-BI-phosphohydrolase, α-galactosidase, β-galactosidase, α-glucosidase, and β-glucosidase, weakly positive for N-acetyl-glucosaminease, and negative for oxidase and catalase.

[0026] The isolated proteinophilic bacterial strain K 5-3-1 can grow at 20–40℃ and pH 6.0–9.0, with the optimal growth temperature being 30℃ and the optimal growth pH being pH 7.0. It can tolerate up to 1% NaCl.

[0027] Example 2: Molecular biological characteristics of proteinophilic bacterial strain K5-3-1

[0028] I. Identification of 16S rDNA of the new strain K5-3-1

[0029] The K5-3-1 strain was inoculated onto fastidious anaerobic agar medium and cultured anaerobicly at 37°C for 48 h. A loopful of colony was picked and genomic DNA was extracted using a bacterial genome extraction kit.

[0030] The 16S rDNA of the P1-1 genomic genome was amplified using primers 27F and 1492R. The results were: 27F: AGAGTTTGATCCTGGCTCAG, 1492R: GGTTACCTTGTTACGACTT.

[0031] 2×PCR premix 25 μL Primer F (10 μmol / L) 1μL Primer R (10 μmol / L) 1 μL bacterial genomic DNA 2 μL sterile double-distilled water 21 μL

[0032] PCR reaction procedure: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 1 min, 55℃ annealing for 1 min, 72℃ extension for 1.5 min, for a total of 30 cycles; 72℃ extension for 10 min; terminate the reaction at 4℃ and store for later use.

[0033] After PCR product gel electrophoresis detection, the samples were sent to Shanghai Sangon Biotech Co., Ltd. for 16S rDNA sequencing. The 16S rDNA sequence of strain K5-3-1 is shown in SEQ ID NO:1.

[0034] The 16S rDNA gene sequence obtained from the K5-3-1 strain was compared with the sequences of strains with valid names in the EzBioCloud database. The neighbor-joining method in MEGA software was used to identify *Forsythia stolonifera* (…). Tannerella forsythia ATCC 43037 T Construct a phylogenetic tree for species K5-3-1 for outgroup species, such as Figure 2 As shown.

[0035] II. Genome-wide ANI analysis of the new bacterial strain K5-3-1

[0036] Whole-genome ANI analysis was performed on the ten most closely similar published type strains to the 16S rDNA gene sequence of strain K5-3-1. FASTA format genome sequences of the ten type strains were downloaded from the NCBI database as reference sequences. Data contamination was checked using ContEst16S software (https: / / www.ezbiocloud.net / tools / contest16s). Sequences meeting quality control requirements were used to calculate the ANI value between the K5-3-1 genome sequence and the type strain genome sequences using the ANI Calculator software in the EzBioCloud database. The results showed that the K5-3-1 strain and the type strain (a proteinophilic bacterium) exhibited similarity. Proteiniphilum saccharofermentans DSM 28694 T The ANI value was the highest, at 79.09%, <95%.

[0037] III. Genome-wide dDDH analysis of the new strain K 5-3-1

[0038] Whole-genome dDDH analysis was performed on strain K 5-3-1 and the top ten valid published type strains with the highest 16S rDNA gene sequence similarity. Data contamination was checked using ContEst16S software (https: / / www.ezbiocloud.net / tools / contest16s), and data meeting quality control requirements were used for dDDH calculation using GGDC (Genome-to-GenomeDistance Calculator 2.1, https: / / ggdc.dsmz.de / ggdc.php#) software. The results showed that strain K 5-3-1 is similar to the type strain *Acetobacter acetophilus* (…). Proteiniphilum acetatigenes DSM18083 T The highest dDDH value was 23.80%, which is <70%.

[0039] IV. Analysis of drug resistance and virulence genes in the new strain K 5-3-1

[0040] 1. Analysis of drug resistance genes in bacterial strains

[0041] The genome sequence of bacterial strain K 5-3-1 was compared with the ResFinder nucleic acid database (https: / / cge.cbs.dtu.dk / services / ResFinder / ) with parameters set to ID=90% and Minimum length=60% for screening. Genes related to resistance to non-antibiotic substances were removed, and antibiotic resistance genes in bacterial strain K 5-3-1 were analyzed. The results showed that bacterial strain K 5-3-1 does not contain antibiotic resistance genes.

[0042] 2. Virulence gene analysis of the strain

[0043] The genome sequence of bacterial strain K 5-3-1 was compared with the VirulenceFinder nucleic acid database (https: / / cge.cbs.dtu.dk / services / VirulenceFinder / ) to analyze virulence genes. The alignment parameters were set to ID=90%, Minimum length=60%, and genes not related to virulence were removed. The results showed that bacterial strain K 5-3-1 does not contain virulence genes.

[0044] Based on comprehensive analysis of colony morphology, physiological and biochemical characteristics, 16S rDNA gene sequence, whole-genome ANI analysis, and dDDH analysis, bacterial species K 5-3-1 was identified as a proteinophile genus ( ). Proteiniphilum (sp.) A new strain, strain K 5-3-1, does not contain drug resistance genes or virulence genes.

[0045] Example 3: Cytochemical analysis of proteinophilic bacterial strain K5-3-1

[0046] I. Fatty acid composition analysis of the new strain K5-3-1

[0047] Fresh petri dish cultures of strain K 5-3-1 were collected. After fatty acid cleavage and release, saponification, methylation, and extraction, the main fatty acid types and contents of strain K 5-3-1 were determined by gas chromatography (GC) combined with the MIDI Sherlock automated identification system. The results showed that the main fatty acid component of strain K 5-3-1 was C. 15:0 ANTEISO FAME, content is 39.12%.

[0048] II. Polar lipid component analysis of the new bacterial strain K5-3-1

[0049] Fresh cultures of bacterial strain K 5-3-1 were collected, precipitated, and freeze-dried to obtain bacterial powder. Methanol, chloroform, and glass beads were added to the powder, and the mixture was disrupted. The lower organic phase was then concentrated under vacuum. The concentrated liquid was subjected to two-dimensional chromatography on a TLC plate, dried, and developed. The cellular polar lipid composition of bacterial strain K 5-3-1 was analyzed by referring to the standard spectrum of major polar lipids. Figure 3 As shown, the main polar lipids in the K5-3-1 bacterial strain are UAPL (Unidentified aminophospholipid), UL (Unidentified lipid), and NPG (Phospholipids of unknown structure containing glucosamine).

[0050] III. Analysis of cell wall sugars and DAP components in the new bacterial strain K 5-3-1

[0051] Fresh cultures of strain K 5-3-1 were collected, precipitated, and freeze-dried to obtain bacterial powder. The powder was then hydrolyzed with hydrochloric acid, and cell wall components were analyzed using thin-layer chromatography (TLC) and high-performance liquid chromatography (HPLC). The results showed that the characteristic DAP component of the cell wall of strain K 5-3-1 was... meso -DAP, the characteristic glycoside of the cell wall is glucose.

[0052] Example 4: Determination of major organic acids in the fermentation broth of proteinophilic bacteria strain K 5-3-1

[0053] The K5-3-1 strain was inoculated at a 2% inoculum into a fastidious anaerobic broth medium and anaerobically cultured at 37℃ for 10 days. The fermentation broth was diluted 10-fold with ultrapure water, shaken thoroughly, and then filtered through a 0.22 μm filter to remove bacteria, serving as the sample for analysis. The content of the main organic acids in the fermentation broth was determined by HPLC. The chromatographic program was as follows: column: Rezex ROA-Organic Acid H+ (8%) (300×7.8 mm); column temperature: 80℃; mobile phase: H2SO4 5 mmol / L; flow rate: 0.6 mL / min; injection volume: 10 μL; detector: PDA (210 nm). The main organic acid in the fermentation broth of the proteophilic strain K5-3-1 was acetic acid, with a content of 2482.5 ppm.

[0054] The protein-loving bacterial strain obtained by screening in this invention produces high levels of acetic acid, which helps to improve the flavor and quality of strong-aroma baijiu and has broad application prospects.

Claims

1. Proteinophiles ( Proteiniphilum The bacterial strain K5-3-1 (sp.) is characterized by: The accession number of this strain at the China General Microbiological Culture Collection Center is CGMCC NO. 27523.

2. The proteinophilic bacterial strain K 5-3-1 according to claim 1, characterized in that: The 16S rDNA nucleotide sequence of the strain is shown in SEQ ID NO:

1.

3. The proteinophilic bacterial strain K 5-3-1 according to claim 1, characterized in that: The strain can produce acetic acid.

Images