Rslec14b gene related to radish leaf margin shape, indel marker and application thereof

Abstract

This invention belongs to the field of biotechnology and provides information related to the shape of radish leaf margins. RsLEC14B Genes, Indel markers, and their application in identifying / aiding the identification of radish leaf margin shape. Among these, those related to radish leaf margin shape... RsLEC14B The CDS sequence of the gene is shown in SEQ ID NO:1, the full-length DNA sequence is shown in SEQ ID NO:2 or SEQ ID NO:3, and the PCR primers for amplifying the CDS sequence are shown in SEQ ID NO:4 and SEQ ID NO:5. This invention provides... RsLEC14B Genes have great potential in improving the shape of radish leaf margins, based on RsLEC14B Molecular markers developed from gene sequences have the advantages of being simple to operate, highly accurate, and efficient in identifying the shape of radish leaf margins.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the RsLEC14B gene related to radish leaf shape and its application, and the Indel marker based on the RsLEC14B gene that is closely linked to radish leaf shape and its application. Background Technology

[0002] Radish (Raphanus sativus L.) is an important vegetable crop native to my country, with an average annual planting area of ​​16 million mu (approximately 1.1 million hectares). For a long time, radish has been a staple vegetable for ensuring vegetable supply and increasing farmers' income. The edible organ of the radish is its enlarged fleshy root. The balance between the underground fleshy root and the above-ground leaves affects yield, and leaf shape is one of the key factors in maintaining this balance, reflecting the interaction between variety domestication and environmental adaptation. Among these factors, leaf margin shape is a crucial influence on radish leaf shape. Leaf margin shapes can be categorized as entire without lobes, shallowly lobed, deeply lobed, and fully lobed. Radish varieties with entire, unlobed leaves exhibit higher photosynthetic efficiency and fleshy root yield.

[0003] The shape of plant leaf margins is mainly determined by genetic factors and regulated by multiple genes in a complex molecular regulatory network, including the NAC family Class I KNOTTED-like Homeobox (KNOX1), the CUP-SHAPED COTYLEDON (CUC) transcription factor, and the HD-ZIP family LATE MERISTEM IDENTITY1 (LMI1) transcription factor. Among them, LMI1 and its homeotype RCO are important genes that regulate leaf margin shape and leaflet development, and are key candidate genes for the formation of serrated or fully lobed traits in crops such as Arabidopsis thaliana, rapeseed, cabbage, and mustard. Summary of the Invention

[0004] To address the aforementioned problems in the prior art, this invention provides the RsLEC14B gene, Indel marker, and their applications related to the shape of radish leaf margins.

[0005] In a first aspect, the present invention provides the CDS sequence of the RsLEC14B gene related to the shape of radish leaf margin, the sequence composition of which is shown in SEQ ID NO:1 in the sequence listing;

[0006] Alternatively: It has greater than or equal to 95% homology with SEQ ID NO:1 in the sequence listing;

[0007] Or: A nucleotide sequence that encodes a protein having the same function as the protein encoded by the RsLEC14B gene, obtained by substitution, deletion, and / or addition of one or more nucleotides based on SEQ ID NO:1 in the sequence listing.

[0008] Secondly, the present invention provides the full-length DNA sequence of the RsLEC14B gene related to the shape of radish leaf margins, the sequence composition of which is shown in SEQ ID NO:2 in the sequence listing;

[0009] Alternatively: It has greater than or equal to 95% homology with SEQ ID NO:2 in the sequence listing;

[0010] Or: A nucleotide sequence that encodes a protein having the same function as the protein encoded by the RsLEC14B gene, obtained by substitution, deletion, and / or addition of one or more nucleotides based on SEQ ID NO:2 in the sequence listing.

[0011] Or as shown in SEQ ID NO:3 in the sequence list;

[0012] Alternatively: It has greater than or equal to 95% homology with SEQ ID NO:3 in the sequence listing;

[0013] Alternatively: a nucleotide sequence encoding a protein having the same function as the protein encoded by the RsLEC14B gene, obtained by substitution, deletion, and / or addition of one or more nucleotides based on SEQ ID NO:3 in the sequence listing.

[0014] Thirdly, the present invention provides PCR amplification primers for amplifying the CDS sequence (SEQ ID NO:1) of the RsLEC14B gene related to the leaf margin shape of radish provided in the first aspect, the nucleotide sequence composition of which is shown in SEQ ID NO:4 and SEQ ID NO:5 in the sequence listing.

[0015] Fourthly, this invention provides the application of the RsLEC14B gene, which is related to the shape of radish leaf margins, in regulating the shape of radish leaf margins.

[0016] Fifthly, the present invention provides an Indel mark that is closely linked to the shape of the radish leaf margin.

[0017] In a sixth aspect, the present invention provides a primer set for identifying the Indel marker provided in the fifth aspect of the present invention, the nucleotide sequence of which is shown in SEQ ID NO:8 and SEQ ID NO:9 in the sequence listing.

[0018] In a seventh aspect, the present invention provides a kit for identifying / assisting in the identification of radish leaf margin shape, the kit comprising the primer set provided in the sixth aspect of the present invention for identifying the Indel marker described in the fifth aspect of the present invention.

[0019] Eighthly, the present invention provides a method for identifying / assisting in identifying the shape of radish leaf margins, the method comprising using the primer set for identifying the Indel marker provided in the sixth aspect of the present invention, and / or the kit for identifying / assisting in identifying the shape of radish leaf margins provided in the seventh aspect of the present invention.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] 1. The RsLEC14B gene discovered in this invention has great potential in improving radish leaf shape, especially leaf margin shape.

[0022] 2. The molecular marker developed based on the RsLEC14B gene sequence in this invention has a high accuracy rate of 100% in assisting the selection of leaf margin shape during backcrossing and breeding.

[0023] 3. The method for improving radish leaf margin shape using the RsLEC14B gene and the method for identifying radish leaf margin shape using Indel markers based on the RsLEC14B gene, as described in this invention, are highly accurate, simple to operate, efficient, and resource-saving. The synergistic effect between the various operational steps of the above methods achieves excellent results. Attached Figure Description

[0024] Figure 1 The distribution of the RsLMI and RsRCO gene markers from Example 1 in radish materials with different leaf margin shapes is shown. (A) shows photographs of leaves from radish varieties with different leaf margin shapes, including: fully lobed materials: P1 (Er Nian Zi), P2 (Chun Li Hong Hua), P3 (Yu Bai), P4 (Wu Jin Hong); and whole-margin, non-lobed materials: P5 (301A), P6 (Qi Ye Hong), P7 (Duan Ye 13), P8 (MTH01). (B) shows electrophoresis images of the PCR amplification results of molecular marker RsLMI1-8F / 8R in different radish varieties. (C) shows electrophoresis images of the PCR amplification results of molecular marker RsRCO-2F / 1R in different radish varieties.

[0025] Figure 2 These are photographs of the leaves of the radish varieties “Er Nian Zi”, “Man 01” (MTH01), and F1 generation plants in Example 1.

[0026] Figure 3 This is a schematic diagram of the BSA-seq and BSR-seq analysis results of the whole-edge, un-cracked leaf pool and the shallow-cracked leaf pool in Example 1.

[0027] Figure 4 This is a schematic diagram of the location of the gene regulating the shape of radish leaf margin in Example 1.

[0028] Figure 5The results of overexpression of the RsLEC14B gene in transgenic turnips in Example 2 are shown. Figure A shows leaf phenotypic photographs of wild-type WJ1006 and the transgenic line; Figure B shows electrophoresis diagrams of PCR products from positive transgenic plants.

[0029] Figure 6 This is a schematic diagram showing the sequence alignment of the RsLEC14B gene sequence variation in the whole-margin, unsplit leaf material “MTH01” and the whole-split leaf material “Nianzi” in Example 3.

[0030] Figure 7 This is an electrophoresis diagram showing the amplification results of the RsLEC14B gene molecular marker 5F-5R in 44 materials with different leaf margin shapes in Example 4. Detailed Implementation

[0031] To make the technical solution, objectives, and advantages of the present invention clearer, the present invention will be further described in detail below through specific embodiments. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0032] In a first aspect, the present invention provides the CDS sequence of the RsLEC14B gene related to the shape of radish leaf margin, the sequence composition of which is shown in SEQ ID NO:1 in the sequence listing;

[0033] Alternatively: It has greater than or equal to 95% homology with SEQ ID NO:1 in the sequence listing;

[0034] Or: A nucleotide sequence that encodes a protein having the same function as the protein encoded by the RsLEC14B gene, obtained by substitution, deletion, and / or addition of one or more nucleotides based on SEQ ID NO:1 in the sequence listing.

[0035] The sequence SEQ ID NO:1 above is derived from the radish variety “MTH01”, whose leaf margin shape is an entire phenotype without cleavage.

[0036] Secondly, the present invention provides the full-length DNA sequence of the RsLEC14B gene related to the shape of radish leaf margins, the sequence composition of which is shown in SEQ ID NO:2 in the sequence listing;

[0037] Alternatively: It has greater than or equal to 95% homology with SEQ ID NO:2 in the sequence listing;

[0038] Or: A nucleotide sequence that encodes a protein having the same function as the protein encoded by the RsLEC14B gene, obtained by substitution, deletion, and / or addition of one or more nucleotides based on SEQ ID NO:2 in the sequence listing.

[0039] The sequence SEQ ID NO:2 above is derived from the radish variety “MTH01”, whose leaf margin shape is an entire phenotype without cleavage.

[0040] The present invention also provides the full-length DNA sequence of another RsLEC14B gene related to the shape of radish leaf margins, the sequence composition of which is shown in SEQ ID NO:3 in the sequence listing;

[0041] Alternatively: It has greater than or equal to 95% homology with SEQ ID NO:3 in the sequence listing;

[0042] Alternatively: a nucleotide sequence encoding a protein having the same function as the protein encoded by the RsLEC14B gene, obtained by substitution, deletion, and / or addition of one or more nucleotides based on SEQ ID NO:3 in the sequence listing.

[0043] The sequence of SEQ ID NO:3 above is derived from the radish variety “Er Nian Zi”, whose leaf margin shape is a fully split phenotype.

[0044] Thirdly, the present invention provides PCR amplification primers for amplifying the CDS sequence (SEQ ID NO:1) of the radish leaf margin shape-related RsLEC14B gene provided in the first aspect, the nucleotide sequence composition of which is shown in SEQ ID NO:4 and SEQ ID NO:5 in the sequence listing, including:

[0045] Forward primer: 5'-ATGTTTCCTGGACCAATTGA-3' (SEQ ID NO:4);

[0046] Reverse primer: 5'-TCAGTAGTAGAAATGTCTCC-3' (SEQ ID NO:5).

[0047] Fourthly, this invention provides the application of the RsLEC14B gene, which is related to the shape of radish leaf margins, in regulating the shape of radish leaf margins.

[0048] According to a fourth aspect of the invention, the application includes:

[0049] Overexpression of the RsLEC14B gene reduced the degree of leaf margin cleavage and / or the number of small lateral leaves in radish.

[0050] Alternatively, by inhibiting or silencing the RsLEC14B gene expression, the degree of lobes on the radish leaf margins can be increased and / or the number of small lateral leaves can be increased.

[0051] The degree of cleavage on the radish leaf edge is as follows: the severity increases sequentially from no cleavage, shallow cleavage, deep cleavage, to full cleavage, and vice versa.

[0052] The above-mentioned RsLEC14B gene overexpression operation includes: constructing an overexpression vector of the RsLEC14B gene CDS sequence (the framework vector can be the pCAMBIA2300 vector, or other plant expression vectors), and then transferring the overexpression vector into plants to obtain transgenic plants overexpressing the RsLEC14B gene.

[0053] The above-mentioned RsLEC14B gene silencing operation includes: designing the RsLEC14B gene silencing sequence, constructing the RsLEC14B gene silencing vector, and then transferring the gene silencing vector into plants to obtain transformed plants.

[0054] Fifthly, the present invention provides an Indel marker closely linked to the shape of radish leaf margins, wherein the Indel marker is located within the RsLEC14B gene; wherein:

[0055] The Indel marker is 484 bp in size in radishes with a fully cleaved leaf margin phenotype, and its nucleotide sequence composition is shown in SEQ ID NO:6 of the sequence listing:

[0056] The Indel marker is 437 bp in radish with an entire leaf margin without cleavage, and its nucleotide sequence composition is shown in SEQ ID NO:7 in the sequence listing.

[0057] In a sixth aspect, the present invention provides a primer set for identifying the Indel marker provided in the fifth aspect of the present invention, the nucleotide sequence of which is shown in SEQ ID NO:8 and SEQ ID NO:9 in the sequence listing.

[0058] Forward primer: 5'-TTCTCTGTCCCCTGATCAGC-3' (SEQ ID NO:8);

[0059] Reverse primer: 5'-CCAGCAACAAGTTCTCGTCC-3' (SEQ ID NO:9).

[0060] In a seventh aspect, the present invention provides a kit for identifying / assisting in the identification of radish leaf margin shape, the kit comprising the primer set provided in the sixth aspect of the present invention for identifying the Indel marker described in the fifth aspect of the present invention.

[0061] According to a seventh aspect of the present invention, the kit may further include at least one of PCR amplification buffer, dNTPs, and Taq enzyme.

[0062] Eighthly, the present invention provides a method for identifying / assisting in identifying the shape of radish leaf margins, the method comprising using the primer set for identifying the Indel marker provided in the sixth aspect of the present invention, and / or the kit for identifying / assisting in identifying the shape of radish leaf margins provided in the seventh aspect of the present invention.

[0063] According to an eighth aspect of the present invention, the method includes performing a PCR amplification reaction on the radish genome using the primer set described in the sixth aspect of the present invention, and then detecting and analyzing the PCR amplification products.

[0064] In a preferred embodiment, the operation of detecting and analyzing the PCR amplification products may include, for example, performing electrophoresis (e.g., agarose gel electrophoresis) on the PCR amplification products and then detecting and analyzing the electrophoretic bands; or sequencing the PCR amplification products.

[0065] In a preferred embodiment, the operation of detecting and analyzing the PCR amplification products may include:

[0066] If a target band of 484 bp is amplified but a target band of 437 bp is not amplified, then the leaf margin shape of the radish is a fully lobed phenotype.

[0067] If a target band of 437 bp is amplified but a target band of 484 bp is not amplified, then the leaf margin shape of the radish is an entire, un-cleft phenotype.

[0068] If target bands of 484bp and 437bp are amplified simultaneously, the leaf margin shape of the radish will be either shallowly lobed or deeply lobed.

[0069] In a preferred embodiment, the reaction system (10 μL) for the above-mentioned PCR amplification reaction comprises:

[0070] DNA 50ng, 10×PCR Buffer 1μL, dNTPs 0.8μL, forward and reverse primers at a concentration of 10μmol each 0.2μL, Taq enzyme 1U, add ddH2O to make up to 10μL.

[0071] As a preferred embodiment, the above PCR amplification program includes: 94 °C pre-denaturation for 4 min; 94 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 30 s, for a total of 35 cycles; 72 °C extension for 10 min; and storage at 4 °C.

[0072] Ninthly, the present invention also provides: the application of the Indel marker provided in the fifth aspect of the present invention, and / or the primer set for identifying the Indel marker provided in the sixth aspect of the present invention, and / or the kit for identifying / assisting in identifying the shape of radish leaf margins provided in the seventh aspect of the present invention, and / or the method for identifying / assisting in identifying the shape of radish leaf margins provided in the eighth aspect of the present invention in the identification / assisting in identification of radish leaf margins, and in radish breeding / assisted breeding.

[0073] Unless otherwise specified, all reagents and materials used in the following examples are products that can be obtained from commercial channels; unless otherwise specified, all testing and detection methods used in the following examples are conventional testing and detection methods in the field and can be obtained from textbooks, reference books or academic journals.

[0074] The radish varieties “Er Nian Zi”, “Chun Li Hong Hua”, “Yu Bai”, “Wu Jin Hong”, “301A”, “Qi Ye Hong”, “Duan Ye 13”, and “MTH01” used in the following embodiments are currently preserved in the Germplasm Resource Bank of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences (Tel: 010-81127153). For the purpose of implementing the technical solution of this invention, anyone may contact our organization to obtain the above-mentioned plant varieties within the patent term from the date of application of this invention.

[0075] For ease of description, the eight radish varieties mentioned above will be referred to as P1, P2, P3, P4, P5, P6, P7, and P8 respectively. Among them, P1, P2, P3, and P4 (corresponding to "Er Nian Zi", "Chun Li Hong Hua", "Yu Bai", and "Wu Jin Hong" respectively) are all fully cracked materials; P5, P6, P7, and P8 (corresponding to "301A", "Qi Ye Hong", "Duan Ye 13", and "MTH01" respectively) are all whole-edged materials without cracks.

[0076] Example 1

[0077] This embodiment describes the process of locating and cloning the RsLEC14B gene, which is related to the shape of radish leaf margins, and the process of obtaining the Indel marker based on the RsLEC14B gene.

[0078] In this embodiment, the key gene RsLEC14B, which controls the shape of radish leaf margins, was obtained by map-based cloning using different whole-margin, non-cracked and fully cracked materials. This gene can change the shape of radish leaf margins in the presence of RsLMI1 / RsRCO.

[0079] 1. Multiple genes are involved in regulating the leaf margin shape of radish.

[0080] Previous studies have confirmed that RsLMI1 and RsRCO are key genes regulating radish leaf morphology. The inventors' research group developed molecular markers for these two genes based on their gene sequences: RsLMI1-8F / 8R (upstream primer: GTAGGCATCATTCCAAAGACCT; downstream primer: TGAAGCTAATTGTCCACTCGTT) and RsRCO-2F / 1R (upstream primer: CCAAAATTGTACCATTCCGAAGT‎; downstream primer: GTACAGTAAGACCTTTTCCGCTA). These molecular markers were used to amplify radish materials with different leaf margin shapes. Figure 1 A). The results showed that the marker RsLMI1-8F / 8R amplified a 2545bp fragment in the fully cleaved materials (P1, P2, P3, P4), while a 1438bp fragment was amplified in the intact, uncleaved materials (P5, P6, P7). However, a 2545bp fragment was amplified in the intact, uncleaved leaf material P8. Figure 1 B). Similarly, the marker RsRCO-2F / 1R amplified a 222 bp fragment in the fully etched materials (P1, P2, P3, P4), and a 239 bp fragment in the intact materials (P5, P6, P7), but only a 222 bp fragment was amplified in the intact material P8. Figure 1 C). Therefore, it is inferred that multiple genes are involved in regulating the leaf margin shape of radish. In the whole, un-cracked material P8, the genotypes of RsLMI1 and RsRCO are consistent with those in the whole-cracked material, indicating that there may be other genes regulating leaf margin shape.

[0081] 2. The RsLEC14B gene is a key gene regulating the shape of radish leaf margins.

[0082] 2.1 To locate and clone the regulatory gene for radish leaf margin shape in the "MTH01" material, the inventors' research group constructed the BC1 genetic population using "two-year-old seed" (fully lobed material) and "MTH01" (completely lobed material), such as... Figure 2 The results showed that F1 exhibited shallowly lobed leaf margins. As shown in Table 1, in the BC1 population, there were 125 plants with shallowly lobed leaf margins and 105 plants with entire leaf margins, consistent with a 1:1 inheritance ratio (χ²). 2 =1.74, P=0.187). This is because the genes RsLMI1 and RsRCO (which control full-scale etching) are present in “MTH01”. Figure 1 This indicates that the leaf margin shape of “MTH01” is controlled by a dominant epistatic gene that counteracts the effects of RsLMI1 and RsRCO.

[0083] Table 1: Statistical table of leaf margin shape of the "Two-Year-Old Seed" × "MTH01" population

[0084]

[0085] 2.2. In the BC1 population of “MTH01” × “two-year-old”, 50 whole-leaf un-cleaved and 50 shallow-cleaved single plants were selected respectively. DNA pools of whole-leaf un-cleaved and shallow-cleaved plants were constructed by mixing equal amounts of DNA from each plant. Genome resequencing yielded 54.3 Gb and 56.7 Gb reads respectively. BSA-Seq analysis was performed using the “XYB36-2” reference genome. By calculating the ΔSNP-Index value, the major QTL controlling radish leaf margin shape was located in the interval 11.89–13.56 Mb (p < 0.01) on chromosome 9 (e.g., ...). Figure 3 (As shown in A). Simultaneously, whole-margin, non-fretted RNA pools and shallow-fretted RNA pools were constructed by mixing equal amounts of RNA from single plants. Transcriptome sequencing yielded 18.23 Gb and 19.27 Gb reads, respectively. BSR-seq analysis was performed using the "XYB36-2" reference genome. By calculating the ΔSNP-Index value, the major QTL controlling radish leaf margin shape was located in the 10.07–14.84 Mb interval on chromosome 9 (p < 0.01). Figure 3 As shown in B).

[0086] 2.3 To finely locate the radish leaf margin shape gene, this invention developed 19 Indel markers within the mapping interval. Using BC1F2, the radish leaf margin shape gene was mapped to an 89KB interval between Indel 68 and Indel 72 (13.46~13.55MB). Figure 4 As shown in Table 2, the gene contains 15 genes. Transcriptome data analysis revealed that only Rsa10009535 showed differential expression in both the whole-leaf no-crease RNA pool and the shallow-crease RNA pool within the localization region. The TPM values ​​for this gene in the whole-leaf no-crease RNA pool and the shallow-crease RNA pool were 6.64 and 1.95, respectively (Table 2). Gene functional annotation indicated that this gene is LEC14B, a WD40 protein, which can bind to DDB1 in the DDB1-CUL4A-RBX1 E3 ubiquitin ligase complex and is responsible for recognizing substrate proteins. Therefore, this invention considers the RsLEC14B gene as a key candidate gene for regulating leaf margin creases in radish.

[0087] Table 2: Expression levels and functional annotations of candidate genes within the localization region in whole-rim, unfurled RNA pools and shallow-furled RNA pools.

[0088]

[0089] Example 2

[0090] This embodiment describes the application of the RsLEC14B gene, which is used to improve the leaf margin shape of radish by overexpressing the RsLEC14B gene.

[0091] 1. Construction of transgenic overexpression vectors and transgenic processes

[0092] (1) Total RNA was extracted from the young leaves of MTH01 and reverse transcribed into cDNA (SEQ ID NO: 1).

[0093] (2) Homologous recombination primers were used. The upstream primer sequence was 5'-tttggagagaacacgggtaccATGTTTCCTGGACCAATTGA-3', and the downstream primer sequence was 5'-catgtcgactctagaggatccGTAGTAGAAATGTCTCCTTC-3'. PCR amplification was performed using the above cDNA as a template to obtain an amplification product with KpnI and BamHI restriction sites. This amplification product was inserted between the KpnI and BamHI restriction sites of the binary vector pCAMBIA2300 to construct an overexpression vector. This overexpression vector was driven by the CaMV 35S promoter and had a GFP tag fused to its 3' end.

[0094] (3) The above overexpression vector was introduced into Agrobacterium tumefaciens strain GV3101 and then used for genetic transformation of the turnip inbred line WJ006. The genetic transformation experiment was carried out according to the method described by Xin et al. (Xin, X., Li, P., Zhao, X. et al. Temperature-dependent jumonji demethylase modulates flowering time by targeting H3K36me2 / 3 in Brassica rapa. Nat Commun 15, 5470 (2024)), and positive transgenic plants were screened by genomic PCR.

[0095] 2. The transgenic lines significantly reduced the degree of leaf margin cleavage in radish.

[0096] like Figure 5 As shown, in the T1 generation WJ006 transgenic line, the presence of the transgene was confirmed by genomic PCR using a forward primer for the CaMV 35S promoter region and a reverse primer for the RsLEC14B coding region (e.g., Figure 5As shown in Figure B, lane 1 from left to right is the marker, lanes 2 to 6 are wild-type WJ006, and the others are transgenic lines. Lanes 3, 5, 7, 8, 10-15, and 17-19 are transgenic positive lines. Phenotypic identification of the transgenic lines showed that, compared with wild-type WJ1006, overexpression of RsLEC14B resulted in reduced leaf margin lobes and a significant decrease in the number of small lateral leaves. Lateral buds also appeared at the stem plate position in RsLEC14B-OE-7 and RsLEC14B-OE-15 (e.g., ...). Figure 5 A (as shown in Table 3). The above results indicate that leaf margin shape can be improved by transgenic overexpression of the RsLEC14B gene.

[0097] Table 3: Statistics of small lateral leaves in wild-type and RsLEC14B overexpressing plants

[0098]

[0099] Example 3

[0100] This embodiment describes the acquisition of Indel markers based on the RsLEC14B gene.

[0101] (1) Take young leaves of the fully cleaved material “Two Years” and the whole-margin uncleaved material “MTH01” and extract DNA using the CTAB method.

[0102] (2) Using primers 5'-ATGTTTCCTGGACCAATTGA-3' and 5'-TCAGTAGTAGAAATGTCTCC-3', PCR reactions were performed to amplify the RsLEC14B gene fragments of whole-edge un-cracked material and whole-cracked material (SEQ ID NO:2 and SEQ ID NO:3, respectively).

[0103] (3) such as Figure 6 As shown, gene sequencing was performed on the RsLEC14B gene fragments of both fully cleaved and uncleaved materials. Sequence alignment revealed numerous SNPs and InDel variations between the two. This invention selected the longer InDel variation and developed the molecular marker primer 5F-5R (… Figure 6 The primer sequences for this molecular marker are as follows:

[0104] 5F: 5'-TTCTCTGTCCCCTGATCAGC-3' (SEQ ID NO: 8);

[0105] 5R: ‎‎5'-CCAGCAACAAGTTCTCGTCC-3' (SEQ ID NO: 9) ‎.

[0106] The primers for this molecular marker amplified fragments of 484bp (SEQ ID NO:6) and 437bp (SEQ ID NO:7) in the fully cleaved material "Er Nian Zi" and the whole-margin uncleaved material "MTH01", respectively, which can be used as an Indel marker to identify the shape of radish leaf margins.

[0107] Example 4

[0108] This embodiment describes a method for identifying / assisting in the identification of radish leaf margin shape using Indel markers. Using the 5F-5R primer pair of the RsLEC14B gene molecular marker, 44 radish plants (a BC1F2 population of “two-year-old seed” × “MTH01”, i.e., the self-crossed offspring of BC1 in Table 1) were identified by marker typing.

[0109] S1: Genomic DNA was extracted from each radish plant using the CTAB method.

[0110] S2: Using the 5F-5R primer set, PCR amplification reactions were performed using each radish genome as a template to obtain the PCR amplification products of each individual plant.

[0111] The above PCR reaction system includes:

[0112] DNA 50ng, 10×PCR Buffer 1μL, dNTPs 0.8μL, forward and reverse primers at a concentration of 10μmol each 0.2μL, Taq enzyme 1U, add ddH2O to make up to 10μL.

[0113] The above PCR reaction procedure includes:

[0114] Pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, for a total of 35 cycles; extension at 72℃ for 10 min; storage at 4℃.

[0115] S3: Perform 2% agarose gel electrophoresis on each of the above PCR amplification products.

[0116] S4: Electrophoretic bands were detected, and the leaf margin shape of the radish was identified by detecting the fragment length of the PCR product. Results are as follows: Figure 7 As shown, the fragments amplified by individual plants 6, 7, 18, 22, 24, 25, 27, 28, 29, 31, 32, 34, 38, 40, and 43 were 484 bp in size and were identified as having a complete crease phenotype. The fragments amplified by individual plants 1-5, 8-17, 19-21, 23, 26, 30, 33, 35-37, 39, 41, 42, and 44 were 437 bp in size and were identified as having a whole margin without crease phenotype.

[0117] Comparison with field survey results revealed that the above results were completely consistent with the phenotypic observation results, indicating that the identification method provided by this invention has a 100% accuracy rate. It is evident that the Indel marker based on the RsLEC14B gene can accurately identify the leaf margin shape of radishes.

[0118] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of the RsLEC14B gene, which is related to radish leaf margin shape, in regulating radish leaf margin shape, characterized by, The application is as follows: Overexpression of the RsLEC14B gene reduced the degree of leaf margin cleavage and / or the number of small lateral leaves in radish. RsLEC14B gene overexpression is achieved by transferring an overexpression vector containing the CDS sequence of the RsLEC14B gene shown in SEQ ID NO:1 in the sequence listing into radish plants, thereby overexpressing the RsLEC14B gene.

2. An Indel mark closely linked to the shape of the radish leaf margin, characterized by: The Indel marker is 484 bp in size in radishes with a fully lobed leaf margin phenotype, and its nucleotide sequence composition is shown in SEQ ID NO:6 in the sequence listing; or The Indel marker is 437 bp in radish with an entire leaf margin without cleavage, and its nucleotide sequence composition is shown in SEQ ID NO:7 in the sequence listing.

3. A method for identifying / assisting in the identification of radish leaf margin shape, the method comprising using the primer set shown in SEQ ID NO:8 and SEQ ID NO:9 in the sequence listing to perform a PCR amplification reaction on the radish genome, and then detecting and analyzing the PCR amplification products: If a target band of 484 bp is amplified but a target band of 437 bp is not amplified, then the leaf margin shape of the radish is a fully lobed phenotype. If a target band of 437 bp is amplified but a target band of 484 bp is not amplified, then the leaf margin shape of the radish is an entire, un-cleft phenotype. If target bands of 484bp and 437bp are amplified simultaneously, the leaf margin shape of the radish will be either shallowly lobed or deeply lobed.

4. The application of the primer set for identifying the Indel markers closely linked to the shape of radish leaf margins as described in claim 2 in the identification / auxiliary identification of radish leaf margin shape; in, The nucleotide sequence composition of the primer set is shown in SEQ ID NO:8 and SEQ ID NO:9 in the sequence listing: Forward primer: 5'-TTCTCTGTCCCCTGATCAGC-3' (SEQ ID NO:8); Reverse primer: 5'-CCAGCAACAAGTTCTCGTCC-3' (SEQ ID NO:9).

5. The application of the kit for identifying the Indel markers closely linked to the shape of radish leaf margins as described in claim 2 in the identification / auxiliary identification of radish leaf margin shape; in, The kit includes at least one of PCR amplification buffer, dNTPs, and Taq enzyme, as well as a primer set with nucleotide sequences as shown in SEQ ID NO:8 and SEQ ID NO:9 in the sequence listing: Forward primer: 5'-TTCTCTGTCCCCTGATCAGC-3' (SEQ ID NO:8); Reverse primer: 5'-CCAGCAACAAGTTCTCGTCC-3' (SEQ ID NO:9).

6. The application of the method for identifying / assisting in identifying the shape of radish leaf margins as described in claim 3 in the identification / assisting in the identification of radish leaf margin shapes.

Images