Aspergillus oryzae genetically engineered strain and application thereof

Abstract

The present application relates to the technical field of microbial genetic engineering and fermentation engineering, and specifically discloses an Aspergillus oryzae genetically engineered strain and application thereof, wherein the genetically engineered strain ZW28-AsA1AsB1AsC1AsD1 is a four-gene knockout strain constructed by successively knocking out protease genes AosedA 、 AosedB 、 AosedC and AosedD of Aspergillus oryzae ZW28 as a starting strain by using gene editing technology. The four-gene knockout strain provided by the present application has an average decrease of 35% in total extracellular protease activity, and the yield of expressed human lysozyme and calf rennet is 65 mg / L and 122.2 mg / L, respectively, which is 4.7 to 5.2 times higher than that of the original strain. The four-gene knockout strain shows strong universality to exogenous proteins of different sources and pH characteristics, and provides an advantageous platform for efficient production of industrial enzymes.

Description

Technical Field

[0001] This invention relates to the fields of microbial genetic engineering and fermentation engineering technology, specifically to a genetically engineered strain of Aspergillus oryzae and its applications. Background Technology

[0002] Aspergillus oryzae ( Aspergillus oryzae Aspergillus oryzae has long been used in traditional food fermentation and is a generally recognized safe strain (GRAS). In recent years, with the rapid development of gene recombination technology, Aspergillus oryzae has attracted increasing attention due to its outstanding protein secretion capacity, post-translational processing mechanism more similar to mammals, much lower cultivation costs than plants and animals, ease of industrial production, mature fermentation technology, and high safety, becoming a new generation of outstanding hosts for exogenous protein expression and secretion. Some researchers at home and abroad have used Aspergillus oryzae to produce recombinant proteins and have attempted to improve exogenous protein yield through strategies such as increasing gene copy number, using strong promoters, and gene fusion. However, the yield of exogenous proteins is usually very low, far less than the yield of endogenous proteins in Aspergillus oryzae. Therefore, obtaining a high-yielding Aspergillus oryzae strain for exogenous protein is of great significance. Summary of the Invention

[0003] To obtain a high-yield Aspergillus oryzae strain of exogenous protein, this invention provides a genetically engineered Aspergillus oryzae strain and its applications. The quadruple gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1 provided by this invention exhibits an average decrease of 35% in total extracellular protease activity, and achieves yields of 65 mg / L for human lysozyme and 122.2 mg / L for calf chymotrypsin, representing increases of 4.7 to 5.2 times compared to the original strain. Furthermore, it demonstrates strong universality for exogenous proteins from different sources and with varying pH characteristics, providing an advantageous platform for the efficient production of industrial enzymes.

[0004] This invention provides a strain of Aspergillus oryzae ( Aspergillus oryzae The genetically engineered strain, ZW28-ΔsA1ΔsB1ΔsC1ΔsD1, was obtained by continuously knocking out Aspergillus oryzae ZW28. AosedA , AosedB , AosedC and AosedD Gene acquisition; The Aspergillus oryzae ZW28 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 3, 2025, with accession number GDMCC No: 65967, and classified as follows: Aspergillus oryzae .

[0005] The quadruple gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1 provided by this invention exhibits an average decrease of 35% in total extracellular protease activity, and expresses human lysozyme and calf chymotrypsin at yields of 65 mg / L and 122.2 mg / L, respectively, representing increases of 4.7 to 5.2 times compared to the original strain. Furthermore, it demonstrates strong universality for exogenous proteins from different sources and with varying pH characteristics, providing an advantageous platform for the efficient production of industrial enzymes.

[0006] This invention also provides a method for constructing a genetically engineered strain of Aspergillus oryzae, using the Gateway™ gene editing system and the Aspergillus oryzae multiple gene knockout cycle system to modify the Aspergillus oryzae ZW28 strain. AosedA , AosedB , AosedC and AosedD Gene knockout yielded strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1.

[0007] Furthermore, it includes the following steps: Starting with Aspergillus oryzae ZW28, the following were constructed and introduced sequentially. AosedA , AosedB , AosedC and AosedD The gene knockout kit was used, and each step was verified by PCR to confirm the success of gene knockout, ultimately resulting in the quadruple gene knockout Aspergillus oryzae genetically engineered strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1.

[0008] Furthermore, construct AosedA The gene knockout cassette was introduced into Aspergillus oryzae ZW28 to obtain the Aspergillus oryzae AosedA gene knockout strain ZW28-∆sA1; construction AosedB The gene knockout cassette was introduced into ZW28-∆sA1 to obtain Aspergillus oryzae. AosedA , AosedB Gene knockout strain ZW28-ΔsA1ΔsB1; Construction AosedC The gene knockout cassette was introduced into ZW28-ΔsA1ΔsB1 to obtain Aspergillus oryzae. AosedA , AosedB , AosedC Gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1; Construction AosedD The gene knockout cassette was introduced into ZW28-ΔsA1ΔsB1ΔsC1 to obtain Aspergillus oryzae. AosedA , AosedB , AosedC , AosedD Gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1.

[0009] Furthermore, the aforementioned AosedA The steps for constructing a gene knockout cassette are as follows: Using Aspergillus oryzae ZW28 genomic DNA as a template, amplification AosedA The 1.5 kb upstream sequence of the gene ORF and a fusion fragment containing a 1.5 kb downstream sequence and a 0.3 kb upstream sequence were obtained. The upstream sequence and fusion fragment were cloned into the pDONR™P4-P1R and pDONR™P2R-P3 vectors, respectively, via a backpropagation (BP) reaction to obtain 5' and 3' initiation clones. The obtained 5' and 3' initiation clones were then subjected to an LR reaction with the pgEpG and pDEST™R4-R3 target vectors to construct the gene. AosedA Gene knockout plasmid; amplified using the gene knockout plasmid as a template. Aosed The gene knockout fragment, i.e. AosedA Gene knockout boxes.

[0010] The AosedB The steps for constructing a gene knockout cassette are as follows: Using Aspergillus oryzae ZW28 genomic DNA as a template, amplification was performed separately. AosedB The 1.5 kb upstream sequence of the gene ORF and a fusion fragment containing a 1.5 kb downstream sequence and a 0.3 kb upstream sequence were obtained. The upstream sequence and fusion fragment were cloned into the pDONR™P4-P1R and pDONR™P2R-P3 vectors, respectively, via a backpropagation (BP) reaction to obtain 5' and 3' initiation clones. The obtained 5' and 3' initiation clones were then subjected to an LR reaction with the pgEpG and pDEST™R4-R3 target vectors to construct the gene. AosedB Gene knockout plasmid; amplified using the gene knockout plasmid as a template. AosedB The gene knockout fragment, i.e. AosedB Gene knockout boxes.

[0011] The AosedC The steps for constructing a gene knockout cassette are as follows: Using Aspergillus oryzae ZW28 genomic DNA as a template, amplification was performed separately. AosedC The 1.5 kb upstream sequence of the gene ORF and a fusion fragment containing a 1.5 kb downstream sequence and a 0.3 kb upstream sequence were obtained. The upstream sequence and fusion fragment were cloned into the pDONR™P4-P1R and pDONR™P2R-P3 vectors, respectively, via a backpropagation (BP) reaction to obtain 5' and 3' initiation clones. The obtained 5' and 3' initiation clones were then subjected to an LR reaction with the pgEpG and pDEST™R4-R3 target vectors to construct the gene. AosedC Gene knockout plasmid; amplified using the gene knockout plasmid as a template. AosedC The gene knockout fragment, i.e. AosedC Gene knockout boxes.

[0012] The AosedDThe steps for constructing a gene knockout cassette are as follows: Using Aspergillus oryzae ZW28 genomic DNA as a template, amplification was performed separately. AosedD The 1.5 kb upstream sequence of the gene ORF and a fusion fragment containing a 1.5 kb downstream sequence and a 0.3 kb upstream sequence were obtained. The upstream sequence and fusion fragment were cloned into the pDONR™P4-P1R and pDONR™P2R-P3 vectors, respectively, via a backpropagation (BP) reaction to obtain 5' and 3' initiation clones. The obtained 5' and 3' initiation clones were then subjected to an LR reaction with the pgEpG and pDEST™R4-R3 target vectors to construct the gene. AosedD Gene knockout plasmid; amplified using the gene knockout plasmid as a template. AosedD The gene knockout fragment, i.e. AosedD Gene knockout boxes.

[0013] Furthermore, the gene knockout cassette is introduced into Aspergillus oryzae ZW28, ZW28-ΔsA1, ZW28-ΔsA1ΔsB1, ZW28-ΔsA1ΔsB1ΔsC1 or ZW28-ΔsA1ΔsB1ΔsC1ΔsD1 via protoplast fusion technology.

[0014] The present invention also provides an application of Aspergillus oryzae genetically engineered strain in the production of exogenous proteins, wherein the Aspergillus oryzae genetically engineered strain is used to increase the yield of exogenous proteins.

[0015] Furthermore, the exogenous protein includes any one or a combination of human lysozyme, calf chymotrypsin, cellulase, laccase, and manganese peroxidase.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention utilizes genetic engineering technology to perform targeted genetic modification on a self-isolated and identified Aspergillus oryzae strain ZW28, by knocking out four protease genes of the Sedolisin family ( AosedA , AosedB , AosedC and AosedD The systemic disruption of Aspergillus oryzae's robust extracellular protease network resulted in ( Picture 1 , Picture 2 Both single and sequential knockouts effectively reduced the activity of total extracellular proteases. The final quadruple gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1 showed an average decrease of 35% in total extracellular protease activity, and also a significant decrease in tripeptidyl peptidase activity, which is closely related to protein degradation (P<0.01). This created a decisively favorable environment for the stable existence of exogenous proteins in the fermentation broth.

[0017] The quadruple gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1 constructed in this invention achieves a significant increase in the production of exogenous proteins: the production of human lysozyme (HLY, optimal pH slightly alkaline) in the quadruple gene knockout strain reaches 65 mg / L, which is 5.2 times that of the original strain (12.5 mg / L), and the difference is highly significant (P<0.01). Picture 3 The yield of calf rennet (CHY, optimal pH slightly acidic) in the quadruple gene knockout strain reached 122.2 mg / L, which was 4.7 times that of the original strain (26.0 mg / L), and the difference was also highly significant (P<0.01). Picture 4 ).

[0018] The genetically modified strain constructed in this invention is successfully adapted to exogenous proteins from different sources (human and bovine) and with different optimal pH values ​​(acidic and alkaline), achieving several-fold yield increases in all cases. This strongly demonstrates that the genetically modified strain is not effective against specific proteins but has broad versatility. It is also suitable for producing other industrial enzymes with high commercial value, such as cellulase, laccase, and manganese peroxidase, providing a powerful and universal host platform for the efficient industrial production of various recombinant proteins.

[0019] Information on the preservation of biological materials: ZW28, referred to as *Aspergillus oryzae* ZW28 in this invention, was deposited on March 3, 2025, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC) with accession number GDMCC No. 65967. The address of the depository is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, 510070, China. Aspergillus oryzae . Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Picture 1 for AosedA , AosedB , AosedC and AosedD Effects of gene knockout alone on total extracellular protease activity; in the figure, * indicates a significant difference (P<0.05); ** indicates a highly significant difference (P<0.01).

[0022] Picture 2 for AosedA , AosedB , AosedC and AosedD Effects of sequential gene knockout on the activities of total extracellular proteases and tripeptidyl peptidase. * indicates a statistically significant difference (P<0.05); ** indicates a highly statistically significant difference (P<0.01).

[0023] Picture 3 Comparison of human lysozyme production by exogenously expressed human lysozyme in wild-type Aspergillus oryzae and quadruple gene knockout strains.

[0024] Picture 4 Comparison of calf rennet production by exogenously expressed Aspergillus oryzae wild-type strain and quadruple gene knockout strain. Detailed Implementation

[0025] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0026] Example 1: A genetically engineered strain of Aspergillus oryzae and its application.

[0027] 1. Test materials The expression plasmids pgAKCN and pgAFLN are documented in "Isolation of aspergillus oryzae mutants for heterologous protein production from a double proteinase gene disruptant" (Takashi, Nemoto, Taisuke, Watanabe, Yutaka, & Mizogami, et al. (2009). Isolation of aspergillus oryzae mutants for heterologous protein production from a double proteinase gene disruptant. Applied Microbiology&Biotechnology.82, 1105-1114.); pgEpG is recorded in "Multiple gene disruptions by marker recycling with highly efficient gene-targeting background (Δ ligD ) in Aspergillus oryzae 》(Maruyama J., Kitamoto K. (2008) Multiple gene disruptions by markerrecycling with highly efficient gene-targeting background (Δ ligD )in Aspergillus oryzae . Biotechnol. Lett. 30: 1811-1817.).

[0028] The applicant guarantees to release the biological materials to the public within twenty years from the date of application.

[0029] 2. Isolation, identification and preservation of wild strains of Aspergillus oryzae The strain was isolated from a rice granary in Wuchang City, Heilongjiang Province. Airborne filamentous fungal spores were collected using CYA medium (pH 10, containing 25 µg / mL chloramphenicol) (NaNO3 3.0 g, KH2PO4 1.0 g, KCl 0.5 g, MgSO4·7H2O 0.5 g, FeSO4·7H2O 0.01 g, yeast extract 5.0 g, sucrose 30.0 g, agar 15.0 g, distilled water 1.0 L) and incubated at 25℃ for 5 days. Single colonies were picked and transferred to fresh CYA medium, and purification was repeated until a pure filamentous fungal strain was obtained for morphological observation.

[0030] The mycelial DNA of the strain was extracted using the ISOPLANT II DNA Rapid Extraction Reagent (purchased from WAKO Pure Chemicals, catalog number 316-04153) as a DNA template. β-Tubulin Gene-specific primers Bt2a (GGTAACCAAATCGGTGCTGCTTTC, SEQ ID NO: 1) and Bt2b (ACCCTCAGTGTAGTGACCCTTGGC, SEQ ID NO: 2) were used for PCR amplification. The total volume of the PCR reaction system was 25 µL (2 µL DNA template, 12.5 µL Taq enzyme Mix, 1 µL 10 µM Bt2a, 1 µL 10 µM Bt2b, and 8.5 µL double-distilled water). The reaction program was as follows: 94℃ for 5 min; denaturation at 94℃ for 50 s, annealing at 55℃ for 50 s, extension at 72℃ for 50 s, 33 cycles; and extension at 72℃ for 7 min.

[0031] The PCR-amplified sample was sent to Shanghai Sangon Biotech for sequencing analysis. The sequencing results showed 99% homology with the reference type species of *Aspergillus*, confirming the strain belonged to the *Aspergillus* yellow-green group. Further, after culturing for 3 days in AFPA toxin-producing medium (10.0 g peptone, 20.0 g yeast extract, 0.5 g ferric citrate, 0.002 g tetrachloroquinone, 15.0 g chloramphenicol, 15.0 g agar), the reverse side of the colonies showed a distinct yellow-brown color, indicating that the strain did not produce toxins (toxin production can be used as one of the indicators for identifying *Aspergillus oryzae* strains). The strain was then subjected to PCR amplification using the specific primers AflM-1for (AAGTTAATGGCGGAGACG, SEQ ID NO: 3) and AflM-2rev (TCTACCTGCTCATCGGTGA, SEQ ID NO: 4) for the *Aspergillus oryzae* A dehydrogenase gene. The total volume of the PCR reaction system was 25 µL (2 µL DNA template, 12.5 µL Taq enzyme mix, 1 µL...). The reaction mixture consisted of 10 µM AflM-1 (1 µL of 10 µM AflM-2rev) and 8.5 µL of double-distilled water. The reaction program was as follows: 94℃ for 5 min; denaturation at 94℃ for 50 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, for 33 cycles; and a final extension at 72℃ for 10 min. No amplification band was observed during PCR, and the strain was ultimately identified as *Aspergillus oryzae*, named *Aspergillus oryzae* ZW28.

[0032] 3. Strains Construction Method This invention utilizes the mature Gateway™ gene editing system and the Aspergillus oryzae multiple gene knockout cycle system, using Aspergillus oryzae ZW28 as the starting strain, and constructs the engineered strain ZW28 in the following steps: 3.1 Construction of Aspergillus oryzae AosedA gene knockout strain The Aspergillus oryzae AosedA gene knockout strain was constructed using the MultiSite Gateway™ system (Invitrogen Carlsbad, CA, USA), and the construction method is as follows: Genomic DNA of Aspergillus oryzae ZW28 was extracted using ISOPLANT II DNA Rapid Extraction Reagent (purchased from WAKO Pure Chemicals, catalog number 316-04153).

[0033] Using aB4-5sA_F and aB1r-5sA_R as primers and Aspergillus oryzae ZW28 genomic DNA as a template, the 1.5 kb upstream region of the AosedA (AO090023000263) ORF was amplified by PCR. The total volume of the PCR reaction system was 25 µL (2 µL DNA template, 12.5 µL Taq enzyme mix, 1 µL 10 µM aB4-5sA_F, 1 µL 10 µM aB1r-5sA_R, and 8.5 µL double-distilled water). The reaction program was: 94 °C for 5 min; 94 °C denaturation for 50 s, 55 °C annealing for 45 s, 72 °C extension for 45 s, 30 cycles; 72 °C extension for 10 min. Then, a MultiSite Gateway was applied. TM The Pro Plus kit (Invitrogen, catalog number 12537100) uses the BP reaction in the kit to transfer PCR products into pDONR™P4-P1R in the kit to obtain the 5' initiation clone pg5'sA.

[0034] Using Aspergillus oryzae ZW28 genomic DNA as a template, and aB2r-sA_F and f-sA+p_R as primers, the 0.3 kb upstream region of the AosedA ORF was amplified by PCR. Using f-sA+p_F and aB3-sA_R as primers, and the same Aspergillus oryzae ZW28 genomic DNA as a template, the 1.5 kb downstream region of the AosedA ORF was amplified by PCR. Fusion-PCR was then performed using aB2r-sA_F and aB3-sA_R as primers for both fragments. The reaction system and procedure for these three PCRs were consistent with the steps in the PCR amplification of the 1.5 kb upstream region of the AosedA (AO090023000263) ORF. Then, MultiSite Gateway was applied. TM The ProPlus kit uses the BP reaction in the kit to transfer PCR products into pDONR™P2R-P3 in the kit to obtain the 3' initiation clone pg3'sA+p.

[0035] The prepared pg5'sA, pg3'sA+p, and pgEpG were mixed with the target vector pDESTTMR4-R3 (purchased from Invitrogen) at a volume ratio of 1:1:1:1, and then processed using a MultiSite Gateway. TM Using the Pro Plus kit, the LR reaction was performed to obtain the AosedA gene knockout plasmid pg∆sApG.

[0036] Using aB4-5sA_F and aB3-sA_R as primers, and the AosedA gene knockout plasmid pg∆sApG as a template, the AosedA gene knockout fragment was amplified under the same PCR conditions and conditions as the aB4-5sA_F and aB1r-5sA_R primers described above.

[0037] The gene knockout fragment was transferred into Aspergillus oryzae ZW28. The specific steps were as follows: Aspergillus oryzae ZW28 was cultured on PDA medium (Oxoid Ltd., UK, catalog number CM0139B) at 30°C for 5 days. Mycelia and spores were collected and inoculated into 100 mL DPY liquid medium and cultured at 30°C for 20 h. Mycelia were collected using Miracloth (Calbiochem, La Jolla, CA, USA), washed with sterile distilled water until colorless, and then cultured in TF solution I (1% Yatalase (TaKaRa), 0.6 M (NH4)2SO4, 50 mM maleate buffer, pH 5.5) at 30°C with shaking in a water bath (50 rpm) for 3 h. Mycelia were filtered using Miracloth, and the filtrate containing protoplasts was collected. Add 10 mL of TF solution II (1.2 M sorbitol (TaKaRa), 50 mM CaCl2, 35 mM NaCl, 10 mM Tris-HCl, pH 7.5) to the filtrate containing protoplasts, centrifuge at 2000 rpm for 6 min, discard the supernatant, and redissolve the precipitate in 10 mL of TF solution II. Centrifuge to collect the precipitate and obtain protoplasts. Dissolve the precipitate with TF solution II and adjust the amount of TF solution II to achieve a protoplast concentration of 1 × 10⁻⁶. 7 / mL to 5×10 7 / mL. Mix 200 μL of protoplasts with 10 μg / 10 μL of gene knockout fragment, incubate on ice for 30 min, then slowly add TF solution III (60% PEG4000, 50 mM CaCl2, 10 mM Tris-HCl, pH 7.5, v / v) in three portions. The volumes of TF solution III added for the three portions are 250 μL, 250 μL, and 850 μL, respectively. After incubating at room temperature for 20 min, add 5 mL of TF solution II, centrifuge at 6000 rpm for 6 min, discard the supernatant, dissolve the precipitate in 500 μL of TF solution II, and add to 5 mL of melted M+Met medium (NH4Cl 0.2 g, (NH4)2SO4 0.1 g, KCl 0.05 g, NaCl 0.05 g, KH2PO4 0.1 g, MgSO4·7H2O 0.05 g, glucose 2 g, methionine 0.15 g). Add g of the extract to distilled water to bring the volume to 100 mL, and adjust the pH to 5.5 with NaOH. Mix well and spread on M+Met medium. Incubate at 30°C for 5 days. Then, perform two line screenings on M+Met medium (5 days each time) to obtain the Aspergillus oryzae AosedA gene knockout strain ZW28-∆sA1.

[0038] Using aB4-5sA_F and aB3-sA_R as primers, and the obtained ZW28-∆sA1 genomic DNA (extracted using ISOPLANT II DNA rapid extraction reagent) as a template, the gene knockout was verified by comparing the sequence length.

[0039] 3.2 Construction of Aspergillus oryzae AosedB gene knockout strain The Aspergillus oryzae AosedB gene knockout strain was constructed using the MultiSite Gateway™ system, and the construction method is as follows: Using Aspergillus oryzae ZW28 genomic DNA as a template, and aB4-5sB_F and aB1r-5sB_R as primers, the 1.5 kb upstream region of the AosedB (AO090011000235) ORF was amplified under the PCR conditions described in section 3.1. Then, MultiSiteGateway was applied. TMThe Pro Plus kit, using the BP reaction in the kit, transferred the PCR product into pDONR™ P4-P1R to obtain the 5' initiator clone pg5'sB. Using Aspergillus oryzae ZW28 genomic DNA as a template, the 0.3 kb upstream region of the AosedB ORF was amplified using aB2r-sB_F and f-sB+p_R primers according to the PCR conditions in section 3.1; the 1.5 kb downstream region of the AosedB ORF was amplified using f-sB+p_F and aB3-sB_R primers according to the PCR conditions in section 3.1; these two fragments were then subjected to Fusion-PCR using aB2r-sB_F and aB3-sB_R primers according to the PCR conditions in section 3.1. MultiSite Gateway was then applied. TM The Pro Plus kit (Invitrogen, catalog number 12537100) was used to transform PCR products into pDONR™ P2R-P3 in the kit via the BP reaction, yielding the 3' initiation clone pg3'sB+p. The prepared pg5'sB, pg3'sB+p, and pgEpG were then mixed with the target vector pDESTTMR4-R3 and processed using the MultiSite Gateway. TM Using the ProPlus kit, the LR reaction was performed to obtain the AosedB gene knockout plasmid pg∆sBpG.

[0040] Using aB4-5sB_F and aB3-sB_R as primers, and the AosedB gene knockout plasmid pg∆sBpG as a template, the AosedB gene knockout fragment was amplified under the PCR conditions described in 3.1. This DNA fragment was then transformed into *Aspergillus oryzae* ZW28 and strain ZW28-ΔsA1, following the same steps as in 3.1, to obtain the *Aspergillus oryzae* AosedB single gene knockout strain ZW28-ΔsB1 and the AosedA and AosedB dual gene knockout strain ZW28-ΔsA1ΔsB1. Using aB4-5sB_F and aB3-sB_R as primers, and the obtained ZW28-ΔsB1 and ZW28-ΔsA1ΔsB1 genomic DNA (extracted using ISOPLANT II DNA rapid extraction reagent) as templates, the gene knockout was verified as successful.

[0041] 3.3 Construction of Aspergillus oryzae AosedC gene knockout strain The AosedC gene knockout strain of Aspergillus oryzae was constructed using the MultiSite Gateway™ system, and the construction method is as follows: Using Aspergillus oryzae ZW28 genomic DNA as a template, and aB4-5sC_F and aB1r-5sC_R as primers, the 1.5 kb upstream region of the AosedC(AO090005001380) ORF was amplified under the PCR conditions described in section 3.1. Then, MultiSiteGateway was applied. TM The Pro Plus kit, using the BP reaction in the kit, transferred the PCR product into pDONR™ P4-P1R to obtain the 5' initiation clone pg5'sC. Using Aspergillus oryzae ZW28 genomic DNA as a template, and employing aB2r-sC_F and f-sC+p_R as primers, the 0.3 kb upstream region of the AosedC ORF was amplified according to the PCR conditions in section 3.1. The 1.5 kb downstream region of the AosedC ORF was amplified using f-sC+p_F and aB3-sC_R as primers, also according to the PCR conditions in section 3.1. Fusion-PCR was then performed on these two fragments using aB2r-sC_F and aB3-sC_R as primers, according to the PCR conditions in section 3.1. Finally, MultiSite Gateway was applied. TM The Pro Plus kit, using the BP reaction within the kit, transforms the PCR product into pDONR™ P2R-P3 to obtain the 3' initiation clone pg3'sC+p. The prepared pg5'sC, pg3'sC+p, and pgEpG are then mixed with the target vector pDESTTMR4-R3 and processed using MultiSite Gateway. TM Using the Pro Plus kit, the LR reaction was performed to obtain the AosedC gene knockout plasmid pg∆sCpG.

[0042] Using aB4-5sC_F and aB3-sC_R as primers, and the AosedC gene knockout plasmid pg∆sCpG as a template, the AosedC gene knockout fragment was amplified under the PCR conditions described in 3.1. This DNA fragment was then transformed into strains ZW28 and ZW28-ΔsA1ΔsB1, following the same steps as in 3.1, to obtain the Aspergillus oryzae AosedC single gene knockout strain ZW28-ΔsC1 and the AosedA, AosedB, and AosedC triple gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1. Using aB4-5sC_F and aB3-sC_R as primers, and the obtained ZW28-ΔsC1 and ZW28-ΔsA1ΔsB1ΔsC1 genomic DNA (extracted using ISOPLANT II DNA rapid extraction reagent) as templates, the gene knockout was verified to be successful.

[0043] 3.4 Construction of Aspergillus oryzae AosedD gene knockout strain The Aspergillus oryzae AosedD gene knockout strain was constructed using the MultiSite Gateway™ system, and the construction method is as follows: Using Aspergillus oryzae ZW28 genomic DNA as a template, and aB4-5sD_F and aB1r-5sD_R as primers, the 1.5 kb upstream region of the AosedD(AO090166000084) ORF was amplified under the PCR conditions described in section 3.1. Then, MultiSiteGateway was applied. TM The Pro Plus kit, using the BP reaction in the kit, transferred the PCR product into pDONR™ P4-P1R to obtain the 5' initiation clone pg5'sD. Using Aspergillus oryzae ZW28 genomic DNA as a template, and with aB2r-sD_F and f-sD+p_R as primers, the 0.3 kb upstream region of the AosedD ORF was amplified according to the PCR conditions in 3.1; the 1.5 kb downstream region of the AosedD ORF was amplified using f-sD+p_F and aB3-sD_R as primers, according to the PCR conditions in 3.1. Fusion-PCR was then performed on these two fragments using aB2r-sD_F and aB3-sD_R as primers, according to the PCR conditions in 3.1. Then, MultiSite Gateway was applied. TM The Pro Plus kit, using the BP reaction within the kit, transforms the PCR product into pDONR™ P2R-P3 to obtain the 3' initiation clone pg3'sD+p. The prepared pg5'sD, pg3'sD+p, and pgEpG are then mixed with the target vector pDESTTMR4-R3 and processed using MultiSite Gateway. TM The Pro Plus kit was used to perform the LR reaction as specified in the kit. The final result was the AosedD gene knockout plasmid pg∆sDpG.

[0044] Using aB4-5sD_F and aB3-sD_R as primers and the AosedD gene knockout plasmid pg∆sDpG as a template, the AosedD gene knockout fragment was amplified under the PCR conditions described in 3.1. This DNA fragment was then transformed into strains ZW28 and ZW28-ΔsA1ΔsB1ΔsC1, following the same steps as in 3.1, to obtain the Aspergillus oryzae AosedD single gene knockout strain ZW28-ΔsD1 and the AosedA, AosedB, AosedC, and AosedD quadruple gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1. Using aB4-5sC_F and aB3-sC_R as primers, and the obtained ZW28-ΔsD1 and ZW28-ΔsA1ΔsB1ΔsC1ΔsD1 genomic DNA (extracted using ISOPLANT II DNA rapid extraction reagent) as templates, the gene knockout was verified to be successful.

[0045] Table 1 Primer sequence information 4. Validation of exogenous protein expression The expression plasmid pgAKCN, containing the calf rennet gene, and the expression plasmid pgAFLN, containing the human lysozyme gene, were transformed into the quadruple gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1, respectively. The strains were fermented in 5× DPY liquid medium at 30°C. From day 3 to day 6 of culture, rennet activity and protein concentration were measured in the fermentation broth.

[0046] Compared with the original Aspergillus oryzae strain ZW28, each strain was knocked out individually. AosedA , AosedB , AosedC and AosedD After gene ( Picture 1 During the 3rd to 6th day of culture, the total extracellular protease activity of the strain decreased significantly (P<0.05); after knocking out four genes consecutively, the total extracellular protease activity and tripeptidyl peptidase activity of the strain decreased significantly during the 3rd to 6th day of culture (P<0.01), with the average decrease in total extracellular protease activity reaching 35%. Picture 2 Therefore, knocking out Sedolisin family protease genes can weaken the extracellular protease degradation system.

[0047] Meanwhile, the constructed quadruple knockout strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1 showed a significant increase in exogenous protein production. Taking human lysozyme (HLY) with an optimal pH of slightly neutral to alkaline as an example, after heterologous expression of human lysozyme in ZW28-ΔsA1ΔsB1ΔsC1ΔsD1, the lysozyme yield reached 65 mg / L on day 4 under 5× DPY (pH 8.0) conditions, which is 5.2 times that of the wild-type ZW28 heterologous human lysozyme yield (12.5 mg / L) (P<0.01). Picture 3 Taking chymotrypsin (CHY), which has an optimal pH of slightly acidic, as an example, after heterologous expression of chymotrypsin by the wild-type strain ZW28 of Aspergillus oryzae, the yield reached a maximum of 26.0 mg / L on day 4 when cultured in 5× DPY (pH 5.5) medium; after heterologous expression of chymotrypsin by ZW28-ΔsA1ΔsB1ΔsC1ΔsD1, the yield on day 4 was significantly increased by 4.7 times (P<0.01), reaching 122.2 mg / L. Picture 4 The results of efficient secretion of two exogenous proteins from different higher animals with different optimal pH values ​​indicate that the strategy of high exogenous protein production based on the genetically modified strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1 of Aspergillus oryzae is highly universal and has the potential to be applied to the efficient production of other commercially valuable exogenous proteins (such as cellulase, laccase, manganese peroxidase, and various industrial enzymes).

[0048] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0049] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A strain of Aspergillus oryzae ( Aspergillus oryzae Genetically engineered strains, characterized in that, The Aspergillus oryzae genetically engineered strain is ZW28-ΔsA1ΔsB1ΔsC1ΔsD1, which was obtained by continuously knocking out Aspergillus oryzae ZW28. AosedA , AosedB , AosedC and AosedD Gene acquisition; AosedA The genome number of the gene is AO090023000263. AosedB The genome number of the gene is AO090011000235. AosedC The genome number of the gene is AO090005001380. AosedD The genome number of the gene is AO090166000084; The preservation number of Aspergillus oryzae ZW28 is GDMCC No: 65967.

2. A method for constructing the Aspergillus oryzae genetically engineered strain according to claim 1, characterized in that, Using Aspergillus oryzae ZW28 as the starting strain, a construction was made AosedA The gene knockout cassette was introduced into Aspergillus oryzae ZW28 to obtain Aspergillus oryzae. AosedA Gene knockout strain ZW28-∆sA1; Construction AosedB The gene knockout cassette was introduced into ZW28-∆sA1 to obtain Aspergillus oryzae. AosedA and AosedB Gene knockout strain ZW28-ΔsA1ΔsB1; Construction AosedC The gene knockout cassette was introduced into ZW28-ΔsA1ΔsB1 to obtain Aspergillus oryzae. AosedA , AosedB and AosedC Gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1; Construction AosedD The gene knockout cassette was introduced into ZW28-ΔsA1ΔsB1ΔsC1 to obtain Aspergillus oryzae. AosedA , AosedB , AosedC and AosedD Gene knockout strain ZW28-ΔsA1ΔsB1ΔsC1ΔsD1.

3. The method for constructing the Aspergillus oryzae genetically engineered strain according to claim 2, characterized in that, The AosedA The steps for constructing a gene knockout cassette are as follows: Using Aspergillus oryzae ZW28 genomic DNA as a template, amplification was performed separately. AosedA The 1.5 kb upstream sequence of the gene's ORF and containing AosedA A fusion fragment of a 1.5 kb downstream sequence and a 0.3 kb upstream sequence of the gene's ORF was obtained. The upstream sequence and the fusion fragment were cloned into the pDONR™P4-P1R and pDONR™P2R-P3 vectors, respectively, via a backpropagation (BP) reaction to obtain 5' and 3' initiation clones. The obtained 5' and 3' initiation clones were then subjected to a backpropagation (LR) reaction with the pgEpG and pDEST™R4-R3 target vectors to construct the desired gene. AosedA Gene knockout plasmids; as described AosedA Gene knockout plasmids were used as templates for amplification. AosedA The gene knockout fragment, i.e. AosedA Gene knockout boxes; The AosedB The gene knockout cassette construction steps are as follows: using Aspergillus oryzae ZW28 genomic DNA as a template, amplify separately... AosedB The 1.5 kb upstream sequence of the gene's ORF and containing AosedB A fusion fragment of a 1.5 kb downstream sequence and a 0.3 kb upstream sequence of the gene's ORF was obtained. The upstream sequence and the fusion fragment were cloned into the pDONR™P4-P1R and pDONR™P2R-P3 vectors, respectively, via a backpropagation (BP) reaction to obtain 5' and 3' initiation clones. The obtained 5' and 3' initiation clones were then subjected to a backpropagation (LR) reaction with the pgEpG and pDEST™R4-R3 target vectors to construct the desired gene. AosedB Gene knockout plasmids; as described AosedB Gene knockout plasmids were used as templates for amplification. AosedB The gene knockout fragment, i.e. AosedB Gene knockout boxes; The AosedC The gene knockout cassette construction steps are as follows: using Aspergillus oryzae ZW28 genomic DNA as a template, amplify separately... AosedC The 1.5 kb upstream sequence of the gene's ORF and containing AosedC A fusion fragment of a 1.5 kb downstream sequence and a 0.3 kb upstream sequence of the gene's ORF was obtained. The upstream sequence and the fusion fragment were cloned into the pDONR™P4-P1R and pDONR™P2R-P3 vectors, respectively, via a backpropagation (BP) reaction to obtain 5' and 3' initiation clones. The obtained 5' and 3' initiation clones were then subjected to a backpropagation (LR) reaction with the pgEpG and pDEST™R4-R3 target vectors to construct the desired gene. AosedC Gene knockout plasmids; as described AosedC Gene knockout plasmids were used as templates for amplification. AosedC The gene knockout fragment, i.e. AosedC Gene knockout boxes; The AosedD The gene knockout cassette construction steps are as follows: using Aspergillus oryzae ZW28 genomic DNA as a template, amplify separately... AosedD The 1.5 kb upstream sequence of the gene's ORF and containing AosedD A fusion fragment of a 1.5 kb downstream sequence and a 0.3 kb upstream sequence of the gene's ORF was obtained. The upstream sequence and the fusion fragment were cloned into the pDONR™P4-P1R and pDONR™P2R-P3 vectors, respectively, via a backpropagation (BP) reaction to obtain 5' and 3' initiation clones. The obtained 5' and 3' initiation clones were then subjected to a backpropagation (LR) reaction with the pgEpG and pDEST™R4-R3 target vectors to construct the desired gene. AosedD Gene knockout plasmids; as described AosedD Gene knockout plasmids were used as templates for amplification. AosedD The gene knockout fragment, i.e. AosedD Gene knockout boxes.

4. The method for constructing the Aspergillus oryzae genetically engineered strain according to claim 2, characterized in that, The gene knockout cassette is introduced into Aspergillus oryzae ZW28, ZW28-ΔsA1, ZW28-ΔsA1ΔsB1 or ZW28-ΔsA1ΔsB1ΔsC1 via PEG-mediated protoplast transformation.

5. The application of the Aspergillus oryzae genetically engineered strain according to claim 1 in the production of exogenous proteins, characterized in that, The Aspergillus oryzae genetically engineered strain is used to increase the yield of exogenous proteins.

6. The application according to claim 5, characterized in that, The exogenous protein includes any one or a combination of human lysozyme, calf chymotrypsin, cellulase, laccase, and manganese peroxidase.

Images