A genetically engineered recombinant bacillus subtilis, a construction method thereof and application thereof in resisting vibrio infection

Abstract

The present application relates to the technical field of genetic engineering and aquaculture, and particularly relates to a genetically engineered recombinant bacillus subtilis, a construction method thereof and application thereof in resisting vibrio infection. Specifically, the recombinant bacillus subtilis is constructed by taking bacillus subtilis WB800N as a host bacterium, pDG364 as a carrier and spore coat protein Cot B as an anchor protein, and the recombinant bacillus subtilis BBS-pDG364-Cot B-IL-8 capable of anchoring and expressing rockfish interleukin-8 on the surface of spores is obtained. The recombinant bacillus subtilis BB8 constructed by the present application can not only significantly improve the growth performance and intestinal health status of rockfish, but also enhance the antioxidant capacity, non-specific immune level and resistance to vibrio infection of rockfish, thereby providing a new effective strain for the development and application of rockfish immune enhancer and having a broad application prospect in rockfish aquaculture.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and aquaculture technology, specifically to a genetically engineered recombinant Bacillus subtilis, its construction method, and its application in combating Vibrio infection. Background Technology

[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Scorpionfish (Xu's flatfish) Sebastes schlegelii Black rock perch (also known as blackhead perch or black stone perch) is an important marine aquaculture fish in northern my country, mainly distributed in the Bohai Sea, Yellow Sea, and East China Sea. It is characterized by its strong environmental adaptability, high reproductive capacity, delicious and nutritious flesh, and is highly sought after in domestic and international markets, becoming one of the important marine cage aquaculture fish in the coastal areas of northern my country.

[0004] With the continuous expansion of intensive farming of Scorpionfish (Sebastes schlegelii), disease problems have become increasingly prominent, posing a significant challenge to the sustainable development of the aquaculture industry. Among these, bacterial diseases are common in Scorpionfish farming, particularly those caused by Vibrio species (Vibrio spp.). Vibrio Diseases caused by bacteria (such as Vibrio harveyi and Vibrio parahaemolyticus) are the most serious. These diseases not only cause mass mortality of Scorpionfish, resulting in huge economic losses, but also seriously affect the healthy development of Scorpionfish aquaculture.

[0005] Currently, the main methods for dealing with fish diseases in aquaculture include the use of antibiotics and other drugs. However, long-term use of antibiotics can easily lead to drug resistance in pathogens and drug residues, posing a potential threat to the environment and human health, which is inconsistent with the development concept of green aquaculture. Immunostimulants, as functional feed additives, can regulate the fish's immune system, enhance the body's ability to resist pathogen infection, and have advantages such as being pollution-free and leaving no drug residues, making them an important means of disease control in aquaculture. However, specific immunostimulants for *Scorpionichthys schlegelii* are still relatively lacking and urgently need to be developed. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a genetically engineered recombinant Bacillus subtilis that can anchor and express Scorpionichthys IL-8 on the spore surface, significantly enhancing the immune function and anti-Vibrio infection ability of Scorpionichthys schlegelii. Based on the above research findings, the present invention is thus completed.

[0007] To achieve the above-mentioned technical objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a genetically engineered recombinant Bacillus subtilis, wherein the genetically engineered recombinant Bacillus subtilis uses the spore cap protein Cot B as an anchoring protein and can anchor and express interleukin-8 (IL-8) on the surface of the Bacillus.

[0008] The interleukin-8 (IL-8) is derived from fish, specifically from *Scorpionichthys schlegelii*. IL-8 The gene's GenBank accession number is KP069025.1, and the coding region is 300 bp in size (SEQ ID NO.1). During the construction of the recombinant vector, codon optimization was performed and... IL-8 Adding a 12 bp linker sequence (5'-GGCGGCGGAGGG-3') upstream of the gene increases the spatial flexibility of the anchored protein and the IL-8 protein, avoiding structural interference between the two; adding an 18 bp 6×His tag sequence (5'-CACCACCACCACCACCAC-3') downstream facilitates subsequent detection of the fusion protein using techniques such as Western blotting. IL-8 The full-length gene sequence is 330 bp (SEQ ID NO.2).

[0009] Furthermore, the gene encoding the spore capsid protein... Cot B It is derived from Bacillus subtilis WB800N.

[0010] Furthermore, the starting strain of the genetically engineered recombinant Bacillus subtilis can be Bacillus subtilis strain WB800N.

[0011] A second aspect of the present invention provides a method for constructing the above-mentioned genetically engineered recombinant Bacillus subtilis, comprising the following steps: Build includes Cot B-IL-8 The recombinant expression vector of the fusion gene is obtained by transforming the recombinant expression vector into Bacillus subtilis.

[0012] Among them, the Cot B-IL-8 The fusion gene was obtained using overlap extension PCR technology, wherein... Cot B The gene originates from Bacillus subtilis WB800N; IL-8 The gene originates from fish, specifically from *Scorpionichthys schlegelii*. IL-8 The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0013] The recombinant expression vector is an expression vector and the... Cot B-IL-8 The expression vector can be a plasmid, obtained by fusion gene ligation. In one specific embodiment of the present invention, the plasmid can be the pDG364 plasmid.

[0014] The starting strain Bacillus subtilis can be Bacillus subtilis WB800N, which can efficiently secrete exogenous proteins and is a recognized GRAS-level microorganism. It does not produce toxins, and WB800N has no risk of residual antibiotic resistance genes. Therefore, it is very suitable as a genetically engineered strain in the fields of feed and medicine.

[0015] More specifically, the method for constructing the genetically engineered recombinant Bacillus subtilis includes: (1) Cot B Gene, Cot G Genes and IL-8 Gene amplification: Bacillus subtilis strain WB800N was revived and purified, inoculated into LB broth, and cultured at 37°C and 220 rpm for 12 h. Genomic DNA was extracted according to the bacterial genomic DNA extraction kit instructions. Using the genomic DNA as a template, amplification was performed using specific primers. Cot B Genes and Cot G The gene and primer sequences are as follows: Cot B Gene primers: F-Cot B (5'-TGAGCCGGATGTGATCTGCG-3'), R-Cot B (5'-TTAAAATTTACGTTTCCAGTGATAGTC-3') Cot G Gene primers: F-Cot G (5'-ACGCAAGTCTTTTGGATGAAC-3'), R-Cot G (5'-TTATTTGTATTTCTTTTTGACTACCC-3') PCR reaction system (50 μL): 25 μL 2×PhantaMax Buffer (2 mM), 1 μL dNTP Mix (10 mM), 2 μL upstream primer (0.4 μM), 2 μL downstream primer (0.4 μM), 1 μL PhantaMax Super-Fidelity DNA Polymerase, 17 μL ddH2O, 2 μL genomic DNA (100 ng / μL). Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 5 min. Cot B (gene) or 3 min ( Cot G (Gene), a total of 35 cycles; final extension at 72℃ for 10 min. The amplified products were detected by agarose gel electrophoresis, and the gel was recovered for later use.

[0016] According to the rockfish of Xu's speciesIL-8 The gene, with GenBank accession number KP069025.1, was synthesized with an upstream 12 bp linker sequence and a downstream 18 bp 6×His tag sequence. IL-8 The gene (330 bp in length) was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0017] (2) Construction of fusion genes: Constructed separately by overlap extension PCR Cot B-IL-8 and Cot G-IL-8 Fusion gene, primers are as follows: Cot B-IL-8 Fusion gene primers: F-Cot B (5'-TGAGCCGGATGTGATCTGCG-3'), R-8 (5'-TTAGTGGTGGTGGTGGTGGTGACGAC-3') Cot G-IL-8 Fusion gene primers: F-Cot G (5'-ACGCAAGTCTTTTGGATGAAC-3'), R-8 (5'-TTAGTGGTGGTGGTGGTGGTGACGAC-3') PCR reaction system (50 μL): 25 μL 2×PhantaMax Buffer (2 mM), 1 μL dNTP Mix (10 mM), 2 μL upstream primer (0.4 μM), 2 μL downstream primer (0.4 μM), 1 μL PhantaMax Super-Fidelity DNA Polymerase, 15 μL ddH2O, anchoring protein gene fragment (… Cot B or Cot G 2 μL IL-8 2 μL of gene fragment. Reaction conditions are the same as in step (1). Cot B-IL-8 The fusion gene is expected to be approximately 1670 bp in size. Cot G-IL-8 The expected size of the fusion gene is approximately 1115 bp. The amplification product was recovered from the gel and kept for later use.

[0018] (3) Construction of recombinant plasmids: Using restriction endonucleases Hin d III and Eco RI was used to double-digest the pDG364 vector. The digestion system was 20 μL. Hin d III (15 U / μL) 1 μL EcoRI (15 U / μL) 1 μL, pDG364 plasmid DNA (85 ng / μL) 9 μL, 10×M Buffer 2 μL, ddH2O 7 μL. Incubate at 37℃ for 4 h, then add 10×Loading Buffer to terminate the reaction, and recover the linearized pDG364 vector by gel extraction.

[0019] The linearized pDG364 vector was respectively combined with Cot B-IL-8 , Cot G-IL-8 The fusion gene was ligated via seamless cloning. The seamless cloning reaction system (20 μL) consisted of: 10 μL of 2×Seamless cloning Master Mix, 2 μL of linearized pDG364 vector (40 ng / μL), and the fusion gene fragment (…). Cot B-IL-8 95 ng / μL or Cot G-IL-8 8 μL or 7 μL of 105 ng / μL, and 0 μL or 1 μL of sterile ddH2O. Incubate in a water bath at 50℃ for 20 min, then cool in an ice bath for 2 min to obtain recombinant plasmids pDG364-Cot B-IL-8 (pB8) and pDG364-Cot G-IL-8 (pG8), respectively.

[0020] The recombinant plasmid was transformed into E. coli DH5α competent cells. After antibiotic selection (ampicillin 100 μg / mL), positive single colonies were picked and expanded. The plasmid was extracted for PCR identification (vector primers F-364: 5'-GCGAAATACGGGCAGACATGG-3', R-364: 5'-GGATTTGAGCGTAGCGAAAAATCC-3') and sequencing verification. Plasmids with correct sequencing were stored at -80℃.

[0021] (4) Construction of recombinant Bacillus subtilis: Preparation of Bacillus subtilis WB800N competent cells: The WB800N strain was revived and purified on LB agar plates. Single colonies were picked and inoculated into GM I medium and incubated overnight at 30°C with shaking at 150 r / min. The inoculum was then transferred to fresh GM I medium at a 10% inoculum and incubated at 37°C with shaking at 220 r / min for 3.5 h. The inoculum was then transferred to GM II medium at a 10% inoculum and incubated at 37°C with shaking at 220 r / min for 1.5 h. The cells were centrifuged at 4000 r / min for 3 min, 900 μL of supernatant was discarded, and the remaining cells were resuspended to obtain competent cells.

[0022] Take 10 μL of each sample and administer with restriction endonuclease. Kpn1 μg of pB8 and pG8 plasmids digested with enzyme I was added to 100 μL of competent cells and incubated in a water bath at 37°C for 1 h; 500 μL of GM II medium was added and cultured at 37°C with shaking at 200 r / min for 3 h; after centrifugation, the cells were resuspended and spread on LB agar plates containing 5 μg / mL chloramphenicol and cultured at 37°C for 16 h.

[0023] Suspected positive single colonies were picked, expanded, and genomic DNA was extracted. PCR identification was performed using primers F-amy E (5'-CCAATGAGGTTAAGAGTATTCC-3') / R-amy E (5'-CGAGAAGCTATCACCGCCCAGC-3') and specific primers (F-3-B-8 / R-3-B-8 or F-3-G-8 / R-3-G-8). Amylase activity was also detected simultaneously. Correctly identified strains were named BB8 and BG8, respectively, and stored at -80℃.

[0024] The application of Bs-pDG364-Cot B-IL-8 (BB8) from the aforementioned genetically engineered recombinant Bacillus subtilis in the preparation of an immune enhancer for Scorpionidae. Experimental results verified that BB8's surface-anchored expression of IL-8 was superior to BG8, and it significantly improved the growth performance of Scorpionidae, the activity of intestinal digestive enzymes, improved intestinal tissue structure, and enhanced the antioxidant capacity, non-specific immune level, and resistance to Vibrio harveyi and Vibrio parahaemolyticus infections in Scorpionidae.

[0025] A third aspect of the present invention provides a fish immune enhancer comprising the above-mentioned genetically engineered recombinant Bacillus subtilis Bs-pDG364-Cot B-IL-8 (BB8), wherein the final spore concentration of BB8 in the immune enhancer is 1×10⁻⁶. 8 CFU / mL. Furthermore, the addition of sodium alginate as an encapsulating agent ensures the stability of the spores during storage and transportation, and their effective release into the intestines of the rock bream.

[0026] The fish in question could be *Scorpionfish schlegelii*.

[0027] A fourth aspect of the present invention provides the use of the above-described genetically engineered recombinant Bacillus subtilis or fish immune enhancer in any one or more of the following: (a) Enhance fish immunity; (b) Prevention and control of Vibrio infection.

[0028] The Vibrio species include, but are not limited to, Vibrio harveyi and Vibrio parahaemolyticus.

[0029] The beneficial technical effects of one or more of the above technical solutions are as follows: The above technical solution uses IL-8 from Scorpionichthys schlegelii as an immunomodulatory factor and utilizes the Bacillus subtilis heterologous protein presentation system to construct a recombinant Bacillus subtilis strain that can express IL-8 from Scorpionichthys schlegelii. The immune-enhancing effect of this strain on Scorpionichthys schlegelii is evaluated, providing a new and effective strain for the development of Scorpionichthys schlegelii-specific immune enhancers, solving disease problems in Scorpionichthys schlegelii farming, and promoting the green, healthy, and sustainable development of Scorpionichthys schlegelii farming. Attached Figure Description

[0030] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0031] Figure 1 The figures show the PCR identification results of recombinant plasmids pB8 and pG8 in this embodiment of the invention; A: M is DL2000 Plus DNALadder; 1 is the identification result of pG8; 2 is the identification result of pB8; 3 is the negative control.

[0032] Figure 2 The following are the PCR identification results of recombinant Bacillus subtilis BB8 and BG8 in the embodiments of the present invention; A: M is DL2000Plus DNA Ladder; 1 is negative control; 2 is the identification result of BB8 (F-amy E / R-amy E); B: M is DL2000Plus DNA Ladder; 1 is negative control; 2 is the identification result of BB8 (F-3-B-8 / R-3-B-8); C: M is DL2000Plus DNA Ladder; 1 is negative control; 2 is the identification result of BG8 (F-amy E / R-amy E); D: M is DL2000Plus DNA Ladder; 1 is the identification result of BG8 (F-3-G-8 / R-3-G-8); 2 is negative control.

[0033] Figure 3 These are the amylase activity detection results in the embodiments of the present invention; wherein, A: before adding iodine solution; 1-2 are... B. subtilis WB800N; 3 is recombinant Bacillus subtilis BB8; 4 is recombinant Bacillus subtilis BG8; B: after adding iodine solution; 1-2 are B. subtilis WB800N; 3 represents recombinant Bacillus subtilis BB8; 4 represents recombinant Bacillus subtilis BG8.

[0034] Figure 4 The results of spore staining microscopy and spore counting in this embodiment of the invention (magnification: 1000×); where, A: B. subtilisWB800N; B: Recombinant Bacillus subtilis BG8; C: Recombinant Bacillus subtilis BB8; D: Spore count analysis, different letters above the bars indicate significant differences between treatment groups ( p <0.05).

[0035] Figure 5 This is a Western blot detection of IL-8 protein in an embodiment of the present invention; wherein, A:M is a protein marker; 1 is recombinant Bacillus subtilis BB8; 2 is... B. subtilis WB800N; B: M is protein marker; 1 is recombinant Bacillus subtilis BG8; 2 is... B. subtilis WB800N.

[0036] Figure 6 The following are examples of indirect immunofluorescence verification of recombinant Bacillus subtilis BB8 and BG8 spores in this invention: A: Bacillus subtilis WB800N spores observed under a bright field of view; B: Recombinant Bacillus subtilis BG8 spores observed under a bright field of view; C: Recombinant Bacillus subtilis BB8 spores observed under a bright field of view; D: Bacillus subtilis WB800N spores observed under a fluorescence microscope; E: Recombinant Bacillus subtilis BG8 spores observed under a fluorescence microscope; F: Recombinant Bacillus subtilis BB8 spores observed under a fluorescence microscope.

[0037] Figure 7 The images show the detection results of intestinal digestive enzyme activities in *Scorpionichthys schlegelii* in this embodiment of the invention; from left to right, they represent the detection results of the foregut, midgut, and hindgut, respectively; from top to bottom, they represent the detection results of lipase, α-amylase, and trypsin activities, respectively.

[0038] Figure 8 The images show the intestinal tissue sections and morphological parameter analysis results of *Scorpionichthys schlegelii* in this embodiment of the invention; from left to right, they represent the intestinal tissue sections and morphological parameter analysis results of each group; from top to bottom, they represent the detection results of the foregut, midgut, and hindgut. IVH: intestinal villus height; IVW: intestinal villus width; MT: muscle layer thickness. Different letters above the bars indicate significant differences between treatment groups. p <0.05).

[0039] Figure 9 The results of serum antioxidant and non-specific immune-related index detection of Scorpionfish in this embodiment of the invention are as follows: A: Total antioxidant capacity; B: Total superoxide dismutase; C: Catalase; D: Immunoglobulin M; E: Complement protein 3; F: Complement protein 4; G: Acid phosphatase; H: Alkaline phosphatase; I: Lysozyme.

[0040] Figure 10The total RNA detection results of various tissues of *Scorpionichthys schlegelii* in this embodiment of the invention are shown below; M: DL2000 Marker; 1: gill RNA; 2: spleen RNA; 3: kidney RNA; 4: liver RNA; 5: foregut RNA; 6: midgut RNA; 7: hindgut RNA.

[0041] Figure 11 In the intestinal tissue of *Scorpionichthys schlegelii* in this embodiment of the invention CXCR1 and CXCR2 Relative gene expression analysis; from left to right, the detection results are shown foregut, midgut, and hindgut, respectively; from top to bottom, they represent... CXCR1 and CXCR2 The relative expression level of genes.

[0042] Figure 12 This is an analysis of the relative expression levels of immune-related genes in different tissues of *Scorpionichthys schlegelii* in this embodiment of the invention; from left to right, the results are shown for the liver, spleen, kidney, gills, foregut, midgut, and hindgut; from top to bottom, the results are shown for... NF- κB , AP-1 , HIF-1 and STAT3 The relative expression level of genes.

[0043] Figure 13 Analysis of the effect of recombinant Bacillus subtilis on the resistance of Sebastes schlegelii to Vibrio infection in this invention embodiment; A: V. harveyi Relative protection rate after WHSS0915 virus challenge; B: V. parahaemolyticus Relative protection rate after ATCC33847 challenge; C: V. harveyi WHSS0915 and V. parahaemolyticus Relative protection rate after ATCC33847 mixed attack. Detailed Implementation

[0044] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0045] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0046] The present invention will now be further illustrated with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Unless otherwise specified, experimental conditions not explicitly stated in the examples are generally performed under conventional conditions or as recommended by the reagent company. Unless otherwise specified, all reagents and consumables used in the following examples are commercially available.

[0047] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. The following examples illustrate test methods with specific conditions, which are generally performed under conventional conditions.

[0048] Example 1: Construction of recombinant Bacillus subtilis BB8 and BG8 1.1 Test Materials Strains: Bacillus subtilis WB800N (gifted by Professor Du Aifang of Zhejiang University), Escherichia coli DH5α (Shanghai Sangon Biotech Co., Ltd.).

[0049] Plasmid: pDG364 vector (a kind gift from Professor Aifang Du of Zhejiang University), is an Escherichia coli-Bacillus subtilis shuttle vector, integrated into Bacillus subtilis. amy E Locus containing chloramphenicol resistance gene ( Cmr ).

[0050] Reagents: Bacterial genomic DNA extraction kit (Hunan Aikerui Biotechnology), Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novizan Biotechnology), restriction endonucleases ( Hin d III、 Eco RI Kpn I. Beijing Baori Biotechnology, Seamless Cloning Kit (Shanghai Sangon Biotech), Chloramphenicol (Beijing Solarbio Science & Technology), etc.

[0051] Culture media: LB liquid / solid medium, GM I / II conversion medium, 10×Spizien salts prepared according to standard formula.

[0052] 1.2 Gene Amplification and Fusion Genomic DNA was extracted from Bacillus subtilis WB800N and amplified using it as a template. Cot B Genes and Cot G Genes and PCR products were detected by 1% agarose gel electrophoresis. Cot B The gene fragment size was approximately 1343 bp, and the Cot G gene fragment size was approximately 788 bp, consistent with expectations. It was recovered from the gel and kept for later use.

[0053] Synthetic *Scorpionfish schlegelii* with linker and 6×His tags IL-8 The gene (330 bp) was analyzed by overlap extension PCR with... Cot B , Cot G Gene fusion, resulting in Cot B-IL-8 (approximately 1670 bp) and Cot G-IL-8 (Approximately 1115bp) fusion gene, verified by electrophoresis and recovered by gel extraction.

[0054] 1.3 Construction and Identification of Recombinant Plasmids The pDG364 vector was double-digested with enzymes to obtain a linearized vector fragment. The linearized vector was seamlessly ligated with two fusion genes to construct recombinant plasmids pB8 and pG8. The recombinant plasmids were transformed into *E. coli* DH5α, and after antibiotic selection, the plasmids were extracted. PCR identification showed that pB8 amplified a fragment of approximately 1900 bp, and pG8 amplified a fragment of approximately 1300 bp. Sequencing results were consistent with expectations, indicating successful construction of the recombinant plasmids.

[0055] 1.4 Construction and Screening of Recombinant Bacillus subtilis Bacillus subtilis WB800N competent cells were prepared, and the enzyme-digested pB8 and pG8 plasmids were transformed into competent cells, respectively. After chloramphenicol resistance screening, positive single colonies were picked for PCR identification and amylase activity detection.

[0056] PCR identification results: The BB8 genome amplified with F-amy E / R-amy E primers yielded a fragment of approximately 3300 bp, and with F-3-B-8 / R-3-B-8 primers yielded a fragment of approximately 1700 bp; the BG8 genome amplified with F-amy E / R-amy E primers yielded a fragment of approximately 2700 bp, and with F-3-G-8 / R-3-G-8 primers yielded a fragment of approximately 1100 bp, all as expected.

[0057] Amylase activity assay results: No transparent hydrolysis zone was found around BB8 and BG8 colonies, while a clear transparent zone was found around WB800N colonies, indicating that the fusion gene was successfully integrated into the Bacillus subtilis genome and the recombinant strain was successfully constructed.

[0058] Example 2: Comparative Verification of Expression Effects of Recombinant Bacillus subtilis BB8 and BG8 2.1 Spore preparation and counting Single colonies of BB8 and BG8 were picked and inoculated into LB broth containing chloramphenicol, and cultured at 37°C with shaking for 12 h. Then, 1% inoculum was transferred to 150 mL of DSM medium and cultured at 37°C with shaking (BB8 for 72 h, BG8 for 216 h). After incubation, spores were collected by centrifugation, washed three times with sterile water, sonicated, centrifuged again, stained with a spore staining kit, and analyzed by serial dilution plating for counting.

[0059] The results showed that after 72 h of culture, spores accounted for over 95% of the BB8 field of view, with a spore count of 1.7 × 10⁻⁶. 9 CFU / mL; BG8 spore count was 5.9 × 10⁻⁶. 8 CFU / mL, significantly lower than BB8 ( p <0.05); the number of spores in WB800N was 8.7 × 10⁻⁵. 8 CFU / mL. This indicates that BB8 has a better sporulation capacity than BG8.

[0060] 2.2 Western Blot Detection Spore capsid proteins of BB8 and BG8 were extracted and analyzed by SDS-PAGE electrophoresis and Western blotting (primary antibody: mouse 6×His-tagged antibody; secondary antibody: HRP-labeled goat anti-mouse IgG antibody). Results showed that BB8 exhibited a specific band at approximately 63 kDa (Cot B-IL-8 fusion protein), while BG8 showed a specific band at approximately 43 kDa (Cot G-IL-8 fusion protein); the analysis indicated that BB8 showed higher IL-8 protein expression.

[0061] 2.3 Indirect immunofluorescence assay (IFA) BB8, BG8, and WB800N spores were collected, washed with PBS, spread onto glass slides, fixed, blocked, and then treated with primary antibody and FITC-labeled secondary antibody. The results showed that WB800N spores showed no green fluorescence; BG8 spores exhibited weak green fluorescence; and the green fluorescence signal on the surface of BB8 spores was significantly stronger than that of BG8, further confirming that BB8 spores were more effective at anchoring IL-8 expression.

[0062] In summary, based on the combined results of spore count, Western blotting, and IFA, BB8 showed better surface anchoring of IL-8 in *Scorpionichthys schlegelii* than BG8. BB8 will be selected for further evaluation of its immune-enhancing effect on *Scorpionichthys schlegelii*.

[0063] Example 3: Evaluation of the immune-enhancing effect of recombinant Bacillus subtilis BB8 on Sebastes schlegelii 3.1 Test Materials Experimental animals: 300 healthy juvenile Scorpionfish (body length 6.5±0.5 cm, weight 9±2 g) were purchased from Shandong Weihai Rongcheng Shenghang Aquatic Technology Co., Ltd.

[0064] Strains: Vibrio harveyi WHSS0915 (laboratory isolation), Vibrio parahaemolyticus ATCC33847 (laboratory preservation), BB8 (constructed in Example 1).

[0065] Reagents: Extruded compound feed for turbot and flounder (Changshu Quanxing), sodium alginate (Shanghai Sangon Biotech), enzyme activation kit (Nanjing Jiancheng Biotechnology), qRT-PCR kit (Beijing TransGen Biotech), etc.

[0066] 3.2 Experimental Design and Feeding Management After being temporarily held for 14 days, the rockfish were randomly divided into 3 groups (n=100 fish / group): PBS group: fed a basal diet supplemented with PBS; WB800N group: fed diets supplemented with WB800N spores; BB8 group: fed with feed supplemented with BB8 spores.

[0067] Prepare WB800N and BB8 spores, adjusting the final concentration to 1×10⁻⁶. 8 CFU / mL, each group's diet was supplemented with 1% (w / v) sodium alginate as an encapsulating agent and dried at 40℃ for later use. During the experiment, the fish were fed twice daily (09:00 and 18:00), with a feed amount of 2% of their total body weight, for 28 days. The culture water temperature was 16℃, dissolved oxygen was 12-13 mg / L, pH was 7.9-8.2, and 2 / 3 of the seawater was changed daily.

[0068] 3.3 Growth performance determination On days 0, 7, 14, 21, and 28 of feeding, 10 fish were randomly selected from each group to measure body weight and length. Weight gain rate (WGR), specific growth rate (SGR), length gain rate (LGR), and feed efficiency (FER) were calculated. The results are shown in Table 1. The results indicate that the addition of recombinant Bacillus subtilis BB8 to the diet has a positive impact on the growth performance of *Scorpionichthys schlegelii*.

[0069] Table 1. Effects of recombinant Bacillus subtilis BB8 on the growth performance of Scorpionfish schlegelii.

[0070] Note: All experimental data are expressed as mean ± standard deviation. Different letters in a row indicate significant differences. p <0.05).

[0071] 3.4 Detection of intestinal digestive enzyme levels in Scorpionfish (Scorpionfish schlegelii) To evaluate the effect of adding recombinant Bacillus subtilis on the activity of intestinal digestive enzymes in Sebastes schlegelii, the activities of lipase, α-amylase, and trypsin in the foregut, midgut, and hindgut were analyzed.

[0072] After 28 days of feeding, the lipase activity in the foregut and midgut of the BB8 group was significantly higher than that of the WB800N group and the PBS group. p <0.05%, the lipase activity in the hindgut of the BB8 group reached the highest level, significantly higher than that of the PBS group ( p <0.05).

[0073] In the BB8 group, α-amylase activity in the foregut and midgut peaked on day 7, while α-amylase activity in the hindgut peaked on day 21. Throughout the 28-day feeding period, α-amylase activity in the foregut, midgut, and hindgut of the BB8 group remained at a high level.

[0074] In the BB8 group, enterotrypsin activity remained at a high level, significantly higher than that in the PBS group at all time points. p <0.05).

[0075] The above results indicate that the addition of recombinant Bacillus subtilis BB8 effectively improved the intestinal digestive function of Sebastes schlegelii.

[0076] 3.5 Morphological and structural analysis of the intestinal tissue of Scorpionfish Xu's To evaluate the effect of adding recombinant Bacillus subtilis on the intestinal tissue structure of Sebastes schlegelii, the tissue structures of the foregut, midgut, and hindgut were analyzed.

[0077] Compared with the PBS group without Bacillus subtilis, the intestinal villus height in the foregut, midgut, and hindgut of the groups with Bacillus subtilis was increased. Specifically, the intestinal villus height in the foregut, midgut, and hindgut of the BB8 and WB800N groups was significantly higher than that of the PBS group. p <0.05).

[0078] There were no significant differences in the width of intestinal villi in the foregut and midgut among the groups. p >0.05), while the intestinal villus width of the hindgut in the BB8 group and WB800N group was significantly higher than that in the PBS group ( p <0.05).

[0079] Regarding muscle layer thickness, the muscle layer thickness of the foregut in the BB8 group was not significantly different from that in the PBS and WB800N groups. p>0.05). The muscular layer thickness of the midgut in the BB8 group was significantly higher than that in the PBS group ( p <0.05. There was no significant difference in the muscular layer thickness of the hindgut among the groups. p >0.05).

[0080] The above results indicate that the addition of recombinant Bacillus subtilis BB8 increases the intestinal villus height and muscle layer thickness of Sebastes schlegelii, further improving its intestinal digestion and absorption of nutrients.

[0081] 3.6 Detection of antioxidant and non-specific immune-related indicators in the serum of Scorpionfish schlegelii To evaluate the effects of adding recombinant Bacillus subtilis on the antioxidant capacity and nonspecific immune levels of Sebastes schlegelii, serum antioxidant-related indicators and nonspecific immune indicators were detected.

[0082] (1) Results of detection of antioxidant-related indicators The T-AOC activity assay results showed that the BB8 group reached its highest T-AOC activity on day 28, and was significantly higher than that of the PBS group at all time points. p <0.05).

[0083] The results of T-SOD activity assay showed that the T-SOD activity in the BB8 group remained at a high level throughout, and was significantly higher than that in the PBS group and the WB800N group at all time points. p <0.05).

[0084] CAT activity assay results showed that CAT activity in the BB8 group increased, reaching its highest level on day 28, significantly higher than that in the PBS group and the WB800N group. p <0.05).

[0085] The above results indicate that the addition of recombinant Bacillus subtilis enhances the antioxidant capacity of Sebastes schlegelii.

[0086] (2) Results of non-specific immune-related indicators The IgM content detection results showed that the IgM content in the BB8 group generally increased with the extension of feeding time, reaching a peak on day 28. The IgM content in the BB8 group was significantly higher than that in the PBS group at all time points. p <0.05), on days 7 and 21, the IgM content in the BB8 group was significantly higher than that in the WB800N group ( p <0.05).

[0087] The C3 content test results showed that the C3 content in the BB8 group gradually increased with the extension of feeding time, reaching the highest level on day 28. The C3 content in the BB8 group was significantly higher than that in the PBS group and the WB800N group at all time points. p<0.05).

[0088] C4 content detection results showed that the C4 content in the BB8 group gradually increased with the extension of feeding time, reaching a peak on day 28. On days 7, 21, and 28, the C4 content in the BB8 group was significantly higher than that in the WB800N group and the PBS group. p <0.05).

[0089] The ACP activity assay results showed that the ACP activity in the BB8 group first increased, then decreased, and then increased again, reaching its highest level on day 28. Furthermore, the ACP activity at each time point was significantly higher than that in the PBS group and the WB800N group. p <0.05).

[0090] AKP activity assay results showed that the AKP activity in the BB8 group was significantly higher than that in the PBS group and the WB800N group at all time points. p <0.05).

[0091] The LZM activity test results showed that the LZM activity in the BB8 group generally increased with the extension of feeding time, and was significantly higher than that in the PBS group and the WB800N group at all time points. p <0.05). The above results indicate that the addition of recombinant Bacillus subtilis BB8 improves the non-specific immunity level of Scorpionfish.

[0092] 3.7 Total RNA extraction from various tissues of Scorpionfish schlegelii The results of total RNA extraction and detection from different tissues of Sebastes schlegelii showed that the total RNA electrophoretic bands from the liver, spleen, kidney, gills, foregut, midgut, and hindgut were complete and clear, exhibiting three bands: 28S, 18S, and 5.8S. The concentration and purity of these bands met the expected requirements.

[0093] 3.8 Intestinal tissue of Scorpionfish schlegelii CXCR1 and CXCR2 Gene relative expression analysis To evaluate the effect of adding recombinant Bacillus subtilis on the expression level of the IL-8 receptor protein-coding gene in the intestinal tissue of Sebastes schlegelii, the following study was conducted on the intestinal tissue. CXCR1 Genes and CXCR2 The relative expression levels of genes were analyzed.

[0094] After feeding recombinant Bacillus subtilis BB8, the intestinal tissue of Scorpionichthys schlegelii CXCR1 The relative expression levels of genes generally showed an upward trend. (BB8 group foregut) CXCR1 The relative expression levels of the gene showed a trend of first increasing and then decreasing, reaching their highest level on day 21. (BB8 group midgut) CXCR1 The relative expression levels of the gene were significantly higher than those in the PBS group and the WB800N group at all time points. p<0.05). BB8 group hindgut CXCR1 The relative gene expression level showed a trend of first increasing, then decreasing, and then increasing again with the extension of feeding time, reaching a peak on day 28, and was significantly higher than that of the PBS group and the WB800N group. p <0.05).

[0095] After feeding recombinant Bacillus subtilis BB8, the intestinal tissue of Scorpionichthys schlegelii CXCR2 The relative expression levels of genes showed an increasing trend. On days 21 and 28, the foregut of the BB8 group... CXCR2 The relative expression level of the gene was significantly higher than that of the PBS group and the WB800N group. p <0.05). On days 21 and 28, the midgut of BB8 group... CXCR2 The relative expression level of the gene was significantly higher than that in the PBS group. p <0.05). BB8 group hindgut CXCR2 The relative gene expression level showed a trend of first increasing and then decreasing, reaching its highest level on day 14, and was significantly higher than that of the PBS group at all time points. p <0.05). On days 7, 14, and 21, the hindgut of BB8 group... CXCR2 The relative expression level of the gene was significantly higher than that of the WB800N group. p <0.05).

[0096] The above results indicate that the addition of recombinant Bacillus subtilis can increase the expression of the IL-8 protein receptor protein-coding gene in the intestinal tissue of Scorpionichthys schlegelii. CXCR1 and CXCR2 The relative expression level.

[0097] 3.9 Analysis of the relative expression levels of immune-related genes in various tissues of Scorpionfish Xu's To assess the effect of adding recombinant Bacillus subtilis on the immune level of Sebastes schlegelii, the relative expression levels of immune-related genes in different tissues of Sebastes schlegelii were analyzed.

[0098] After feeding recombinant Bacillus subtilis NF-κB The relative expression levels of the gene showed an increasing trend in different tissues, with the highest relative expression levels in the liver and spleen. (BB8 group tissues) NF-κB The relative expression levels of the genes were significantly higher than those in the PBS group and the WB800N group. p <0.05).

[0099] BB8 group liver, spleen, kidney and gill tissue AP-1 The relative gene expression level showed a trend of first increasing, then decreasing, and then increasing again, and was significantly higher than that of the PBS group and the WB800N group at each time point. p <0.05). Spore capsid protein BB8 group liver, spleen, kidneys, gills, midgut and hindgut HIF-1 The relative expression levels of genes showed a trend of first increasing, then decreasing, and then increasing again, with the spleen showing the most significant increase. HIF-1 The relative expression level of the gene was highest in the liver, kidneys, and gills, followed by the liver, kidneys, and gills, with the lowest relative expression level in the midgut. (BB8 group tissues) HIF-1 The relative expression levels of the gene were significantly higher than those in the PBS group and the WB800N group at all time points. p <0.05).

[0100] Day 28, BB8 Group Organizations STAT3 The relative expression levels of all genes reached their highest levels, significantly higher than those in the PBS group and the WB800N group. p <0.05).

[0101] The above results indicate that the addition of recombinant Bacillus subtilis significantly improved the levels of Bacillus schlegelii in various tissues of Scorpionidae. NF-κB , AP-1 , HIF-1 and STAT3 The relative expression level of genes.

[0102] 3.10 Results of the challenge test with Scorpionfish (Sebastes schlegelii) To evaluate the resistance of recombinant Bacillus subtilis to Sebastes schlegelii V. harveyi WHSS0915 and V. parahaemolyticus The effects of ATCC33847 and its mixed infectivity on viral challenge were investigated using a challenge experiment. Results showed: V. harveyi After WHSS0915 infection, the relative protection rate in the BB8 group was 60%. V. parahaemolyticus After infection with ATCC33847, the relative protection rate in the BB8 group was 64.29%. V. harveyi WHSS0915 and V. parahaemolyticus Following co-infection with ATCC33847, the relative protection rate in the BB8 group was 71.43%. These results indicate that the addition of recombinant Bacillus subtilis enhances the resistance of *Scorpionichthys schlegelii*. V. harveyi WHSS0915 and V. parahaemolyticus ATCC33847 and its ability to cause mixed infection.

[0103] In summary, the recombinant Bacillus subtilis BB8 screened in this invention has high safety and significant effects, and can be used as the core component of the Scorpionfish immune enhancer, providing an effective technical solution for disease prevention and control in Scorpionfish aquaculture and promoting the green, healthy and sustainable development of the industry.

[0104] IL-8 Gene coding region sequence: ATGATGAGCAGCGGATTCATTGTCCTCTATTGTGGTGCTCCTGGCTTTCCTGGCCGTCAGTGAAGGGATGAGTAAGAGAAGCCTGGGAGTGGAGCTGCACTGTCGCTGCATCCAGACGGAGAGCAAACCCATCAGCCGCCACATCGAGAA GGTGGAGCTGATTCCTGCCAACTCCCATTGCGGCGAGACCGAGATCATTGCTACTCTGAAAAAGACAGGCCAAGAGGTTTTGCCTGGACCCCGAAGCTCTCTGGGTGAAGAAAGTAATTAAGAGGATCATGTCCAACAGAAGACGTTGA (SEQ ID NO.1) Optimized IL-8 Gene sequence: GGCGGCGGAGGGATGATGTCATCTGGTTTCATCGTTTCTTTCTATCGTTGTTCTTTTAGCTTTCTTAGCTGTTTCTGAAGGTATGTCTAAACGTTTCTTTAGGTGTTGAACTTCACTGTCGTTGTATCCAAACTGAATCTAAACCAATCTCTCGTCACATCGAAAAAGT AGAACTTATCCCAGCTAACTCTCACTGTGGTGAAACTGAAATCATCGCTACTCTTAAGAAAACTGGTCAAGAAGTTTGTTTAGATCCTGAAGCTCTTTGGGTTAAAAAAGTAATCAAACGTATCATGTCTAACCGTCGTCGTCACCACCACCACCACCACTAA (SEQ ID NO.2) Matters not covered in this invention are common knowledge.

[0105] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A genetically engineered recombinant Bacillus subtilis, characterized in that, The genetically engineered recombinant Bacillus subtilis uses the spore cap protein Cot B as an anchoring protein and can anchor and express IL-8 on the surface of Bacillus subtilis. The method for constructing the genetically engineered recombinant Bacillus subtilis includes the following steps: A recombinant expression vector containing the Cot B-IL-8 fusion gene was constructed, and the recombinant expression vector was transformed into Bacillus subtilis to obtain the product. The Cot B-IL-8 fusion gene was obtained by overlap extension PCR technology, wherein the Cot B gene was derived from Bacillus subtilis WB800N; the IL-8 gene was derived from Scorpionfish, and the nucleotide sequence of the IL-8 gene is shown in SEQ ID NO.2; The recombinant expression vector was obtained by ligating the expression vector with the Cot B-IL-8 fusion gene, and the expression vector was a plasmid; the plasmid was pDG364 plasmid.

2. The genetically engineered recombinant Bacillus subtilis as described in claim 1, characterized in that, The originating strain, Bacillus subtilis, is specifically Bacillus subtilis WB800N.

3. The application of the genetically engineered recombinant Bacillus subtilis according to claim 1 or 2 in the preparation of fish immune enhancers, characterized in that, The fish in question is the rockfish (Scorpionus schlegelii).

4. The application as described in claim 3, characterized in that, The immune enhancer improves the growth performance of *Scorpionichthys schlegelii*, the activity of intestinal digestive enzymes, improves intestinal tissue structure, and enhances the antioxidant capacity, non-specific immune level, and resistance to Vibrio infection in *Scorpionichthys schlegelii*; the Vibrio includes *Vibrio harveyi* and *Vibrio parahaemolyticus*.

5. A fish immune enhancer, characterized in that, The fish is a recombinant Bacillus subtilis as described in claim 1 or 2, and the fish is Sebastes schlegelii.

6. The fish immune enhancer as described in claim 5, characterized in that, The fish immune enhancer also contains sodium alginate.

Images