Application of RNASEH2B gene SNP molecular marker in assessing growth and slaughter traits in chickens

Abstract

This invention discloses the application of the RNASEH2B gene SNP molecular marker in assessing chicken growth and slaughter traits, belonging to the field of chicken genetics and breeding technology. The SNP molecular marker is located at position 352 of the nucleotide sequence shown in SEQ ID NO.1, with a base polymorphism of C or T. This polymorphic site is significantly correlated with chicken growth and slaughter traits. The SNP molecular marker genotypes, from highest to lowest, are TT, CT, and CC. This can accurately predict the final changes in body weight and slaughter performance at each stage of chicken development, and can be used for early screening of chicken growth and slaughter traits, significantly reducing screening costs, accelerating the genetic breeding process, and effectively improving breeding efficiency. It has high economic and scientific research value.

Description

Technical Field

[0001] This invention relates to the field of chicken genetics and breeding technology, specifically to the application of the RNASEH2B gene SNP molecular marker in assessing chicken growth and slaughter traits. Background Technology

[0002] Chickens are currently the most widely raised poultry species. Weight at different weeks of age and slaughter performance at slaughter age are key indicators for evaluating broiler production performance, which directly affect consumer choices and corporate economic interests. They are among the most important growth and slaughter traits of broilers and are often used as breeding targets.

[0003] The slaughter performance of broilers is closely related to their body weight at different weeks of age and their slaughter age, reflecting their growth potential, maturity, and productivity. Traditional methods for selecting broiler slaughter traits require waiting until chicks reach slaughter age to obtain accurate slaughter trait data. This data is then used to determine the breeding value of closely related individuals, ultimately deciding whether to retain or cull those closely related individuals. Individuals with obtained slaughter data cannot be used for breeding due to slaughter. This method is time-consuming, costly, and inefficient, necessitating the application of molecular breeding techniques to improve the efficiency of selecting broiler slaughter traits.

[0004] In recent years, molecular breeding techniques such as marker-assisted selection and genomic selection have been increasingly applied in broiler breeding. These techniques have also provided valuable insights into the genetic mechanisms of target traits in broiler breeding. Given the importance of body weight at different ages and slaughter performance at market age, researchers have conducted extensive studies on related candidate genes and molecular markers. However, current research findings are limited, which restricts practical application. Summary of the Invention

[0005] The purpose of this invention is to address the problems of long breeding cycles and high costs in traditional chicken growth and slaughter traits selection, and the limited application of molecular breeding technology in this area, by providing the application of RNASEH2B gene SNP molecular markers in evaluating chicken growth and slaughter traits.

[0006] The technical solution of this invention is described in detail below: In a first aspect, this invention provides the application of the RNASEH2B gene SNP molecular marker in assessing growth and slaughter traits in chickens. The SNP molecular marker is located at position 171263700 on chicken chromosome 1 (Chr1:171263700, the 87365th bp of RNASEH2B), specifically position 352 of the nucleotide sequence shown in SEQ ID NO.1, with a base polymorphism of C or T. When this SNP (single nucleotide polymorphism) site is T, the chicken exhibits greater body weight and body size traits.

[0007] The growth and slaughter traits of the chicken include at least three of the following: 10-week-old body weight, 12-week-old body weight, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight.

[0008] It should be understood that the RNASEH2B gene SNP molecular marker described in this invention can be any length of genomic fragment containing the SNP site at position 171,263,700 on chicken chromosome 1, as long as the primers designed to amplify the SNP site when used as the target gene are sufficient. Generally, the target gene length is between 200-700 bp.

[0009] Secondly, this invention provides the application of a reagent for detecting the RNASEH2B gene SNP molecular marker in the preparation of products for evaluating chicken growth and slaughter traits. The reagent includes primer pairs, the nucleotide sequences of which are shown in SEQ ID NO. 2-3. The SNP molecular marker is located at position 352 of the nucleotide sequence shown in SEQ ID NO. 1, and the base polymorphism is C or T. The SNP molecular marker genotypes of chickens, from high to low, are TT, CT, and CC.

[0010] Thirdly, this invention provides the application of a reagent for detecting the SNP molecular marker of the RNASEH2B gene in chicken genetic breeding. It is used to screen or identify growth and slaughter traits in chickens. The SNP molecular marker is located at position 352 of the nucleotide sequence shown in SEQ ID NO.1, and the base polymorphism is C or T. The SNP molecular marker genotypes of chickens from high to low growth and slaughter traits are TT, CT, and CC.

[0011] Fourthly, the present invention provides a method for screening or identifying growth and slaughter traits of chickens, comprising the following steps: (1) Collect chicken blood samples and extract genomic DNA; (2) Using genomic DNA as a template, design amplification primers and perform PCR to amplify the target gene fragment containing the SNP molecular marker to obtain the amplification product; the SNP molecular marker is located at position 352 of the nucleotide sequence shown in SEQ ID NO.1, and the base polymorphism is C or T; (3) Sequencing the amplified products to obtain the genotype of the SNP molecular marker. The SNP molecular marker genotypes of chicken growth and slaughter traits from high to low are TT, CT, and CC. The growth and slaughter traits of chicken include at least three of the following: 10-week-old body weight, 12-week-old body weight, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight.

[0012] Compared with the prior art, the present invention has the following beneficial effects: This invention identifies a single SNP molecular marker associated with growth and slaughter traits in chickens, located at position 171263700 on chromosome 1 (Chr1:171263700), and is part of the RNASEH2B gene. This invention also provides the target sequence containing this SNP site, SEQ ID NO.1. Detection using designed primers can accurately obtain the polymorphism of this site, allowing for a relatively accurate prediction of the final changes in growth and slaughter traits during future chicken development based on its polymorphic characteristics. This can be used for early screening of chicken growth and slaughter traits, significantly reducing screening costs and effectively improving breeding efficiency. Attached Figure Description

[0013] Figure 1 The Manhattan plot and QQ plot are used to illustrate the genome-wide association analysis of chicken body weight at 10 weeks of age in this example. Figure 2 The Manhattan plot and QQ plot are used to illustrate the genome-wide association analysis of chicken body weight at 12 weeks of age in this example. Figure 3 The Manhattan plot and QQ plot are used for genome-wide association analysis of chicken slaughter weight in the examples; Figure 4 The Manhattan plot and QQ plot are used for genome-wide association analysis of whole eviscerated weight of chickens in the examples; Figure 5 The Manhattan plot and QQ plot are used for genome-wide association analysis of semi-eviscerated chicken weight in the example. Figure 6 The Manhattan plot and QQ plot are shown in the example of genome-wide association analysis of chicken breast muscle weight; Figure 7 The Manhattan plot and QQ plot are used for genome-wide association analysis of chicken leg muscle weight in the example. Figure 8 Manhattan plot and QQ plot of genome-wide association analysis of chicken wing weight in the example; Figure 9 The Sankey bubble diagram is used for KEGG enrichment analysis of genes in candidate regions of eight chicken traits in the example. Detailed Implementation

[0014] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.

[0015] Example 1 Blood samples and eight body size trait data (body weight at 10 weeks of age, body weight at 12 weeks of age, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight) were collected from 648 yellow-feathered broilers at a chicken farm in Guangzhou, Guangdong Province. Raw sequencing data were obtained through second-generation whole-genome resequencing using the MGISEQ™ sequencing system.

[0016] To ensure data quality and accuracy, rigorous quality control was performed on the raw genome sequencing data of 648 yellow-feathered broiler chickens. First, Trimmomatic (v0.36) software was used for quality filtering and removal of low-quality sequences. Then, BWA (v0.7.17) software was used to align the filtered sequences to the GRCg6a reference genome of the Red Junglefowl (ancestor of domestic chickens) (NCBI accession number GCF_000002315.6) to identify SNPs. Finally, GATK (v4.2.3.0) software was used for further screening and filtering of SNPs, and Plink (v1.90b6.21) software was used for quality control and extraction of these SNPs, retaining a minimum allele frequency (MAF) >0.05, a genotype deletion rate of less than 10%, and passing the Hardy-Weinberg equilibrium test (p<10). −6 ), and in the SNPs of autosomes, a total of 6,302,794 SNP loci were finally obtained.

[0017] Based on phenotypic data, an additive-dominant model from the ADDO package was used to construct genomic relation matrices and perform genome-wide association studies (GWAS) on all eight traits (10-week-old body weight, 12-week-old body weight, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight). GWAS is a method for studying the genetic mechanisms of complex traits, primarily identifying the genetic factors influencing phenotypic traits by analyzing the association between phenotypic traits and gene variation. GWAS was performed on 4,965,204 SNPs retaining three genotypes. Based on the GWAS results, the p-value of each SNP locus was converted to -log. 10 (P), the threshold for significant SNPs is 1 / n (n is the number of SNPs). Finally, significant SNPs are selected for further analysis, and Manhattan plots and Quantile-Quantile plots (QQ plots) are drawn using the ggplot2 and CMplot packages in R. See [link / reference]. Figure 1-8 .

[0018] Significant SNPs within a 1.5 Mb range were merged to form a candidate region. The R package clusterProfiler (v4.16.0) was used to perform Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis on all eight traits (10-week-old body weight, 12-week-old body weight, carcass weight, eviscerated weight, semi-eviscerated weight, pectoral muscle weight, leg muscle weight, and wing weight) of the candidate regions to predict the enrichment pathways of all genes within the candidate regions. The results are as follows: Figure 9 .

[0019] Combining the results of GWAS and enrichment analysis, we screened out the chr1:171263700 polymorphic locus in 8 traits (10-week-old body weight, 12-week-old body weight, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight). This locus was significant in both GWAS and enrichment analysis of different traits, as shown in Table 1.

[0020] Table 1. P-values ​​of chr1:171263700 polymorphic loci in different traits according to GWAS. The association analysis results between the chr1: 171263700 polymorphic site and growth and slaughter traits are shown in Table 2 below.

[0021] Table 2 Association analysis of Chr1: 171263700 polymorphic loci with growth and slaughter traits Note: Values ​​labeled with different letters show significant differences, while values ​​labeled with the same letter show no significant differences.

[0022] In both rooster and hen populations, this locus was significantly associated with eight traits (body weight at 10 weeks of age, body weight at 12 weeks of age, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight).

[0023] In this embodiment, the molecular marker nucleotide sequence containing the chr1:171263700 polymorphic site is as follows: GCATCCTTGAGCAAGTCCTATAATAATTACTTGATTTTGTATGAATTTTCTGTTTTCTGGTTGTTTTTAACAGCAAATGATTTTGCTGGCCATATTTTAAAGATTTAGAAGTTGTGTAGCAAAATGCTTTATGCAATTTTCACATTTATGTTTCAAATTCTAGCCACATTCAGCAAAATGCTCTTTT GGACTAAAAGTCCATTTGTTTAGATTGGAAATCATCAAAAAAATGAAACATATTAACTGTTTATATTTTAAGGACATTTCAATTTTTTTCCTTAAATTCTTTTCTTAAATTCTTTTTCTTCACTGAATTTAATCTGAATGATTTTGTCCAACCCTGTTCTGGTGTGCAGAAGAGGTTACCTAGCT C TGCCTGTGTGAGCAGGCTGACTCTTGAGGTGCTAAGGCTTGAGCTAGGGGGTGTGTTCAGAAGAGCTAATGGAGAAGTTGTAGTTTTATTTTATTCGTCCTGGGGGAATGAAAGCTAAACATGATTAAATCAACATGTACATTTTTTAATGTTGAGAACAAAGCTGA AACCTATATAGTCCTTTAGGTAAAACAAAAAATAGGAGAGACCTCATTATATTAATATTATTGTTCTGAATGTATGAAAGATATTTTCCATGGGGTGAACTTCAACCAAAATGTCAACCGGAGTTCACATAAAACATGGAGGAAATGGATGCAAATGAGATCC (SEQ ID NO.1).

[0024] In the above nucleotide sequence, the polymorphic site at position 532 is either C or T. TurkeyHSD multiple comparison results showed that when the marker is mutated to T, chickens have greater trait traits such as 10-week-old body weight, 12-week-old body weight, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight, and this trend is more pronounced in roosters.

[0025] In summary, blood samples from yellow-feathered broilers were collected and sequenced using the MGISEQ™ sequencing system. Trimmomatic was used to filter the sequencing data and remove low-quality sequences. Then, BWA was used to align the filtered sequences to the Red Junglefowl reference genome to identify SNPs. Finally, GATK was used for further screening and filtering of SNPs, and Plink was used for quality control and extraction of these SNPs to obtain a genotype dataset. Combined with phenotypic data, ADDO software was used to employ an additive-dominant model to screen for eight major genes and functional mutation sites associated with growth and slaughter traits, including body weight at 10 weeks of age in yellow-feathered broilers. This provides new SNP sites for breeding selection of growth and slaughter traits in yellow-feathered broilers.

[0026] Detection of polymorphic sites for chr1:171263700: found at https: / / www.ncbi.nlm.nih.gov / RNASEH2B The gene sequence (NCBI accession number GCF_000002315.6) was used to design primer pairs using Primer Premier 5.0 software. The primer pair information is shown in Table 3 (primer sequence 5'→3'). The designed primer pair sequences were sent to Sangon Biotech for synthesis, and the primer pairs were used to perform PCR on blood DNA to test the specificity of the primers.

[0027] Table 3 Primer information for screening polymorphic sites at chr1: 171263700 Two DNA samples of each genotype were randomly selected, for a total of six DNA samples, for PCR amplification. The obtained PCR products were sent to Sangon Biotech for sequencing. Sequencing revealed that the genotypes at the chr1:171263700 locus were CC, CT, and TT, which were consistent with the genotypes obtained from individual next-generation genome sequencing.

[0028] Validation of the association between the chr1:171223058 polymorphic site and chicken growth and slaughter traits.

[0029] In addition, 206 chickens were selected for the validation group. Blood samples were taken from 8 weeks of age to detect SNP genotypes. Chickens were raised from hatching, and their body weights at 10 and 12 weeks of age, as well as carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight were recorded at 13 weeks of age. The association between SNP locus genotypes and chicken growth and slaughter traits was validated, and the results are shown in Table 4 below.

[0030] Table 4. Association results between the chr1:171263700 polymorphic locus in the validation group and growth and slaughter traits in chickens. The experimental data from the validation group show that when the SNP locus genotype is TT, chickens have better growth and slaughter traits, including body weight at 10 weeks of age, body weight at 12 weeks of age, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight.

[0031] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. Application of RNASEH2B gene SNP molecular markers in assessing growth and slaughter traits in chickens, characterized in that, The SNP molecular marker is located at position 352 of the nucleotide sequence shown in SEQ ID NO.1, with a base polymorphism of C or T; the SNP molecular marker genotypes of chickens from high to low growth and slaughter traits are TT, CT, and CC.

2. The application according to claim 1, characterized in that, The growth and slaughter traits of the chicken include at least three of the following: 10-week-old body weight, 12-week-old body weight, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight.

3. The application of reagents for detecting RNASEH2B gene SNP molecular markers in the preparation of products for evaluating chicken growth and slaughter traits, characterized in that... The reagents include primer pairs, the nucleotide sequences of which are shown in SEQ ID NO.2~3; the SNP molecular marker is located at position 352 of the nucleotide sequence shown in SEQ ID NO.1, and the base polymorphism is C or T; the SNP molecular marker genotypes of chickens from high to low growth and slaughter traits are TT, CT, and CC.

4. The application of reagents for detecting SNP molecular markers of the RNASEH2B gene in chicken genetic breeding, characterized in that... Used to screen or identify growth and slaughter traits in chickens, the SNP molecular marker is located at position 352 of the nucleotide sequence shown in SEQ ID NO.1, with a base polymorphism of C or T; the SNP molecular marker genotypes of chickens from high to low growth and slaughter traits are TT, CT, and CC.

5. A method for screening or identifying growth and slaughter traits in chickens, characterized in that, Includes the following steps: (1) Collect chicken blood samples and extract genomic DNA; (2) Using genomic DNA as a template, design amplification primers and perform PCR to amplify the target gene fragment containing the SNP molecular marker to obtain the amplification product; the SNP molecular marker is located at position 352 of the nucleotide sequence shown in SEQ ID NO.1, and the base polymorphism is C or T; (3) Sequencing the amplified products to obtain the genotype of the SNP molecular marker. The SNP molecular marker genotypes of chicken growth and slaughter traits from high to low are TT, CT, and CC. The growth and slaughter traits of chicken include at least three of the following: 10-week-old body weight, 12-week-old body weight, carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, leg muscle weight, and wing weight.

Images