A molecular marker related to parthenocarpy of cucumber and application thereof

Abstract

The application relates to the technical field of molecular markers, in particular to a molecular marker related to cucumber parthenocarpy and application thereof. The base sequence of the InDel molecular marker is shown in SEQ ID NO. 4, wherein the 195-204th position of SEQ ID NO. 4 has an insertion and deletion variation; the dry cucumber with the sequence of the 195-204th position of SEQ ID NO. 4, i.e. TGAGTGTTTG, is parthenocarpic; the dry cucumber with the sequence of the 195-204th position of SEQ ID NO. 4, i.e. TGAGTGTTTG, is not parthenocarpic. The molecular marker is applied to breeding, early selection can be realized, the selection and breeding efficiency of parthenocarpic varieties is significantly improved, the artificial cost is reduced, and the genetic improvement and industrial development of the facility special dry cucumber varieties are promoted.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, specifically to a molecular marker related to parthenocarpy in cucumber and its application. Background Technology

[0002] cucumber( Cucumis sativus L.,2n=2x=14) is one of the most important greenhouse vegetables. Due to its short growth cycle, high yield, and strong market demand, it has a huge cultivation area in greenhouses and polytunnels around the world, especially in China, playing an irreplaceable role in ensuring year-round vegetable supply and enriching residents' food baskets. Among the various cultivation types of cucumbers, the dryland cucumber, also known as the North China type cucumber or fruit-type cucumber, is increasingly favored by consumers for its smooth, thornless skin, crisp texture, and rich flavor. Its cultivation scale and economic benefits in greenhouse cultivation continue to grow.

[0003] Parthenocarpy, the characteristic of the ovary developing into fruit without pollination or other stimulation, is an important target trait for breeding greenhouse-specific varieties. Under greenhouse cultivation conditions of low temperature, low light, and no insect pollinators, strong parthenocarpy varieties can set fruit without the need for flower dipping with plant growth regulators, preventing cucumber fruit drop, reducing labor costs associated with manual flower dipping, and achieving high quality and high yield. Currently, the main varieties cultivated in greenhouse dryland cucumber production are all non-parthenocarpy varieties, and manual flower dipping is time-consuming and labor-intensive. Traditional field phenotypic identification of parthenocarpy in dryland cucumbers is labor-intensive and inefficient; furthermore, because parthenocarpy in dryland cucumbers is controlled by two pairs of major genes plus multiple genes, trait selection is difficult, which to some extent restricts the efficiency of genetic improvement of parthenocarpy in dryland cucumbers and the breeding of greenhouse-specific varieties.

[0004] Therefore, developing and screening molecular markers closely linked to strong parthenocarpy is of great significance for improving breeding efficiency and for the breeding of parthenocarpy cucumber varieties for greenhouse cultivation. Summary of the Invention

[0005] To address the above problems, this invention provides a molecular marker related to parthenocarpy in cucumber and its application.

[0006] This invention is achieved through the following technical solution: An InDel molecular marker associated with parthenocarpy in cucumber, the base sequence of which is shown in SEQ ID NO.4, wherein positions 195-204 of SEQ ID NO.4 have insertion / deletion variations; cucumbers with the sequence TGAGTGTTTG at positions 195-204 of SEQ ID NO.4 are parthenocarpy; cucumbers with the sequence TGAGTGTTTG missing at positions 195-204 of SEQ ID NO.4 are not parthenocarpy.

[0007] Preferably, the cucumber is a dry-grown cucumber.

[0008] The application of the InDel molecular marker in identifying parthenocarpy in cucumber.

[0009] The identification of parthenocarpy in drought-tolerant cucumbers includes the following steps: Genomic DNA was extracted from the cucumbers to be tested.

[0010] The SEQ ID NO.4 sequence in the genomic DNA of cucumber was amplified by PCR using PCR primers to obtain the PCR amplification product.

[0011] The PCR amplification products were sequenced, and the SEQ ID NO.4 sequence was tested. If the insert fragment TGAGTGTTTG was present, the material was determined to be parthenocarpic; otherwise, it was determined to be non-parthenocarpic.

[0012] Preferably, the PCR primers comprise an upstream primer CsSAUR-F and a downstream primer CsSAUR-R. The base sequence of the upstream primer CsSAUR-F is shown in SEQ ID NO.1; the base sequence of the downstream primer CsSAUR-R is shown in SEQ ID NO.2.

[0013] Preferably, the PCR amplification reaction program is as follows: 95℃ for 5 min, 1 cycle; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 35 cycles; extension at 72℃ for 7 min after 35 cycles; storage at 25℃.

[0014] The application of the InDel molecular marker in the breeding of parthenocarpic dryland cucumber.

[0015] Preferably, individuals with the inserted fragment TGAGTGTTTG in the SEQ ID NO.4 sequence are selected as parents to breed parthenocarpic cucumbers.

[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an InDel molecular marker associated with parthenocarpy in cucumbers. The base sequence of the InDel molecular marker is shown in SEQ ID NO.4, wherein positions 195-204 of SEQ ID NO.4 contain an insertion / deletion variation. Arid cucumbers with the sequence TGAGTGTTTG at positions 195-204 of SEQ ID NO.4 exhibiting parthenocarpy are those with the sequence TGAGTGTTTG missing at positions 195-204 of SEQ ID NO.4. These arid cucumbers are non-parthenocarpy. This invention uses BSA sequencing technology to identify markers closely related to parthenocarpy in arid cucumbers. CsSAUR21The InDel molecular marker in the gene, located in the gene promoter region, specifically inserts the base fragment TGAGTGTTTG in parthenocarpic materials. Primers and detection methods developed based on this marker can rapidly and accurately identify parthenocarpic characteristics in cucumbers, overcoming the shortcomings of traditional phenotypic identification methods, such as high workload, low efficiency, and susceptibility to environmental influences. The molecular marker of this invention, when applied to breeding, enables early selection, significantly improves the efficiency of breeding parthenocarpic varieties, reduces labor costs, and promotes the genetic improvement and industrialization of greenhouse-grown, drought-resistant cucumber varieties. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This invention relates to 24 cucumber varieties. CsSAUR21 Sequence alignment results at the InDel site in the gene.

[0019] Figure 2 The images show sequencing peaks at the mutation sites of 13 strongly unisexual cucumber inbred lines of this invention, with boxes indicating inserted bases. Specifically, A represents the sequencing peak at mutation site 6457; B represents the sequencing peak at mutation site 9D6; C represents the sequencing peak at mutation site 27XN; D represents the sequencing peak at mutation site 30DN; E represents the sequencing peak at mutation site 33DN; F represents the sequencing peak at mutation site 36DN; G represents the sequencing peak at mutation site 6456D; H represents the sequencing peak at mutation site 6457DFZ; I represents the sequencing peak at mutation site 24SRDF01; J represents the sequencing peak at mutation site 24SRDF03; K represents the sequencing peak at mutation site 21AF15; L represents the sequencing peak at mutation site LTBHG; and M represents the sequencing peak at mutation site YL.

[0020] Figure 3The images show sequencing peaks at the variant sites of 11 non-parthenocarpy cucumber inbred lines of this invention, with arrows indicating InDel sites. Specifically, A represents the sequencing peak at the LG variant site; B represents the sequencing peak at the LT variant site; C represents the sequencing peak at the BYA variant site; D represents the sequencing peak at the BDH variant site; E represents the sequencing peak at the LYH-2 variant site; F represents the sequencing peak at the 32X variant site; G represents the sequencing peak at the LFW variant site; H represents the sequencing peak at the MT variant site; I represents the sequencing peak at the GFC variant site; J represents the sequencing peak at the 50WN variant site; and K represents the sequencing peak at the QTY variant site.

[0021] Figure 4 This invention utilizes qRT-PCR to determine the composition of eight inbred lines. CsSAUR21 The relative expression levels; among which, CsActin As an internal reference gene, the gene expression level was obtained by averaging three biological replicates; different lowercase letters in the figure represent the differences in expression levels between different treatment groups. p There were significant differences at the <0.05 level. Detailed Implementation

[0022] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0023] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0024] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0025] Example 1 1. Materials and Methods 1.1 Test Materials Materials used for BSA sequencing: The maternal parent P1 was the strong parthenocarpy inbred line '6457' of cucumber, which has been published in the following literature: Yan Liying, Lou Lina, Li Xiaoli, et al. Genetic analysis of parthenocarpy in monoecious cucumber [J]. Chinese Agricultural Science, 2010, 43(6):7. DOI:CNKI:SUN:ZNYK.0.2010-06-026. The paternal parent P2 was the non-parthenocarpy inbred line '32X' of cucumber, which has been published in the following literature: He Shuqiang. Construction and phenotypic analysis of cucumber EMS mutant library [D]. Hebei University of Science and Technology, 2019. Using the aforementioned parents, an F2 segregating population was constructed, and 537 F2 plants were colonized. After phenotypic identification of parthenocarpy during the fruiting period, 30 strongly parthenocarpy extreme materials were obtained as the strongly parthenocarpy extreme pool, and 30 non-parthenocarpy extreme materials were obtained as the non-parthenocarpy extreme pool. The strongly parthenocarpy extreme pool, the non-parthenocarpy extreme pool, the maternal pool '6457', and the paternal pool '32X' were used for BSA sequencing to screen for Indel loci.

[0026] Molecular marker validation materials: The following are strong parthenocarpic cucumber varieties in drought-resistant regions: '9D6', '21AF15', '24SRDF01', '24SRDF03', '27XN', '30DN', '33DN', '36DN', '6457DFZ', '6457D', 'LTBHG', 'YL', and '6457'.

[0027] The following are non-parthenocarpic cucumber varieties: 'LFW', 'LT', 'QTY', 'BDH', 'BYA', '32X', 'GFC', 'LG', 'LYH-2', 'MT', and 50WN.

[0028] The above varieties were all provided by the cucumber research and innovation team of Hebei University of Science and Technology.

[0029] 1.2 Test Methods 1.2.1 Methods for identifying parthenocarpy Parthenocarpic phenotype identification of F2 population: female flowers on nodes 1 to 8 were removed. Starting from the female flower on node 9, flower clipping was performed one day before flowering, clipping one female flower every 3 nodes until node 30. Fruit development was investigated 10 days after flowering. Fruits with enlarged ovaries were identified as parthenocarpic fruits. The number of parthenocarpic fruits was counted. The number of parthenocarpic fruits / the total number of clipped flowers per plant = parthenocarpic fruit set rate. A parthenocarpic fruit set rate greater than or equal to 70% was considered to have strong parthenocarpic ability.

[0030] 1.2.2 Extraction of genomic DNA by CTAB method 1) Take 0.1g of fresh, tender leaves into a 2.0mL centrifuge tube and add 2 steel balls.

[0031] 2) After quick-freezing the sample in liquid nitrogen, use a fully automated sample grinder to break the sample at 50 Hz for 60 seconds, then quickly add 700 μL of CTAB solution and mix well.

[0032] 3) Incubate in a 65℃ water bath for 30 minutes, inverting the sample every 10 minutes during the water bath to promote complete lysis.

[0033] 4) After removing from the oven and cooling to room temperature, add 700 μL of organic solvent in a fume hood, mix by inverting the oven, and centrifuge at 12,000 rpm for 10 min at room temperature; the organic solvent is prepared by chloroform and isoamyl alcohol in a volume ratio of 24:1.

[0034] 5) Take 500 μL of supernatant, add an equal volume of pre-cooled isopropanol, and let it settle in a -20℃ refrigerator for 30 min.

[0035] 6) Centrifuge at 12000 rpm for 10 min and discard the supernatant.

[0036] 7) Wash the DNA twice with 1 mL of 70% alcohol and dry in an oven at 55°C or at room temperature.

[0037] 8) Add 100 μL of sterile ddH2O to each tube and dissolve the DNA overnight at room temperature or 4°C. Store at -20°C.

[0038] 1.2.3 BSA pool construction and sequencing Based on the parthenocarpic phenotype of the F2 generation segregating population, 30 plants were selected from each of the strong parthenocarpic and non-parthenocarpic extreme pools. One plant from '6457' was selected to construct the maternal parent pool, and one plant from '32X' was selected to construct the paternal parent pool. DNA was extracted from the extreme single plants and parents using the method described in 1.2.2. The extracted DNA was sent to Novogene Biotechnology Co., Ltd. for quality testing. Samples that passed the quality test were used to construct DNA libraries and subjected to high-throughput sequencing using the Illumina P150 sequencing platform. Sequencing was performed using the cucumber genome v3 version, accessed at http: / / www.cucurbitgenomics.org / .

[0039] 1.2.4 Detection of Indel variant sites Valid sequencing data were aligned to a reference genome using BWA software with the parameters mem-t4-k32-M. The alignment results were then deduplicated using SAMTOOLS with the rmdup parameter applied. Based on the alignment results, GATK software was used to detect small fragment insertions and deletions less than 50 bp, i.e., InDel variant sites. Windows larger than a threshold at a 99% confidence level were selected as candidate regions. Genes containing InDels within these candidate regions were functionally annotated using the ANNOVAR software tool.

[0040] 1.2.5 Cloning the target fragment Based on BSA sequencing results, genes that exhibit indels were selected. CsSAUR21 Its genome number is CsaV3_2G015450. The gene sequence was retrieved from the cucumber genome database. Primers that can amplify the frameshift mutation sequence were designed using the primer design website Primer 5.

[0041] The primer sequences are shown in Table 1.

[0042] Table 1 Primers used for PCR amplification CsSAUR-F: SEQ ID NO.1: CCCAGAAAGTCAATCACG CsSAUR-R: SEQ ID NO.2: TCGCCCACATAAACAGCA The amplification system is shown in Table 2.

[0043] Table 2 Amplification reaction system 2×Phanta Max premix 25μL -F 1μL -R 1μL cDNA 1μL <![CDATA[ddH2O]]> Fill to 50μL The reaction program was as follows: 95℃ for 5 min, 1 cycle; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 35 cycles; extension at 72℃ for 7 min after 35 cycles; storage at 25℃.

[0044] 1.2.6 Sequence Alignment The PCR amplification products were sequenced and then sequenced using DNAMAN software for sequence alignment.

[0045] 1.2.7 Extraction of total RNA from cucumber ovary Total RNA was extracted from cucumber ovary tissue using the TRIzol method.

[0046] 1) After grinding, take 0.1g of sample into a 2.0mL centrifuge tube, add 1mL of TRNzol solution, and shake to mix.

[0047] 2) After standing at room temperature for 5 min, centrifuge at 12000 rpm for 10 min at 4℃, transfer the supernatant to a new EP tube, add 400 μL of chloroform, shake vigorously for 60 s, and stand at room temperature for 3 min.

[0048] 3) Centrifuge at 12000 rpm for 10 min at 4℃, separate into three phases, with RNA in the upper aqueous phase.

[0049] 4) Take about 600 μL of the upper aqueous phase, add an equal volume of isopropanol, mix well, and let stand at room temperature for 30 min.

[0050] 5) Centrifuge at 12,000 rpm for 10 minutes at 4℃, then discard the supernatant.

[0051] 6) Wash the precipitate once with 1 mL of 75% ethanol, centrifuge at 12000 rpm for 10 min at 4℃, and discard the supernatant.

[0052] 7) Allow the precipitate to dry slightly at room temperature, remove any residual liquid with an RNA-free pipette tip, and immediately dissolve it in 500 μL of DEPC water.

[0053] 8) Add 250 μL of water-saturated phenol, shake to mix for 30 s, add 250 μL of chloroform, shake to mix for 30 s, and let stand at room temperature for 3 min.

[0054] 9) Centrifuge at 12000 rpm for 10 min at 4℃.

[0055] 10) Take about 500 μL of the upper aqueous phase, add 50 μL of 3M sodium acetate with pH 5.2, and 2 times the volume of anhydrous ethanol, mix well, and let stand at 4°C for 30 min.

[0056] 11) Centrifuge at 12000 rpm for 10 min at 4℃.

[0057] 12) Wash the precipitate once with 75% ethanol (volume fraction) and centrifuge at 12,000 rpm for 10 min at 4°C.

[0058] 13) Allow the precipitate to stand at room temperature for 7 minutes, then dissolve it in 50 μL of DEPC water.

[0059] 14) Take 1 μL of RNA and detect OD using a NanoPhotometer P330. 260 / 280 Value and concentration.

[0060] 1.2.8 RNA Reverse Transcription Reverse transcription was performed using a reverse transcription kit from Beijing Adley Biotechnology Co., Ltd., catalog number PC5401. The experimental steps are as follows: 1) The reaction system for removing genomic DNA is shown in Table 3.

[0061] Table 3. Genomic DNA Removal Reaction System 4×gDNA removal premix 4μL Total RNA 1μg Nuclease-free water Fill to 16μL 42℃, 2min.

[0062] 2) The reverse transcription reaction is shown in Table 4 below.

[0063] Table 4 Reverse transcription reaction system 1) Liquid after the reaction step 16μL 5×TRUE RT Reverse Transcription Premix II 4μL Incubate at 42℃ for 15 minutes, then at 85℃ for 5 seconds. The product after the reaction is cDNA, which should be stored at -20℃.

[0064] 1.2.9 Real-time quantitative PCR The SuperReal PreMix Plus SYBRGreen reagent kit (catalog number FP205) purchased from Tiangen Biotech (Beijing) Co., Ltd. was used. The reaction system is shown in Table 5 below.

[0065] Table 5 Real-time quantitative PCR reaction system 2×SuperReal Premix Plus 5μL Primer F 0.5μL Primer R 0.5μL cDNA 1μL Nuclease-free water Bring the volume to 10 μL The PCR amplification reaction program was as follows: 95℃ for 5 min per cycle, 95℃ for 10 s, 60℃ for 20 s, 72℃ for 20 s for 40 cycles, and melting curve analysis was performed at 60℃~95℃.

[0066] Use 2 -ΔΔCT The algorithm calculates the expression levels of each gene, where the internal reference gene is... Csactin The expression level of each gene is derived from the average of three biological replicates.

[0067] 2. Test Results 2.1 Screening of variant sites The resequencing results of the two pooled samples were compared with the reference genome. Genotyping was performed, and InDel site information was statistically analyzed using GATK software. A window exceeding a threshold at a 99% confidence level was selected as a candidate interval. Within this candidate interval, a total of 1916 InDel variant sites were identified, and genes with base insertions in their promoter regions were screened. CsSAUR21 As shown in Table 6, this information on variant sites provides a reference for the development of molecular markers.

[0068] Table 6 Candidate InDel Annotation Table CsaV3_2G015450 insert Chr2 12914253 TGAGTGTTTG - 2.2 InDel tag development and filtering Eleven non-asexual inbred lines (as shown in Table 7) and thirteen asexual inbred lines (as shown in Table 8) were selected. Genomic DNA was extracted from leaves of 24 cucumber varieties using the CTAB method, and the aforementioned primers were used to amplify the genes containing the DNA. CsSAUR21 The DNA sequence of the InDel site was analyzed. PCR amplification products were purified and sequenced after detection by 1% agarose gel electrophoresis. DNAMAN software was used for sequence alignment analysis and sequencing peak diagram analysis. Results are as follows: Figure 1 , 2 As shown in Figure 3, CsSAUR21 The InDel site in the gene exhibits specificity in parthenocarpic and non-parthenocarpic materials, therefore the InDel site can serve as a molecular marker for identifying parthenocarpic properties in cucumbers.

[0069] Table 7. Statistical table of parthenocarpy in non-parthenocarpy varieties. Number of plants 13 13 13 13 13 13 13 13 13 13 13 Total number of female flowers 52 52 52 50 51 52 49 53 52 54 52 Total number of parthenocarpy 0 0 0 0 0 0 0 0 0 0 0 Parthenocarpy Rate / % 0 0 0 0 0 0 0 0 0 0 0 Table 8. Statistical table of parthenocarpy in varieties with strong parthenocarpy Number of plants 13 13 13 13 13 13 13 13 13 13 13 13 13 Total number of female flowers 51 52 51 51 52 52 52 52 52 52 53 50 51 Total number of parthenocarpy 49 49 49 48 49 47 48 49 49 47 49 46 48 Parthenocarpy Rate / % 96.07 94.23 96.07 92.3 96.07 90.38 92.3 94.23 96.07 90.38 92.45 92.00 92.3 The non-parthenocarpy base sequence is shown in SEQ ID NO.3, and is as follows: TCGCCCACATAAACAGCAATATGACCTCTTGGTACATTTGACTGGTTTCTCATTTTAAGAATTTGCTTAGCATGATGAATCAAAGATGATGGCAAACGAATTCCCATTGCTAAATTGTGTTATCGGCTGAAGAACACGTACAAAGAGGAGGCGAACACCCTCTAAAAACTTTCTTTGGTTGAATGGATATGTTTGAAGCCTCGTTTGAAGTTTGT ATATATAGACTTTTTTAAAAAAAAAAAGGAAAAAATAATAGCTGTTTTTCTGATTGCTGATCTGTTCTTGCTGCATTACTAATAGATGTGTTCTTGCTGCATTACTAATAGATGTGGGGTATTAAAGACTGTTGTTGGGAAGACCCTTTCACATGGCTTTGATCAACATATAAAAGAACTCTACATTCAAAACAAAGACTGTACAAGGAAATTGCATATCCACGTGATTGACTTTCTGGG.

[0070] The parthenocarpy base sequence is shown in SEQ ID NO.4, and is as follows: TCGCCCACATAAACAGCAATATGACCTCTTGGTACATTTGACTGGTTTCTCATTTTAAGAATTTGCTTAGCATGATGAATCAAAGATGATGGCAAACGAATTCCCATTGCTAAATTGTGTTATCGGCTGAAGAACACGTACAAAGAGGAGGCGAACACCCTCTAAAAACTTTCTTTGGTTGAATGGATATGTTTGTGAGTGTTTGAAGCCTCGTTTGAAG TTTGTATATATAGACTTTTTTAAAAAAAAGGAAAAAAATAATAGCTGTTTTTCTGATTGCTGATCTGTTCTTGCTGCATTACTAATAGATGTGGGGTATTAAAGACTGTTGTTGGGAAGACCCTTTCACATGGCTTGATCAACATATAAAAGAACTCTACATTCAAAACAAAGACTGTACAAGGAAATTGCATATCCACGTGATTGACTTTCTGGG.

[0071] 2.3 CsSAUR21 Expression level analysis To verify CsSAUR21 The relationship between parthenocarpy and cucumber fertilization was investigated using real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) to analyze the ovaries of strongly parthenocarpy inbred lines 9D6, 6457, YL, and LTBHG, as well as non-parthenocarpy inbred lines 32X, GFC, MT, and LYH-2 on the day of flowering. CsSAUR21 The expression levels were analyzed. The results are as follows: Figure 4 As shown, the expression level in parthenocarpic ovaries is higher than that in non-parthenocarpic ovaries, indicating that the gene expression level is positively correlated with parthenocarpic cucumber.

[0072] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0073] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. A primer set of an InDel molecular marker associated with parthenocarpy of Cucumis sativus L. in identifying parthenocarpy of Cucumis sativus L., characterized in that, The base sequence of the InDel molecular marker is shown in SEQ ID NO.4, wherein positions 195-204 of SEQ ID NO.4 have insertion / deletion variations; the cucumber with the sequence TGAGTGTTTG at positions 195-204 of SEQ ID NO.4 is parthenocarpic; the cucumber with the sequence TGAGTGTTTG missing at positions 195-204 of SEQ ID NO.4 is not parthenocarpic. The primer set includes an upstream primer CsSAUR-F and a downstream primer CsSAUR-R; The base sequence of the upstream primer CsSAUR-F is shown in SEQ ID NO.1; the base sequence of the downstream primer CsSAUR-R is shown in SEQ ID NO.

2.

2. The application as described in claim 1, characterized in that, The identification of parthenocarpy in drought-tolerant cucumbers includes the following steps: Genomic DNA was extracted from the cucumbers to be tested. The primer set described above was used to perform PCR amplification of the SEQ ID NO.4 sequence in the genomic DNA of cucumber, and the PCR amplification product was obtained. The PCR amplification products were sequenced, and the SEQ ID NO.4 sequence was tested. If the insert fragment TGAGTGTTTG was present, the material was determined to be parthenocarpic; otherwise, it was determined to be non-parthenocarpic.

3. The application as described in claim 2, characterized in that, The PCR amplification reaction program is as follows: 95℃ for 5 min, 1 cycle; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 35 cycles; extension at 72℃ for 7 min after 35 cycles; storage at 25℃.

4. The application of the InDel molecular marker primer set as described in claim 1 in the breeding of parthenocarpic drought-tolerant cucumber, characterized in that, Individuals containing the insert fragment TGAGTGTTTG in the sequence of SEQ ID NO.4 are selected as parents using the primer set to breed parthenocarpic cucumbers.

Images