Escherichia coli resistant to bacteriophage and its use in l-tryptophan synthesis

Abstract

This invention belongs to the field of microbial and fermentation engineering technology, specifically relating to a bacteriophage-resistant *Escherichia coli* and its application in L-tryptophan synthesis. Specifically, the *E. coli* strain is characterized by at least the knockout of the protein encoding thioredoxin in the starting strain. trxA Genes were used to perform site-specific modifications on the FhuA protein and to knock out the gene encoding the L-tryptophan operon repressor protein. trpR Genes and those encoding tryptophanase tnaA Gene Acquisition. This invention utilizes genetic engineering technology to genetically modify wild-type Escherichia coli, ultimately obtaining a phage-resistant Escherichia coli genetically engineered strain. This strain significantly improves glucose utilization, resulting in a higher L-tryptophan synthesis level. Furthermore, it can be applied to the microbial fermentation of various other high-value-added compounds, thus possessing significant practical application value.

Description

Technical Field

[0001] This invention belongs to the field of microbial and fermentation engineering technology, specifically relating to a bacteriophage-resistant Escherichia coli and its application in L-tryptophan synthesis. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] With the continuous development of metabolic engineering and synthetic biology, constructing microbial cell factories to produce bulk chemicals and various natural products has become a mainstream trend in industrial production. L-tryptophan, an essential amino acid for humans and animals, is widely used in food, medicine, agriculture, and animal husbandry. *Escherichia coli*, as a rapidly growing, easily cultured microorganism with a clear genetic background, has become one of the ideal cell factories for producing L-tryptophan.

[0004] However, phage contamination has always been one of the key factors restricting the production of L-tryptophan by Escherichia coli fermentation. The presence of phages not only leads to the interruption of the fermentation process but also causes a sharp decline in product yield. Therefore, constructing Escherichia coli strains resistant to multiple phages is of great significance for improving the yield and stability of L-tryptophan. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a phage-resistant *Escherichia coli* strain and its application in L-tryptophan synthesis. Specifically, the present invention utilizes genetic engineering technology to genetically modify wild-type *E. coli*, ultimately obtaining a phage-resistant *E. coli* strain that significantly improves glucose utilization, thereby exhibiting a higher level of L-tryptophan synthesis. Based on the above research results, the present invention is thus completed.

[0006] Specifically, the technical solution of the present invention is as follows: A first aspect of the invention provides a phage-resistant *Escherichia coli* strain, wherein the *E. coli* strain is resistant to phages by knocking out the protein encoding thioredoxin in the starting strain. trxA Genes were used to perform site-specific modifications to the FhuA protein and to knock out the gene encoding the L-tryptophan operon repressor protein. trpR Genes and those encoding tryptophanase tnaA Gene acquisition.

[0007] The specific method for site-specific modification of the FhuA protein involves deleting amino acids 552-558 of the FhuA protein. This reduces the adsorption efficiency of the bacteriophage on the host bacteria.

[0008] Furthermore, the method also includes modifying the gene of the phosphorus thioylation system. sspBC and sspDE Key modules of the L-tryptophan synthesis pathway trpE fbr -aroG fbr -tktA and trpDCBA It is introduced into E. coli to improve the efficiency of L-tryptophan synthesis.

[0009] In this invention, the starting strain is wild-type Escherichia coli W3110 (ATCC 27325).

[0010] Furthermore, the phage-resistant Escherichia coli can be Escherichia coli (E. coli) Escherichia coli XM-6, this strain was deposited on September 22, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20252086. Experimental results showed that this strain not only exhibited resistance to three T-lineage phages, but also improved glucose utilization rate by 32.2% through optimized expression of key enzymes in metabolic pathways, and synthesized 37.76 g / L of L-tryptophan in a 5-L fermenter.

[0011] A second aspect of the present invention provides a method for constructing the above-mentioned phage-resistant Escherichia coli, the method comprising: S1. Using wild-type Escherichia coli as the starting strain, the protein encoding thioredoxin was knocked out. trxA Genes that block the synthesis of bacteriophage DNA within the host bacteria; S2. The FhuA protein is modified at specific sites by deleting amino acids at positions 552-558, thereby reducing the adsorption efficiency of the bacteriophage on the host bacteria. S3, Knockout of the protein encoding the L-tryptophan operon repressor trpR Genes and those encoding tryptophanase tnaA Gene.

[0012] The originating strain is wild-type Escherichia coli W3110 (ATCC 27325).

[0013] Furthermore, the method also includes: S4, modifying the gene of the phosphorus thioylation system. sspBC and sspDE Key modules of the L-tryptophan synthesis pathway trpE fbr -aroG fbr -tktA and trpDCBAThe recombinant plasmids pCL1920 (GenBank AB236930.1) and pTrc99a (GenBank U13872.1) were cloned into the plasmids pM-3 and pM-4, respectively. The recombinant Escherichia coli, which is phage-resistant Escherichia coli, was obtained by transforming the gene-modified strains with these plasmids through electroporation.

[0014] A third aspect of the present invention provides the application of the above-mentioned Escherichia coli in the fermentation production of L-tryptophan.

[0015] Specifically, in the aforementioned application, the environment in which L-tryptophan is produced may be contaminated with bacteriophages.

[0016] A fourth aspect of the present invention provides a method for the industrial production of L-tryptophan, the method comprising: fermenting and culturing Escherichia coli that is resistant to the above-mentioned bacteriophage, and separating and purifying the L-tryptophan.

[0017] The beneficial technical effects of one or more of the above technical solutions are as follows: The recombinant Escherichia coli XM-6 constructed by the above technical solution has both resistance to multiple T-line phages and a high level of L-tryptophan synthesis, providing an effective method to solve the problem of phage contamination in L-tryptophan industrial fermentation. At the same time, through the combination of multi-gene modification and heterologous expression of key modules, the anti-phage performance and metabolic synthesis efficiency of the strain were optimized simultaneously, and the glucose utilization rate was significantly improved.

[0018] In summary, the phage-resistant Escherichia coli developed by the above technical solution has a wide range of applications. It can not only be used for the fermentation production of L-tryptophan, but also extended to the microbial fermentation of other high-value-added compounds. Therefore, the above technical solution has excellent practical application value and application prospects. Attached Figure Description

[0019] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0020] Figure 1 Agarose gel electrophoresis was used to verify the results in the embodiments of this invention. trxA The gene was successfully knocked out.

[0021] Figure 2 In the embodiments of this invention, agarose gel electrophoresis was used to verify that the FhuA552-558 amino acid gene successfully replaced the wild-type FhuA.

[0022] Figure 3 Agarose gel electrophoresis was used to verify this in an embodiment of the invention. trpR The gene was successfully knocked out.

[0023] Figure 4 Agarose gel electrophoresis was used to verify this in an embodiment of the invention. tnaA The gene was successfully knocked out.

[0024] Figure 5 This is a plasmid map of recombinant plasmid pM-3 in an embodiment of the present invention.

[0025] Figure 6 This is a plasmid map of recombinant plasmid pM-4 in an embodiment of the present invention.

[0026] Figure 7 In this embodiment of the invention, growth curves are used to verify the antiphage performance of strain XM-6; wherein, A is the growth curve of phage-resistant Escherichia coli XM-6 and control strain W3110 under different multiplicity of infection conditions in the presence of T1 phage; B is the growth curve of phage-resistant Escherichia coli XM-6 and control strain W3110 under different multiplicity of infection conditions in the presence of T4 phage; C is the growth curve of phage-resistant Escherichia coli XM-6 and control strain W3110 under different multiplicity of infection conditions in the presence of T7 phage.

[0027] Figure 8 In this embodiment of the invention, the double-layer plate method is used to verify the antiphage performance of strain XM-6; wherein, A is the double-layer plate method verification of T1 phage against Escherichia coli XM-6 and control strain W3110 infection respectively; B is the double-layer plate method verification of T4 phage against Escherichia coli XM-6 and control strain W3110 infection respectively; C is the double-layer plate method verification of T7 phage against Escherichia coli XM-6 and control strain W3110 infection respectively.

[0028] Figure 9 The results of batch fermentation of L-tryptophan by strain W3110 in this embodiment of the invention are shown.

[0029] Figure 10 This is the result of batch fermentation of L-tryptophan by strain XM-6 in the embodiments of the present invention.

[0030] Figure 11 This is the result of batch fermentation of strain XM-6 in a 5-L fermenter in an embodiment of the present invention. Detailed Implementation

[0031] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0032] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0033] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the materials, reagents, instruments, and methods used in the following examples are all conventional materials, reagents, instruments, and methods in the art and are commercially available.

[0034] Example 1 I. Experimental Methods 1. Knockout in wild-type Escherichia coli K-12 W3110 trxA Gene 1) Gene knockout of *E. coli* was performed using Red homologous recombination technology. First, the starting strain W3110 was activated and cultured in LB medium (5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride) at 37 ℃ for 12 h. Then, the pTKRed plasmid (Addgene41062) was transformed into the starting strain W3110 to obtain the W3110-pTKRed strain. Primers with 50 bp homologous arms were designed using the W3110 genome as a template. kan ( trxA )-QF1 and kan ( trxA )-QR1, using plasmid pKD4 as a template, was obtained by PCR containing trxA The recombinant fragments of the gene, including the upstream and downstream 50 bp homologous sequences, the FRT site, and the Kan resistance gene, were obtained in the following sequence order: "-upstream homologous arm 50 bp-FRT site-Kana resistance gene-FRT site-downstream homologous arm 50 bp-". The DNA fragments were transferred into W3110-pTKRed via electroporation. Using the recombinase expressed on the pTKRed plasmid, homologous recombination occurred under Kan selection pressure to obtain transformants. Transformants were then generated using primers... kan ( trxA )-JF and kan ( trxA Colony PCR was performed on )-JR cells to obtain the genome. trxAThe strain with Kan resistance replaced was then transformed into the pCP20 plasmid. The Flp enzyme expressed on the pCP20 plasmid was used to induce homologous recombination at the FRT sites flanking the Kan resistance gene, thus removing Kan resistance. The result was obtained by streaking Kan-resistant and antibiotic-free plates. trxA The knockout strain was named W3110Δ trxA ;Gene trxA The primer sequences involved in the knockout are as follows: kan ( trxA )-QF1:TACACCACAACGAAACCAACACGCCAGGCTTATTCCTGTGGAGTTATATGTGTAGGCTGGAGCTGCTTC kan ( trxA )-QR1:CCGGGCGTCCAGTTTTTAGCGACGGGGCACCCGAACATGAAATTCCCATGGGAATTAGCCATGGTCCATA kan ( trxA )-JF : GCAATCGCAGGATGAGAGAGAAGATAATGAAACG kan ( trxA )-JR: GTGATCAGCTCAGAAACCGGCGTATTCTTTAATTC Gene knockout procedure: pTKRed was transformed into strain W3110 to obtain strain W3110-pTKRed; strain W3110-pTKRed was inoculated into test tubes and cultured at 30 ℃ for 12 h; then it was transferred to 50 mL of LB medium containing spectinomycin to allow the initial OD to reach the target value. 600 Reach 0.05; after culturing for 30 min, add 20 μL of 1M IPTG for induction; continue culturing until OD... 600 Reach a pH of 0.5-0.6; at this point, collect the bacteria in a 50 mL centrifuge tube by centrifuging at 4000 rpm for 10 min, discarding as much culture medium as possible; transfer the bacteria to a 1.5 mL Eppendorf tube, resuspend the bacteria in 1 mL of sterile ultrapure water, centrifuge at 12000 g for 1 min, and repeat the centrifugation-resuspending step 4-5 times, finally resuspending the bacteria in 50-100 μL of sterile ultrapure water. Add 20-30 μL of DNA fragments with homologous ends. trxA-del was added to competent cells for electroporation and transferred to a pre-chilled, clean 0.2 cm electroporation cuvette; electroporation was performed using an electroporator with parameters of 2.5 kV and 5 ms; immediately after electroporation, 800 μL of LB medium was added to the electroporation cuvette and mixed thoroughly with the competent cells; 1 mL of the above bacterial culture was transferred to a 1.5 mL Eppendorf tube and incubated at 37 ℃ for approximately 2 h; 500 μL of the recovery culture was collected and spread onto LB agar plates containing kanamycin and incubated at 37 ℃ for 16 h. If colonies grow, the verification primers were used. kan ( trxA )-JF and kan ( trxA Colony PCR was performed on JR cells to identify positive clones. The obtained positive clones were made into competent cells, and the pCP20 plasmid was transformed into the positive strain. Single clones were picked and streaked on antibiotic-free plates and incubated at 42 ℃ for 12 h. Single clones that grew were picked and streaked on LB+Kan, LB and LB+Amp plates and incubated at 37 ℃ for 12 h. Colonies that grew only on antibiotic-free LB plates were picked and colony PCR was performed again. If the colony PCR was successful, the knockout positive colonies were obtained.

[0035] 2. W3110Δ trxA Deletion of amino acids 552-558 in the FhuA protein 1) with trxA Gene knockout was similarly performed using Red homologous recombination technology to knock out amino acids 552-558 of the *E. coli* FhuA protein. First, the starting strain W3110Δ... trxA Activation culture was performed on LB medium (5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride) at 37℃ for 12 h. Then, pTKRed plasmid (Addgene41062) was transformed into the starting strain W3110 to obtain W3110Δ. trxA -pTKRed strain. fhuA The gene encodes an iron-chromium outer membrane transporter in *E. coli*, with its extracellular loop 8 located at amino acids 552-558. This loop acts as a receptor for DNA injection during bacteriophage infection of *E. coli*. KEGG (Kyoto Encyclopedia of Genes and Genomes) can be used to search for... fhuA The gene sequence and its upstream and downstream sequences were analyzed. The coding gene for amino acids positions 552-558 was removed from the gene sequence, and this deletion region was used as the dividing line. fhuAThe gene is divided into two segments: the first segment encodes amino acid positions 1-551 of the FhuA protein (referred to as FhuA1), and the second segment encodes amino acid positions 559-747 of the FhuA protein (referred to as FhuA2). Two pairs of primers were designed based on these sequences. The first pair, FhuAS-QF and FhuAS-QRC, was used to amplify FhuA1. The 3' ends of the primers represent the two ends of the FhuA1 sequence, and the 5' end of FhuAS-QF is... fhuA The upstream homologous arm sequence, FhuAS-QRC, has its 5' end as the upstream terminal sequence of FhuA2. The second pair of primers, FhuAX-QFC and FhuAX-QR, are used to amplify FhuA2. The 3' ends of these primers represent the two terminal sequences of FhuA2, while the 5' end of FhuAX-QFC is the downstream terminal sequence of FhuA1, and FhuAX-QR is... cmr The terminal sequences were obtained. In a clean bench, 10 μL of *E. coli* W3110 was smeared onto the bottom of a PCR tube using a pipette tip as a template. FhuA1 and FhuA2 were obtained through PCR amplification and gel recovery of the product. FhuA1 and FhuA2 overlapped by approximately 70 bp; therefore, these two gene fragments were used as primers for an overlap extension PCR reaction. Primers were designed using the pKD3 plasmid as a template. cmr (FhuA)-QF and cmr (FhuA)-QR, the 3' ends of both the upstream and downstream primers are on the pKD3 plasmid. cmr The terminal sequence, cmr The 5' end of (FhuA)-QF is a terminal homologous sequence of FhuA2. cmr The 5' end of (FhuA)-QR is fhuA The downstream homologous arm sequence was obtained. Finally, using the pKD3 plasmid as a template, PCR amplification was performed to obtain the sequence containing... fhuA The chloramphenicol resistance gene with homologous arms was identified. After PCR, agarose gel electrophoresis was performed, followed by gel cutting and product recovery. Specific gel recovery methods are detailed in the kit instructions. The recovered gene fragment was labeled as... cmr (FhuA). FhuA - and cmrThe two gene fragments (FhuA) overlapped by approximately 70 bp, so they were used as primers for overlap extension PCR. The recovered gene fragment was labeled FhuATB, a homologous recombination fragment containing chloramphenicol resistance, used for gene recombination. Colony PCR was performed using the validation primers FhuA-JF and FhuA-JR to identify positive clones. The obtained positive clones were used to create competent cells, and the pCP20 plasmid was transformed into the positive strain. Single clones were picked and streaked onto antibiotic-free plates and incubated at 42 °C for 12 h. Single clones were also picked and streaked onto LB+Cm, LB, and LB+Amp plates and incubated at 37 °C for 12 h. Colonies growing only on antibiotic-free LB plates were selected for further colony PCR validation. Successful colony PCR validation yielded the knockout-positive colony W3110(Δ). trxA ΔFhuA552-558aa).

[0036] The primer sequences involved in the deletion of amino acids 552-558 of the FhuA protein gene are as follows: FhuAS-QF: TAATCATTCTCGTTTACGTTATCATTCACTTTACATCAGAGATATACCAATGGCGCGTTCCAAAACTGCT FhuAS-QRC: TTATACACGGCACCAGTAACTACAATCGGACGATTCTTCCGGTACATATTTACCTTTAGACGGTGCGAAAA FhuAX-QFC: CTTCTTCGCAAGTTGGGAAGGATGGTAATATTTTCGCACCGTCTAAAGGTAAATATGTACCGGAAGATCG FhuAX-QR: GAAGCAGCTCCAGCCTACACTTAGAAACGGAAGGTTGCGGTTGCAACGACCTGACGTTCTGCGCCCCAGA cmr(FhuA)-QF: TCTGGGGCGCAGAACGTCAGGTCGTTGCAACCGCAACCTTCCGTTTCTAAGTGTAGGCTGGAGCTGCTTC cmr(FhuA)-QR: AGCCAACTTGTGAAATGGGCACGGAAATCCGTGCCCCAAAAGAGAAATGGGAATTAGCCATGGTCCATA FhuATB-QF: TAATCATTCTCGTTTACGTTATCATTCACT FhuATB-QR: AACAGCCAACTTGTGAAATGGGCACGGAAA FhuA-JF: CCAGAAGATATTGCAGATATGGGCGTGGAC FhuA-JR: TTTGCGGGCAAACGCTTTGCTGCTCCAGCT 3. trpR and tnaA Sequential gene knockout Methods and trxA The knockout process is basically similar. Among them, cmr(trpR)-QF / cmr(trpR)-QR and kan(tnaA)-QF / kan(tnaA)-QR are used to obtain individuals carrying the resistance gene. trpR and tnaA Gene knockout fragments. cmr(trpR)-JF / cmr(trpR)-JR and kan(tnaA)-JF / kan(tnaA)-JR are used for... trpR and tnaA Detection of positive clones of gene knockout Gene trpR and tnaA The primer sequences involved in gene knockout are as follows: cmr(trpR)-QF: TACAACCGGGGGAGGCATTTTGCTTCCCCCGCTAACAATGGCGACATATTGTGTAGGCTGGAGCTGCTTC cmr(trpR)-QR: GCATTCGGTGCACGATGCCTGATGCGCCACGTCTTATCAGGCCTACAAAAATGGGAATTAGCCATGGTCC cmr(trpR)-JF: CAGCAGCTTAACGCCGGACCAGG cmr(trpR)-JF: GATGTCGCGTTATACCGGTATTGATG kan(tnaA)-QF: TATTCACAGGGATCACTGTAATTAAAATAAATGAAGGATTATGTAGTGTAGGCTGGAGCTGCTTCG kan(tnaA)-QR: TGTAGGGTAAGAGAGTGGCTAACATCCTTATAGCCACTCTGTAGTATTAAATGGGAATTAGCCATGGTCC kan(tnaA)-JF: GCAGATTACCCAGCTGATTGAG kan(tnaA)-JR1: CCTTCCAGGCCGCCATATGTCG 4. Construction of recombinant Escherichia coli XM-6 Phosphorylation modification system genes sspBC and sspDE (SspABCD–SspE is aphosphorothioation-sensing bacterial defense system with broad anti-phageactivities. Nature Microbiology , 2020, 5(7):1.) and key modules of the L-tryptophan synthesis pathway trpE fbr -aroG fbr -tktA (One-step of tryptophan attenuator inactivation and promoter swapping to improve the production of L-tryptophan in Escherichia coli. Microbial Cell Factories, 2012, 11(1):30.) and trpDCBA (Precursor-DirectedBiosynthesis of 5-Hydroxytryptophan Using Metabolically Engineered E. coli. Acs Synthetic Biology, 2015, 4(5):554.) were cloned into pCL1920 (GenBank AB236930.1) and pTrc99a (GenBank U13872.1) plasmids respectively to obtain recombinant plasmids pM-3 and pM-4, and were then transformed into W3110 (Δ) by electroporation. trxA The recombinant Escherichia coli obtained from the ΔFhuA552-558aa strain is the phage-resistant Escherichia coli XM-6.

[0037] 5. Fermentation detection of recombinant Escherichia coli XM-6 For batch fermentation assays, the recombinant bacterial strain was removed from a -80 °C cryogenic freezer, and 100 μL of the bacterial culture was inoculated into 50 mL of antibiotic-free LB liquid medium. The culture was then incubated overnight at 30 °C and 200 rpm in a constant-temperature shaker to activate the strain. Subsequently, the activated bacterial culture was transferred at a 5% (v / v) inoculation rate to seed medium (with or without the appropriate antibiotics) and incubated at 36 °C and 200 rpm with constant-temperature shaking for 6 hours. After incubation, the seed culture was transferred at a 5% (v / v) inoculation rate to fermentation medium (with or without the appropriate antibiotics) for fermentation, which was carried out at 36 °C and 200 rpm with constant-temperature shaking. During fermentation, samples were taken every 6 hours to measure the strain's growth, glucose consumption, and L-tryptophan production. Simultaneously, the pH of the culture system was monitored and adjusted every 6 hours, using ammonia solution to maintain it within the optimal pH range. For batch fed-batch fermentation testing, the recombinant bacterial strain was removed from an -80 ℃ ultra-low temperature freezer, and 100 μL of bacterial culture was inoculated into 50 mL of antibiotic-free LB liquid medium. The culture was then incubated overnight at 30 ℃ and 200 rpm in a constant-temperature shaker to activate the strain. Subsequently, the activated bacterial culture was transferred at a 5% (v / v) inoculation rate to a seed culture medium supplemented with the appropriate antibiotic, and cultured at 36 ℃ and 200 rpm with constant-temperature shaking. After the culture was completed, the seed culture was transferred at a 5% (v / v) inoculation rate to a fermentation medium supplemented with the appropriate antibiotic for fermentation. The fermentation process was carried out at 36 ℃ and 200 rpm with constant-temperature shaking, and the ammonia was automatically controlled at 6.8, while dissolved oxygen was controlled at 25%-35%. Whenever the fermentation sugar content fell below 5 g / L, 500 g / L of glucose was added until fermentation was completed.

[0038] 6. Methods for detecting strain growth, glucose consumption, and L-tryptophan production. During fermentation, a 1 mL sample was aseptically taken from the fermentation culture every 6 hours. The sample was centrifuged at 15,000 rpm for 3 minutes, and the supernatant was removed. The cells were then resuspended in 1 mL of distilled water. The culture was diluted appropriately as needed to ensure adequate absorbance (OD) at 600 nm. 600 The absorbance (OD) value was between 0 and 1.0. The absorbance of the diluted bacterial culture at 600 nm was measured using a spectrophotometer. 600 ), and based on the OD during fermentation 600A growth curve was plotted based on the changes in glucose levels. The supernatant was appropriately diluted with distilled water to ensure the glucose concentration was within the linear detection range of 0-1 g / L. Glucose concentration was measured using an SBA-40E biosensor analyzer; specific operation instructions were provided in the instrument's manual. A glucose consumption curve was plotted based on the results. The supernatant was filtered through a 0.22 μm aqueous filter membrane. Quantitative analysis of L-tryptophan was performed using an Agilent 1200 high-performance liquid chromatography system under the following chromatographic conditions: C18 reversed-phase column (250 mm × 4.6 mm, 5 μm); mobile phase: 0.05 mol / L KH₂PO₄-methanol (80:20, v / v); column temperature: 39℃; flow rate: 0.7 mL / min; detection wavelength: 254 nm; injection volume: 20 μL; run time: 12 min. A standard curve was prepared using L-tryptophan standards (Sigma-Aldrich, purity ≥99%), and quantitative analysis was performed using the external standard method.

[0039] 7. Determination of Escherichia coli titer Remove Escherichia coli W3110 from the -80 ℃ ultra-low temperature freezer and immediately thaw it on ice. After the bacterial suspension is completely dissolved, take 100 μL of the bacterial suspension in a clean bench and transfer it to 50 mL of sterile LB liquid medium. Incubate overnight at 37 °C with constant temperature shaking incubator at 200 rpm. The following day, 500 μL of the revived culture was aspirated from the laminar flow hood and inoculated into 50 mL of LB liquid medium. The medium was placed in a 37 °C constant temperature shaking incubator and shaken at 200 rpm until the OD of the bacterial culture reached a certain level. 600 The value reached 0.6.

[0040] OD 600 Once the bacterial culture reaches a concentration of 0.6, remove it from the incubator. In a clean bench, take 1 mL of the bacterial culture and dilute it 10-fold with ultrapure water. The dilution gradient is set to 10. -1 -10 -10 .

[0041] Divide the bottom of the petri dish into evenly spaced 3×5 squares, and mark the dilution factor of the bacterial solution on the edge of each row of squares.

[0042] Heat the pre-prepared LB solid culture medium until it is completely melted, and after cooling to about 50 °C, pour it into the marked petri dishes in a clean bench.

[0043] Using a pipette, pipette 5 μL of each serially diluted bacterial suspension and add it dropwise to the corresponding culture medium squares. When adding the liquid, keep the pipette tip perpendicular to the plate surface and gently touch the solidified medium, ensuring the droplets are evenly distributed in the marked area. Incubate the plates at 37 ℃ for 12 h.

[0044] After 12 hours, observe the double-layer plates and record the size and number distribution of single colonies at specific dilution gradients. Select a dilution factor that is suitable for the number of single colonies, uniformly distributed, and easy to count. Take the average value of the single colony count results of the three parallel dilution gradients and substitute it into the bacterial titer calculation formula.

[0045] Bacterial titer (PFU / mL): Average single colony count × dilution factor × 200 8. Phage titer detection The phage filtrate was serially diluted 10-fold using SM buffer (Tris 6.05 g / L; NaCl 8.75 g / L; anhydrous CaCl2 0.2 g / L; MgCl2·6H2O 2.05 g / L). -1 -10 -10 .

[0046] Divide the bottom of the petri dish into evenly spaced 3×5 squares, and mark the phage dilution factor on the edge of each row of squares.

[0047] Heat the pre-prepared LB solid medium until completely melted, and after cooling to about 50 °C, pour about 15-20 mL into a marked culture dish in a clean bench using aseptic techniques to prepare the bottom layer medium.

[0048] Prepare sterile 10 mL centrifuge tubes. Add 500 μL of SM buffer, 500 μL of E. coli culture with calculated CFU, and 5 mL of melted and constant-temperature 0.4% water agar to each tube. Gently mix and quickly pour onto the surface of the bottom layer of LB agar plate. Gently rotate the plate to distribute the top layer of agar evenly. Let it stand for 15-20 minutes to solidify.

[0049] Using a pipette, pipette 5 μL of each serially diluted T1 phage and add it dropwise onto the surface of the pre-labeled upper agar medium of the corresponding dilution. When adding the drop, keep the pipette tip perpendicular to the plate surface and gently touch the solidified top agar layer, ensuring the droplets are evenly distributed over the labeled area. Place the plates containing the phage dilutions in a 37 °C incubator.

[0050] After 7-12 hours, observe the double-layer plates and record the size and number distribution of plaques at specific dilution gradients. Select a dilution factor that is suitable for the number of plaques, uniformly distributed, and easy to count. Take the average value of the plaque count results from three parallel dilution gradients and substitute it into the phage titer calculation formula.

[0051] Phage titer (PFU / mL): Number of phage plaques × Dilution factor × 200 9. Determination of the optimal multiple of infection (MOI) for bacteriophages Calculation formula: MOI = PFU / CFU The phage with the measured PFU was diluted and mixed with an equal volume of host bacterial culture with the measured CFU, so that the MOIs of the mixture were 10, 1, 0.1, 0.01, 0.001, 0.0001, and 0.00001, respectively. The mixture was then incubated at 37 ℃ and 200 rpm for 4-6 h.

[0052] After incubation, the mixed culture was centrifuged at 8000 rpm for 10 min at 4 ℃. The supernatant was collected and filtered through a 0.22 μm microporous membrane. The phage titer was then determined using the double-layer plate method. By comparing the phage titers under different MOI conditions, the MOI value corresponding to the highest titer was determined as the optimal multiplicity of infection for that phage.

[0053] 10. Determine the growth curves of wild-type and recombinant Escherichia coli after phage infection. Remove Escherichia coli XM-6 and wild-type Escherichia coli W3110 from the -80 ℃ ultra-low temperature freezer and immediately thaw them on ice. After the bacterial suspension is completely dissolved, transfer 100 μL of the bacterial suspension to 50 mL of sterile LB liquid medium in a clean bench and incubate overnight at 37 °C with shaking at 200 rpm.

[0054] The following day, 500 μL of the resuscitation culture was transferred to 50 mL of fresh LB liquid medium and incubated at 37 ℃ and 200 rpm. Samples were taken every 1 hour to determine the OD of the host bacteria. 600 value.

[0055] When wild-type and recombinant Escherichia coli bacterial cultures OD 600 After all values ​​reached 0.6, 1 mL of bacterial suspension was taken and an equal volume of serially diluted phage suspension was added and mixed to make the final MOIs correspond to: optimal multiplicity of infection (MOIopt), 10×MOIopt (high infection group) and 0.1×MOIopt (low infection group).

[0056] 200 μL of the mixed culture was added to each well of a 96-well plate and incubated at 37 ℃ with shaking for 24 h. The growth curves of each group of cultures were dynamically monitored using a microplate reader, and OD was automatically recorded every 30 min. 600 value.

[0057] Based on the monitored OD values ​​of wild-type and recombinant Escherichia coli 600 The values ​​changed, and the cell growth curves under three MOI conditions (MOIopt, 10×MOIopt, 0.1×MOIopt) were compared.

[0058] 11. Determine the number of phage plaques in wild-type and recombinant Escherichia coli after phage infection. Wild-type and recombinant Escherichia coli, stored at -80 °C, were immediately thawed on ice. After the bacterial suspension was completely dissolved, 100 μL of the bacterial suspension was transferred to 50 mL of sterile LB broth in a clean bench and incubated overnight at 200 rpm in a 37 °C constant temperature shaking incubator. The following day, 500 μL of the revived culture was aspirated from the laminar flow hood and inoculated into 50 mL of LB liquid medium. The medium was then placed in a 37 °C constant temperature shaking incubator and shaken at 200 rpm until the OD of the bacterial culture reached a certain level. 600 Remove and set aside when the value reaches 0.6.

[0059] Heat the pre-prepared LB solid medium until completely melted, and after cooling to about 50 °C, pour about 15-20 mL into a marked culture dish in a clean bench using aseptic techniques to prepare the bottom layer medium.

[0060] Take a sterile 10 mL centrifuge tube and add the following components in sequence: 5 mL of 0.4% water agar stored at 55 ℃, 500 μL of SM buffer, and 500 μL of OD. 600 Wild-type / recombinant E. coli cultures with a plaque concentration (MOI) of 0.6 and 500 μL of serially diluted phage suspensions (final MOI values ​​of MOIopt, 10×MOIopt, and 0.1×MOIopt, respectively) were prepared. After gentle mixing, the mixture was immediately poured onto pre-prepared LB agar plates. The top layer of agar was spread evenly by slowly rotating the plate. The plates were then incubated at 37 °C for 7–12 h, and the number of plaques on the plates was counted.

[0061] II. Experimental Results In this study, we first used wild-type Escherichia coli W3110 as the starting strain and knocked out the protein encoding thioredoxin. trxAGenes were first introduced to block the synthesis of bacteriophage DNA within the host bacteria. Subsequently, the FhuA protein was modified at specific sites, deleting amino acids 552-558, thereby reducing the phage's adsorption efficiency to the host bacteria. Based on this, the genes encoding the L-tryptophan operon repressor protein were sequentially knocked out. trpR Genes and those encoding tryptophanase tnaA Genes that reduce the repression of key enzymes in the tryptophan synthesis pathway and the degradation by tryptophanase ( Figure 1-Figure 4 At the same time, phosphorus thioylation was used to modify the system genes. sspBC and sspDE Key modules of the L-tryptophan synthesis pathway trpE fbr -aroG fbr -tktA and trpDCBA The recombinant plasmid pM-3 was obtained by cloning into pCL1920 (GenBank AB236930.1) and pTrc99a (GenBank U13872.1) plasmids, respectively. Figure 5 ) and pM-4 ( Figure 6 The recombinant Escherichia coli XM-6, which possesses both phage tolerance and L-tryptophan synthesis levels, was obtained by transforming the genetically modified strain through electroporation.

[0062] To verify the overall performance of XM-6, the growth curves of wild-type and XM-6 strains were monitored under different multiples of infection (MOIopt, 10×MOIopt, and 0.1×MOIopt) of three bacteriophages (T1, T4, and T7). Figure 7 Then, the plaque formation differences between wild-type and XM-6 strains of three phages (T1, T4, and T7) under the same MOI conditions (MOIopt, 10×MOIopt, and 0.1×MOIopt) were quantitatively compared using the double-layer plate method. Figure 8 The results showed that XM-6 exhibited significant resistance to three T-lineage phages. Furthermore, through optimized expression of key enzymes in the metabolic pathway, the glucose utilization rate was increased by 32.2% (from 0.59 g / L / h in the wild-type strain to 0.78 g / L / h), and 37.76 g / L of L-tryptophan could be synthesized in a 5-L fermenter. Figure 9-Figure 11 This invention provides a novel strategy for addressing the common problem of phage contamination in L-tryptophan industrial fermentation. Furthermore, the *E. coli* strain resistant to multiple T-line phages developed in this study can also be used for the microbial fermentation of various other high-value-added compounds, demonstrating significant application potential and value.

[0063] In summary, this embodiment achieves the following beneficial effects: 1. The constructed recombinant Escherichia coli XM-6 exhibits resistance to multiple T-line phages, providing a novel strategy for addressing the common problem of phage contamination in L-tryptophan industrial fermentation; 2. The constructed recombinant Escherichia coli XM-6 has a high level of L-tryptophan synthesis and has the potential for industrial application.

[0064] 3. By expressing key genes in the L-tryptophan synthesis pathway, recombinant Escherichia coli XM-6 exhibited a higher glucose utilization rate than the wild-type strain, which was 32.2% higher than the initial strain.

[0065] Matters not covered in this invention are common knowledge.

[0066] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Application of a bacteriophage-resistant Escherichia coli in the fermentation production of L-tryptophan; The environment in which L-tryptophan is produced is contaminated with bacteriophages; The *E. coli* strain was modified by knocking out the protein encoding thioredoxin in the starting strain. trxA Genes were used to perform site-specific modifications to the FhuA protein and to knock out the gene encoding the L-tryptophan operon repressor protein. trpR Genes and those encoding tryptophanase tnaA Gene acquisition; The method also includes modifying the system genes with phosphorus thioylation. sspBC and sspDE Key modules of the L-tryptophan synthesis pathway trpE fbr -aroG fbr -tktA and trpDCBA Introduced into E. coli; The specific method for site-directed modification of FhuA protein is to delete amino acids 552-558 of FhuA protein; The starting strain was wild-type *E. coli* W3110; the *E. coli* strain resistant to the phage was *E. coli* (…). Escherichia coli XM-6, this strain was deposited at the China Center for Type Culture Collection on September 22, 2025, with the following accession number: CCTCC NO: M 20252086; The method for constructing the phage-resistant Escherichia coli includes: S1. Using wild-type Escherichia coli as the starting strain, the protein encoding thioredoxin was knocked out. trxA Genes that block the synthesis of bacteriophage DNA within the host bacteria; S2. The FhuA protein is modified at specific sites by deleting amino acids at positions 552-558, thereby reducing the adsorption efficiency of the bacteriophage on the host bacteria. S3, Knockout of the protein encoding the L-tryptophan operon repressor trpR Genes and those encoding tryptophanase tnaA Gene; The method further includes: S4, modifying the gene of the phosphorus thioylation system. sspBC and sspDE Key modules of the L-tryptophan synthesis pathway trpE fbr -aroG fbr -tktA and trpDCBA The recombinant plasmids pM-3 and pM-4 were cloned into pCL1920 and pTrc99a plasmids, respectively. The recombinant Escherichia coli obtained by transforming the gene-modified strains with these plasmids through electroporation were the phage-resistant Escherichia coli.

2. A method for the industrial production of L-tryptophan, characterized in that, The method includes: fermenting and culturing *E. coli* resistant to bacteriophages as described in claim 1 (…). Escherichia coli XM-6, and the L-tryptophan was obtained by separation and purification.

Images