Heat-resistant gene ZmMPK7 and application thereof in improving plant heat resistance
By cloning and overexpressing the maize filament activating protein kinase gene ZmMPK7, the problem of unclear molecular mechanisms of maize's response to high-temperature stress was solved, resulting in a significant improvement in plant heat resistance and providing new breeding resources.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HEBEI ACADEMY OF AGRI & FORESTRY SCI INST OF GENETICS & PHYSIOLOGY
- Filing Date
- 2025-12-23
- Publication Date
- 2026-07-14
AI Technical Summary
In the current technology, the molecular mechanism of maize's resistance to high temperature stress is still unclear, and there is a lack of effective heat-resistant gene resources, which leads to the slow progress of heat-resistant maize breeding.
The maize filament cleavage activating protein kinase gene ZmMPK7 was cloned and validated. By binding to downstream heat shock transcription factors, it regulates the expression of heat resistance genes. The gene was overexpressed in plants using Agrobacterium-mediated genetic transformation to enhance heat resistance.
It significantly improved the heat resistance of plants, provided new genetic resources for heat-resistant maize breeding, and enhanced the survival ability of plants in high-temperature environments.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular biology and genetic engineering technology. Specifically, it involves the verification and application of the heat resistance function of the maize heat resistance gene ZmMPK7. Background Technology
[0002] In-depth research into the response mechanisms of maize to high-temperature stress and the discovery of potential heat-resistant genes will contribute to the genetic improvement of maize's heat resistance, thereby stabilizing the yield and quality of food crops under increasingly warming climate conditions. The rapid development of biotechnology has provided new avenues for plant breeding. Genetic engineering allows for targeted genetic improvement of crops, and it has already demonstrated significant value in cultivating new stress-resistant crop varieties (materials). Therefore, the discovery and identification of heat-resistant genes are of great importance for creating heat-resistant transgenic plants using genetic engineering and accelerating the process of heat-resistant maize breeding.
[0003] Compared to transcriptional regulation, post-translational regulation—the modification of existing proteins within the cell—is a rapid and economical regulatory mechanism. Mitogen-activated protein kinases (MAPKs) are highly conserved and functionally important signaling molecules involved in intracellular protein phosphorylation. They function downstream of receptors / signal receptors, acting on specific transcription factors or proteins to coordinate corresponding cellular responses, enabling normal plant growth and development, immune responses, and rapid responses to abiotic stresses. However, whether and how MAPKs mediate Hsf involvement in the molecular mechanism of maize's response to high-temperature stress remains unclear. Discovering and identifying functional genes within the large family of maize mitogen-activated protein kinases can provide genetic resources for crop stress resistance improvement breeding. Summary of the Invention
[0004] The purpose of this invention is to provide a heat-resistant maize gene ZmMPK7, to elucidate the function of this gene in response to heat stress, and its role in cultivating heat-resistant plants.
[0005] The present invention adopts the following technical solution:
[0006] A maize mitogen-activated protein kinase gene, ZmMPK7, has the nucleotide sequence shown in SEQ ID No. 1. ZmMPK7 is highly expressed in response to heat stress and binds to downstream heat shock transcription factors, regulating the expression of heat-resistant genes.
[0007] A protein encoded by the aforementioned corn filament cleavage-activated protein kinase ZmMPK7, the amino acid sequence of which is shown in SEQ ID NO.2.
[0008] A primer pair for amplifying the maize mitogen-activated protein kinase gene ZmMPK7 is disclosed. The forward primer sequence is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4. The primer pairs SEQ ID NO.3 and SEQ ID NO.4 can amplify the ZmMPK7 gene from maize Jinhe 21. Primer pairs for amplifying any fragment of ZmMPK7 are also within the scope of this invention.
[0009] A method for amplifying the above-mentioned maize mitogen-activated protein kinase gene ZmMPK7, the method comprising the following steps: using cDNA of maize variety Jinhe 21 as a template, performing PCR amplification using the above-mentioned primer pair to obtain the heat-resistant gene ZmMPK7; the PCR amplification program includes: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.
[0010] An expression vector comprising the maize filament cleavage-activated protein kinase gene ZmMPK7, further wherein the expression vector is pCAMBIA1300-ZmMPK7.
[0011] A method for improving heat resistance in plants is provided, comprising the following steps: expressing or overexpressing the heat resistance gene ZmMPK7 in the plant genome.
[0012] Preferably, the overexpression includes using genetic transformation to transfer the recombinant vector into the genome of a plant to obtain a plant with improved heat resistance.
[0013] Beneficial Effects: This invention provides a heat-resistant gene ZmMPK7, which was isolated and cloned from the superior maize variety Jinhe 21. Its nucleotide sequence is shown in SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO. 2, containing a 1194 bp open reading frame (ORF) encoding 398 amino acids with a predicted molecular weight of 42 kDa. In this embodiment, after obtaining the full-length ZmMPK7 gene, it was expressed in wild-type Arabidopsis thaliana using Agrobacterium-mediated genetic transformation. The resulting transgenic plants were verified for biological function. The results showed that the heat resistance of the wild-type Arabidopsis thaliana transgenic plants was significantly improved. Based on the heat-resistant gene ZmMPK7 described in this invention, the heat resistance of plants can be effectively improved, providing a new gene resource for molecular breeding of plant heat resistance. Introducing this gene into plants through Agrobacterium-mediated transformation and cultivating new lines can create new genetic resources for the implementation of green agriculture. Attached Figure Description
[0014] Figure 1 Agarose gel electrophoresis image of the cloned ZmMPK7 gene.
[0015] Figure 2 This is a graph showing the expression of ZmMPK7 in maize leaves after heat stress.
[0016] Figure 3 Figure showing how the introduction of the ZmMPK7 gene into wild-type Arabidopsis thaliana improves the plant's heat resistance. Detailed Implementation
[0017] The present invention will be further described below with reference to the embodiments and accompanying drawings.
[0018] Example 1: Cloning of the ZmMPK7 gene.
[0019] Total RNA was extracted from the leaves of maize variety Jinhe 21 using Redzol lysis buffer (Beijing Saibaisheng, operation method according to the instructions). The quality and concentration of RNA were detected to obtain RNA that met the experimental requirements.
[0020] Using the reagents in the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific), and with the extracted RNA as a template, the first-strand cDNA was synthesized according to the instructions.
[0021] Using the high-fidelity enzyme PrimerStar from Takara, PCR amplification was performed using the forward primer SEQ ID NO.3 and the reverse primer SEQ ID NO.4. The amplification program was as follows: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.
[0022] The amplification products were separated by agarose gel electrophoresis. Figure 1 Obtained by cloning ZmMPK7 Agarose gel electrophoresis showed clear bands between 1000-1200 bp. The target fragment was excised from the gel and recovered using the TaKaRa MiniBEST AgaroseGel DNA Extraction Kit. Ligation of the fragment to the vector was performed using the p-EASY-Bluntcloning kit from Beijing TransGen Biotech Co., Ltd. The ligated plasmid was transformed into competent E. coli cells, and antibiotic selection was performed. Single clones were selected for PCR verification and then sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.
[0023] Example 2: ZmMPK7 gene expression analysis
[0024] Two-leaf-one-core stage maize seedlings with uniform growth were selected and subjected to heat stress treatment. They were placed in a culture room with a temperature of 25℃, a relative humidity of 50%~60%, a photoperiod of 16 h / 8 h (light / dark), and a light intensity of 55,500 lx. Two-week-old maize seedlings with similar growth were selected and divided into two groups. One group was cultured normally, while the other group was treated at 55℃ for 13 h in a plant light incubator (the heat treatment conditions were determined through preliminary experiments). The maize seedlings showed obvious wilting. After returning to normal culture for one week, the leaves were immediately placed in liquid nitrogen, frozen and crushed, and stored in an ultra-low temperature freezer at -80℃ for later use.
[0025] Based on the gene sequence characteristics of maize ZmMPK7, semi-quantitative PCR primers were designed. The forward primer sequence is: ATGGACGGCGGGGGGCAGCCCCCGG, and the reverse primer sequence is: CTACTGGTAATCTGGGTTGAATGCA. All primer sequences were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0026] Figure 2 As shown, the ZmMPK7 gene is strongly expressed in leaves after induction under heat stress, suggesting that it may play a role in resisting heat stress.
[0027] Example 3 Construction of plant expression vector (pCAMBIA1300-ZmMPK7)
[0028] Using recombination methods ZmMPK7 The gene was constructed into the binary expression vector pCAMBIA1300. First, the 35S promoter was inserted between the Hind III and XbaI restriction sites at the multiple cloning site of pCAMBIA1300 using a restriction enzyme ligation method. Second, the NOS terminator was inserted between the Sac I and EcoRI restriction sites at the multiple cloning site of pCAMBIA1300 using a restriction enzyme ligation method. Third, amplification was performed using the ClonExpress II (Novozymes Biotechnology Co., Ltd.) recombinant reaction system. ZmMPK7 Specific primers were used to digest the modified vector with restriction endonucleases XbaI and SacI (NEB). The PCR product was mixed with the linearized vector at a 1:2 molar ratio, and the recombination reaction was carried out using ClonExpress II rapid cloning technology. ZmMPK7The gene was inserted between the 35S promoter and the NOS terminator. The total ligation reaction mixture consisted of: 4 µL 5×ClonExpress II Buffer, 50–200 ng linearized vector, 20–200 ng amplified insert, 2 µL Exnase II, and sterile water to a total volume of 20 µL. After mixing all components, the mixture was incubated at 37°C for 30 min. After the reaction was complete, the mixture was immediately cooled in an ice bath for 5 min.
[0029] The ligation product was then transformed into Agrobacterium competent cells, and screened in LB solid medium containing 50 mg / L kanamycin. Single clones that tested positive by PCR were sent to the company for sequencing. Sequencing confirmed that the reading frame was completely correct, indicating that the pCAMBIA1300-ZmMPK7 recombinant vector was successfully constructed.
[0030] Example 4: Application of ZmMPK7 in improving the heat resistance of Arabidopsis thaliana
[0031] 1. The steps of Agrobacterium tumefaciens-mediated genetic transformation of Arabidopsis thaliana are as follows: Take fresh Agrobacterium tumefaciens suspension, streak it on LB agar plates (containing 50 mg / L kanamycin and 25 mg / L rifampin), scrape off the streaks, add them to 1 / 2 MS liquid medium, and incubate at 28℃ with shaking at 200 rpm. When the bacterial concentration reaches OD600 = 0.8-1.2, perform inoculation; immerse Arabidopsis thaliana plants in the Agrobacterium suspension for 1-3 min, then remove them, place them on a tray, cover them with plastic wrap, and keep them in the dark overnight; one day later, remove the plastic wrap to allow ventilation, straighten the Arabidopsis thaliana plants, and culture them normally until the seeds mature.
[0032] 2. Screening of transgenic plants: After the genetically transformed Arabidopsis thaliana matured, the seeds were harvested (T0 generation), sterilized, and sown on MS medium containing 25 µg / ml hygromycin. Vernalization was carried out at 4°C for 3 days, followed by normal light cultivation. One week later, Arabidopsis thaliana seedlings incorporating the exogenous gene could be identified (T1 generation). Because the binary vector contained a hygromycin resistance site, the resistant seedlings had green cotyledons, longer hypocotyls, elongated roots, and developed two normal true leaves; while the non-transformed plants lacked resistance, their cotyledons remained green but they did not develop normal true leaves, and their radicles ceased growth.
[0033] Resistant plants were transplanted and cultured further to collect T1 generation seeds. These T1 seeds were then sown on a medium containing 25 µg / ml hygromycin for further selection. The segregation ratio of the offspring (T2 generation) was used to determine whether it was a single-point insertion.
[0034] Transgenic plants with single-site insertion were selected and transplanted. Seeds were collected from each plant (T3 generation) and planted on a medium containing 25 µg / ml MS for further screening of homozygotes. Those that did not segregate were considered homozygotes.
[0035] 3. Identification of tolerance in transgenic Arabidopsis thaliana.
[0036] After sterilization, wild-type and ZmMPK7 transgenic homozygous Arabidopsis thaliana seeds were evenly spotted onto 1 / 2 MS solid medium for wreath experiments. Approximately 50 seeds were spotted on each line. The petri dishes were sealed with tape and placed in a 4°C refrigerator for vernalization in the dark for 3 days. After that, they were placed in a 22°C light incubator for 5 days. Then, they were subjected to basic heat treatment: 45°C heat shock for 50 min, followed by 22°C recovery for 2 days. The experiment was repeated 3 times. Phenotypic observations were performed and photographs were taken for recording.
[0037] Figure 3 shows that *Col* represents wild-type *Arabidopsis thaliana*, and lines 5-15, 5-16, 5-18, 4-2, and 4-16 are *Arabidopsis thaliana* lines transfected with the ZmMPK7 gene. Under normal conditions, the growth of the *Arabidopsis thaliana* lines transfected with the ZmMPK7 gene was not significantly different from that of the wild type. Under heat stress, the *Arabidopsis thaliana* lines transfected with the ZmMPK7 gene grew better than the wild type, indicating that transfecting with the ZmMPK7 gene can enhance the heat resistance of plants.
[0038] The embodiments described above are merely preferred embodiments of the present invention, but are not limited thereto. Those skilled in the art can easily understand the spirit of the present invention based on the above embodiments and make different extensions and variations, but as long as they do not depart from the spirit of the present invention, they are all within the protection scope of the present invention.
Claims
1. The application of the heat-resistant gene ZmMPK7 or its encoded protein in improving the heat resistance of plants, wherein the nucleotide sequence of the heat-resistant gene ZmMPK7 is shown in SEQ ID NO.1, a recombinant vector is constructed using the ZmMPK7 gene, and the recombinant vector is transferred into plants to improve the heat resistance of plants, wherein the plants are Arabidopsis thaliana or maize.
2. The application according to claim 1, characterized in that, The base vector of the recombinant vector includes the pCAMBIA1300 vector, and the heat-resistant gene ZmMPK7 is inserted between the XbaI and SacI sites of the base vector.
3. The application according to claim 1, characterized in that, Using genetic transformation, the recombinant vector described in claim 2 is transferred into the genome of a plant to overexpress the heat-resistant gene ZmMPK7, thereby obtaining a plant with improved heat resistance.