Litchi LcFCA gene and the protein coded by the same in promoting plant flowering

Abstract

The application discloses application of a litchi LcFCA gene and protein coded thereby in promoting plant flowering, wherein the nucleotide sequence of the litchi LcFCA gene is shown as SEQ ID NO:1, and the amino acid sequence of the protein is shown as SEQ ID NO:2. Overexpression of the litchi LcFCA gene in Arabidopsis thaliana plants can significantly advance the flowering time of the Arabidopsis thaliana, and therefore, the litchi LcFCA gene plays a key role in regulating litchi flowering, and provides important value for stabilizing the litchi flowering process and guaranteeing stable litchi production.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology. Specifically, this invention relates to the application of the litchi LcFCA gene and its encoded protein in regulating the flowering sequence of plants. Background Technology

[0002] Litchi, belonging to the Sapindaceae family and the Litchi genus, is an evergreen fruit tree widely cultivated in the subtropical regions of southern my country. It boasts a long history of cultivation and abundant germplasm resources. Unstable flowering during litchi cultivation is a significant cause of low or unstable yields; therefore, research related to litchi flowering has become a focus of attention.

[0003] The flowering process of litchi involves complex environmental and genetic factors. In-depth exploration of the molecular regulatory mechanisms of litchi flowering, and the identification and utilization of key gene resources based on this exploration, are of significant research value for promoting the stable development of the litchi industry. Summary of the Invention

[0004] Therefore, the purpose of this invention is to provide a new gene that regulates the flowering of litchi.

[0005] The specific technical solutions for achieving the above-mentioned objectives are as follows.

[0006] In a first aspect, the present invention provides the application of the litchi LcFCA gene in promoting plant flowering, wherein the nucleotide sequence of the litchi LcFCA gene is shown in SEQ ID NO:1, or the litchi LcFCA gene encodes a protein with an amino acid sequence shown in SEQ ID NO:2.

[0007] In a second aspect, the present invention provides the application of a protein encoded by the litchi LcFCA gene in promoting flowering in plants, the amino acid sequence of which is shown in SEQ ID NO:2.

[0008] A third aspect of the present invention provides the application of a recombinant expression vector overexpressing the litchi LcFCA gene in promoting plant flowering, wherein the nucleotide sequence of the litchi LcFCA gene is shown in SEQ ID NO:1.

[0009] In a fourth aspect, the invention provides the application of engineered bacteria transformed with the recombinant expression vector overexpressing the litchi LcFCA gene in promoting plant flowering.

[0010] In a fifth aspect, the present invention provides a biological agent that promotes flowering of litchi, wherein the active ingredient is the aforementioned recombinant expression vector or engineered bacteria.

[0011] In a sixth aspect, the present invention provides a method for promoting flowering of litchi, comprising the following steps: increasing the expression level of the litchi LcFCA gene in litchi plants, wherein the nucleotide sequence of the litchi LcFCA gene is shown in SEQ ID NO:1.

[0012] The inventors of this invention discovered that overexpression of the litchi LcFCA gene in Arabidopsis thaliana plants can significantly advance the flowering time of Arabidopsis thaliana. Therefore, the litchi LcFCA gene plays a key role in regulating plant flowering and provides important value for stabilizing the flowering process of litchi and ensuring stable litchi production. Attached Figure Description

[0013] Figure 1 The results show the integrity detection of the RNA extracted in Example 1 of this invention.

[0014] Figure 2 This is the identification result of T1 generation Arabidopsis thaliana plants overexpressing the litchi LcFCA gene in Example 2 of the present invention, wherein Col is a negative control.

[0015] Figure 3 The image shows the growth results of T1 generation Arabidopsis thaliana plants overexpressing the litchi LcFCA gene in Example 2 of this invention; the left image shows the pod-bearing stage of the T1 generation positive plants, and the right image shows the seed maturation stage of the T1 generation positive plants.

[0016] Figure 4 This is the result of identifying the T2 generation LcFCA transgenic Arabidopsis line using a hygromycin resistance screening plate in Example 2 of the present invention.

[0017] Figure 5 This is the identification result of T2 generation Arabidopsis thaliana plants overexpressing the litchi LcFCA gene in Example 2 of the present invention, wherein PAC is a plasmid positive control.

[0018] Figure 6 This is the flowering phenotype of Arabidopsis thaliana positive plants and wild-type plants that overexpress the LcFCA gene in Example 3 of the present invention.

[0019] Figure 7 This is a statistical result of the number of days to bolt and the number of rosette leaves at bolting in Arabidopsis thaliana positive plants (#35, #36) overexpressing the LcFCA gene and wild-type plants in Example 3 of the present invention.

[0020] Figure 8 This is the expression level of the litchi LcFCA gene in Example 4 of the present invention before the appearance of white spots on litchi. Detailed Implementation

[0021] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0022] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0023] Unless otherwise specified, all examples were performed under standard experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2013), or as recommended by the manufacturer.

[0024] In some embodiments of the present invention, the application of the litchi LcFCA gene in promoting plant flowering is disclosed, wherein the nucleotide sequence of the litchi LcFCA gene is shown in SEQ ID NO:1, or the litchi LcFCA gene encodes a protein with an amino acid sequence shown in SEQ ID NO:2.

[0025] It should be understood that, given the degeneracy of codons, equivalent substitutions or modifications to the nucleotide sequence of the above-mentioned cDNA reading frame without altering the encoded amino acid sequence also fall within the scope of protection claimed by this invention.

[0026] In one embodiment, the plant is lychee or Arabidopsis thaliana.

[0027] In other embodiments of the present invention, the application of a protein encoded by the litchi LcFCA gene in promoting plant flowering is disclosed, the amino acid sequence of which is shown in SEQ ID NO:2.

[0028] It should be understood that any sequence variants obtained by substituting, deleting, or adding one or more amino acid residues, or by modifying their ends, without affecting the structure and functional activity of the litchi LcFCA protein, are within the scope of protection of this invention.

[0029] In one embodiment, the plant is lychee or Arabidopsis thaliana.

[0030] This invention first extracts total RNA from litchi stem tips and reverse transcribes it into cDNA. Using this cDNA as a template, PCR amplification is performed using the specific primers shown in SEQ ID NO:3 and SEQ ID NO:4 to obtain the litchi LcFCA gene. This gene is then cloned into the pCAMBIA1300 vector to construct the recombinant vector pCAMBIA1300-LcFCA overexpressing the LcFCA gene. Subsequently, transgenic plants are successfully obtained by transforming Arabidopsis thaliana using Agrobacterium-mediated transformation. Statistical results on the flowering time of the transgenic Arabidopsis show that the flowering time of the transgenic plants is significantly earlier than that of wild-type Arabidopsis, suggesting that the litchi LcFCA gene may play a key role in promoting flowering.

[0031] In other embodiments of the present invention, the application of a recombinant expression vector overexpressing the litchi LcFCA gene in promoting plant flowering is disclosed, wherein the nucleotide sequence of the litchi LcFCA gene is shown in SEQ ID NO:1.

[0032] In one embodiment, the recombinant expression vector is pCAMBIA1300-LcFCA.

[0033] In one embodiment, the plant is lychee or Arabidopsis thaliana.

[0034] In other embodiments of the present invention, the application of engineered bacteria transformed with the recombinant expression vector overexpressing the litchi LcFCA gene is disclosed in promoting plant flowering, wherein the nucleotide sequence of the litchi LcFCA gene is shown in SEQ ID NO:1.

[0035] In one embodiment, the engineered bacteria is Agrobacterium.

[0036] In one embodiment, the plant is lychee or Arabidopsis thaliana.

[0037] In other embodiments of the present invention, a biological agent for promoting litchi flowering is disclosed, the active ingredient of which is the above-mentioned recombinant expression vector or engineered bacteria.

[0038] In some embodiments of the present invention, a method for promoting flowering of litchi is disclosed, comprising the following steps: increasing the expression level of the litchi LcFCA gene in litchi plants, wherein the nucleotide sequence of the litchi LcFCA gene is shown in SEQ ID NO:1.

[0039] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0040] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0041] Example 1: Obtaining the LcFCA gene from litchi

[0042] Includes the following steps:

[0043] 1. RNA extraction and cDNA cloning

[0044] Shoot tips from approximately 20 'Feizixiao' lychee trees were rapidly ground in liquid nitrogen to disrupt tissues and cells, and the powder was then transferred to 1.5 mL centrifuge tubes. Total RNA (No. 1 and No. 2) was extracted from the lychee shoot tips using the HiPure Plant RNA Mini Kit (Magen). RNA concentrations were determined using a micro-spectrophotometer; RNA No. 1 was 134.1 ng / µL, and RNA No. 2 was 281.1 ng / µL. RNA integrity was assessed by agarose gel electrophoresis, and the results are shown below. Figure 1 As shown, from Figure 1 As can be seen, the extracted total RNA was intact.

[0045] Subsequently, the first strand of cDNA was synthesized using the Vazyme HiScript® III All-in-one RT SuperMix Perfect for qPCR reverse transcription kit and stored at -80°C for later use.

[0046] Reaction system: 4 µL of 5 x All-in-one qRT SuperMix, 1 µL of Enzyme Mix, 1 µg of template RNA, and finally, bring the total volume to 20 μL with ddH2O. Reaction program: 50℃ for 15 minutes, followed by 85℃ for 5 seconds.

[0047] 2. Amplification of the litchi LcFCA gene

[0048] Using total cDNA obtained from reverse transcription as a template, specific primers (SEQ ID NO:3 and SEQ ID NO:4) were designed, and PCR amplification was performed using Phanta® Max Super-Fidelity DNA Polymerase (Vazyme) to obtain the complete coding region fragment of the litchi LcFCA gene. The primer sequences are as follows:

[0049] Forward primer LcFCA-F (SEQ ID NO:3): ATGGAGAGGCACAGAGGAGACC

[0050] Reverse primer LcFCA-R (SEQ ID NO:4): TTCTTTTGTGGAAGGTGGGACA

[0051] The PCR reaction system consisted of 2 μL each of forward and reverse primers, 2 μL of cDNA template, 25 μL of 2 x Phanta Max Buffer, 1 μL of dNTP Mix, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and finally, ddH2O to bring the total volume to 50 μL.

[0052] The PCR reaction procedure was as follows: pre-denaturation at 95℃ for 3 minutes; followed by 35 cycles of amplification, each cycle consisting of denaturation at 95℃ for 15 seconds, annealing at 58℃ for 15 seconds, and extension at 72℃ for 60 seconds; and a final extension at 72℃ for 5 minutes after the cycle.

[0053] The final PCR product was sequenced to confirm the target LcFCA gene sequence, the nucleotide sequence of which is shown in SEQ ID NO:1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO:2.

[0054] SEQ ID NO:1

[0055]

[0056] SEQ ID NO:2

[0057] MERHRGDRFYGGNNNNSNNFDSHSQDSHQYNNNRHNNRPSRFSDAPISRFNNNNATNEDSSYHHYDRRRSSPSEFRVAGAGGGHRPFDSPPPPAGVGGPGGGFRPTSGAGGVGGGGMFRPMGGGGGFGPSYPMPPPPVSQLSGQKRGFSGRGGPSPDGSDGGSFAKLFVGSVPKTATEDDIRPLFEDHGRVVEVALIKDKRTGQQQGCCFIKYATSEEADRAIRALHNQHTLPGGAGPIQVRYADGERERLGAVEYKLFVGSLNKQATEKEVEEIFSPYGRVEDVYLMRDELKQSRGCGFVKYSHRDMALAAINALNGIYTMRGCDQPLTVRFADPKRPRPGDSRNPSFGGPGFGPRFQPPGPRPAPSFGDPIGDRMPPHAWHPMSPQNMGPNPSIRGFGNQLLPRSGDLAIPSNMGGPLGGHGGPADGPLPGLPISSSTTSATQLGFNPPLSQVPSHGQHISPLQKPRQSPQHMPPSLQLHPQAPPYSQTQTSPVGQLQIPGQTPFGQALPSQHLPAISGPSSASQSHIQQIPSSATALTPPNINLQSSSLPTPTNQQQLPALVQQQLLQPLQQSPSQLAQMLSQQTQTLQASFQSSQQAFSQLQQQLQLMQPSNQSLALQQSSQASKQQWPGISSQSAASVPASTPAAEVPSSMSAVSAVPVVSQTAAPVKCNWTEHTSPDGYKYYYNNITGESKWEKPEELTSFEQQQQQQKPPVQQLQTQSHPKVMPAQQVPQTQQVQLQTQLRQQQQQQQQPFPSSYQASGGIGQHNPQEIGYGQVPVVVNDPTRFQQGLQATQEWMWKNKPSGLKRFHWLCTSFLLLSIPVPPSTKE

[0058] Example 2 Construction of Overexpression Vector pCAMBIA1300-LcFCA and Identification of Transgenic Positive Plants

[0059] Comprising the following steps:

[0060] 1. The PCR amplification product obtained in Example 1 was recovered and purified. The LcFCA gene fragment was ligated into the pCAMBIA1300 vector using in-fusion technology (this plasmid is stored in the applicant's laboratory and can also be purchased commercially). The recombinant ligation product was transformed into E. coli competent cells, and positive clones were screened by antibiotic plates and sent for sequencing verification.

[0061] 2. Using the liquid nitrogen freeze-thaw method, the recombinant plasmid, verified by sequencing, was introduced into Agrobacterium GV3101 (p19) competent cells. Dual antibiotic selection was performed using 50 mg / L rifampin (Rif) and 50 mg / L kanamycin (Kan). The resulting monoclonal colonies were then identified by PCR to confirm positive transformants.

[0062] 3. Inoculate the positive Agrobacterium species into 50 mL LB liquid medium containing 50 mg / L Rif and 50 mg / L Kan, and incubate overnight in a shaker at 28°C. Monitor the bacterial concentration, and stop incubation when the OD value reaches 0.8–1.0. Subsequently, collect the bacterial cells by centrifugation at 4000 rpm for 10 minutes at 28°C.

[0063] 4. The collected bacterial cells were resuspended in 50 mL of infection solution (including 5% sucrose and 0.02% Silwet-77). Arabidopsis thaliana was then transformed using Agrobacterium-mediated flower immersion transformation, with an infection time of 20-30 seconds. The plants were then cultured in the dark for 24 hours.

[0064] 5. The transformed Arabidopsis plants were restored to light and transplanted to an artificial climate culture chamber for continued growth. Once the plants matured, their T1 generation seeds were collected. Three T1 generation LcFCA transgenic Arabidopsis lines were randomly selected, and their genotypes were determined by PCR. The results are as follows: Figure 2 As shown, all three T1 generation LcFCA transgenic Arabidopsis thaliana lines were positive plants.

[0065] 6. Harvested T1 generation Arabidopsis seeds were sown in 1 / 2 MS medium supplemented with 50 mg / L hygromycin for selection. After two true leaves emerged, seedlings were transplanted into a substrate (a 1:1 mixture of potting soil and vermiculite) and placed in an artificial climate chamber for cultivation until maturity. The light intensity during cultivation was set at 100 µmol / m². -2 s -1 The photoperiod is 16 hours of light / 8 hours of darkness. The growth of T1 generation transgenic Arabidopsis plants is as follows: Figure 3 As shown, the plant has robust inflorescences, produces plump pods, and both the plant and pods are in good condition after ripening. T2 generation seeds are harvested after the plant matures.

[0066] 7. T2 generation seeds were sown in 1 / 2 MS medium supplemented with 50 mg / L hygromycin for further selection. The results are as follows: Figure 4 As shown, the Col negative control seeds had small cotyledons after germination, which could not fully unfold, and root growth was inhibited. The transgenic positive plants (56, 57, and 58 in the figure represent randomly selected samples) had larger, fully unfolded cotyledons compared to the control, and developed normal radicles. Positive identification was performed on three representative T2 generation Arabidopsis plants (#35, #36, and #37) using specific detection primers (SEQ ID NO:5 and SEQ ID NO:6). The results are as follows... Figure 5 As shown, the results indicate that all three representative T2 generation Arabidopsis thaliana plants (represented as UBQ:LcFCA-GFP in the figure) were positive plants.

[0067] Detection primer F (SEQ ID NO:5): ATGGAGAGGCACAGAGGAGACCGT

[0068] Detection primer R (SEQ ID NO:6): tcttgaagaagtcgtgccgc

[0069] Example 3: Flowering phenotype analysis of transgenic plants overexpressing the litchi LcFCA gene

[0070] Transgenic Arabidopsis thaliana T2 generation seeds and control wild-type Arabidopsis thaliana seeds (10 plants per genotype, 3 biological replicates) were simultaneously sown in a sterilized substrate (nutrient soil and vermiculite mixed in a 1:1 ratio). Their growth was observed until flowering and bolting, and the total number of growth days from sowing to the appearance of the first flower was recorded.

[0071] Figure 6 A comparison of the flowering phenotypes of wild-type Arabidopsis thaliana (Col) and transgenic lines overexpressing the litchi LcFCA gene (UBQ:LcFCA-GFP) at 34 days of growth clearly shows that the transgenic line overexpressing the litchi LcFCA gene has successfully completed flowering and bolting, while wild-type Arabidopsis thaliana (Col) is still in the vegetative growth stage and no flower stalks have been formed.

[0072] Figure 7 This study statistically analyzed the flowering time and the number of rosette leaves at bolting in the transgenic line (UBQ:LcFCA-GFP) overexpressing the litchi LcFCA gene. The results showed that the average flowering time of the transgenic line (UBQ:LcFCA-GFP) was approximately 34 days, while the average flowering time of the wild-type plant (Col) was 37 days, indicating a significant difference in the number of days required for flowering. Furthermore, at bolting, the transgenic plant (UBQ:LcFCA-GFP) had an average of 18 rosette leaves, while the wild-type plant (Col) had an average of 20 rosette leaves.

[0073] The results of this embodiment show that overexpression of the LcFCA gene can cause Arabidopsis thaliana to flower earlier and enter the reproductive growth stage earlier, suggesting that the litchi LcFCA gene may play an important role in regulating the flowering time of plants.

[0074] Example 4: Expression changes of the litchi LcFCA gene before the appearance of white spots on litchi.

[0075] Shoots were collected at weeks 10, 8, 6, 4, and 2 before the appearance of white spots. At each time point, approximately 20 litchi shoot tips were collected, and total RNA was extracted from the shoot tips according to the method in Example 1. cDNA was then synthesized. Using the total cDNA obtained through reverse transcription as a template, specific primers (SEQ ID NO:7 and SEQ ID NO:8) were designed, and RT-qPCR amplification was performed using ChamQ Universal SYBR qPCRMaster Mix (Vazyme). The primer sequences are as follows:

[0076] Forward primer (SEQ ID NO:7): AGCTGCACCTGTTGTGTTTG

[0077] Reverse primer (SEQ ID NO:8): CTGAACACACCTCCCCTGAT

[0078] The RT-qPCR reaction system consisted of 0.4 μL each of forward and reverse primers, 5 μL of cDNA template, 10 μL of 2 x ChamQUniversal SYBR qPCR Master Mix, and finally, ddH2O was added to bring the total volume to 20 μL.

[0079] The RT-qPCR reaction program was as follows: pre-denaturation at 95℃ for 30 seconds; followed by 40 cycles of amplification, each cycle including denaturation at 95℃ for 10 seconds, annealing at 60℃ and extension for 30 seconds; melting curve acquisition included reaction at 95℃ for 15 seconds, reaction at 60℃ for 60 seconds, and treatment at 95℃ for 15 seconds.

[0080] The results are as follows Figure 8 As shown, the results indicated that the expression level of LcFCA mRNA reached 3.5-fold and 4.5-fold higher than that 10 weeks prior, respectively, 4 weeks and 2 weeks before the appearance of white spots on litchi. This suggests that 2 to 4 weeks before the appearance of white spots, a marker of flower bud differentiation, is a critical stage for LcFCA gene expression and plays a decisive role in the flowering process. The high level of LcFCA gene expression during this period further confirms its important role in promoting litchi flower bud differentiation and flowering.

[0081] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0082] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Lychee LcFCA The application of genes in promoting plant flowering, specifically in litchi. LcFCA The nucleotide sequence of the gene is shown in SEQ ID NO:1, or the litchi described. LcFCA The gene encodes a protein with the amino acid sequence shown in SEQ ID NO:2, and the plant is litchi or Arabidopsis thaliana.

2. Lychee LcFCA The application of a gene-encoded protein in promoting plant flowering, the amino acid sequence of which is shown in SEQ ID NO:2, and the plant is litchi or Arabidopsis thaliana.

3. Overexpression of lychee LcFCA The application of recombinant gene expression vectors in promoting plant flowering, specifically in litchi. LcFCA The nucleotide sequence of the gene is shown in SEQ ID NO:1, and the plant is litchi or Arabidopsis thaliana.

4. The application according to claim 3, characterized in that, The recombinant expression vector is pCAMBIA1300-LcFCA .

5. Transformation and overexpression of litchi LcFCA The application of engineered bacteria using recombinant gene expression vectors in promoting plant flowering, specifically in litchi. LcFCA The nucleotide sequence of the gene is shown in SEQ ID NO:1, and the plant is litchi or Arabidopsis thaliana.

6. The application according to claim 5, characterized in that, The engineered bacteria is Agrobacterium.

7. A biological agent for promoting litchi flowering, characterized in that, Its active ingredient is overexpressed lychee. LcFCA Recombinant expression vectors of genes or transformed overexpressing litchi LcFCA Engineered bacteria using recombinant gene expression vectors, specifically litchi. LcFCA The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

8. A method for promoting lychee flowering, characterized in that, Includes the following steps: Increase the amount of litchi in litchi plants LcFCA The expression level of the gene, in the litchi LcFCA The nucleotide sequence of the gene is shown in SEQ ID NO:1.

Images