A dna methylation molecular marker related to cucumber regeneration ability and application thereof

By using DNA methylation molecular markers at positions 612-883 of the CsWIND1 gene and their primer pairs, the challenges of differences in shoot tissue regeneration capacity and screening in cucumber breeding were solved, achieving efficient screening and precision breeding, and improving the efficiency of transgenic cucumber breeding.

CN121575147BActive Publication Date: 2026-07-31YANGZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2026-01-09
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Cucumber breeding suffers from significant differences in bud tissue regeneration capacity, cumber-intensive traditional screening methods that rely on experience, and a lack of precise molecular markers, resulting in low efficiency in transgenic breeding.

Method used

A DNA methylation molecular marker located at positions 612-883 of the CsWIND1 gene nucleotide sequence and its primer pair are provided. The methylation level of the CsWIND1 gene can be detected by PCR amplification and methylation analysis to predict the bud tissue regeneration capacity.

Benefits of technology

This technology enables efficient screening of cucumber germplasm with high regeneration capacity, improves the efficiency of transgenic breeding, provides precise molecular marker-assisted breeding methods, and shortens the breeding cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121575147B_ABST
    Figure CN121575147B_ABST
Patent Text Reader

Abstract

This invention discloses a DNA methylation molecular marker related to cucumber regeneration ability and its application. The DNA methylation molecular marker related to cucumber regeneration ability is located at positions 612-883 of the CsWIND1 gene nucleotide sequence, as shown in SEQ ID NO.1, and the molecular marker's nucleotide sequence is shown in SEQ ID NO.2. This invention identifies a DNA methylation molecular marker located within the nucleotide range of positions 612-883 in the CsWIND1 gene promoter region. Based on this molecular marker, the methylation level of the CsWIND1 gene can be analyzed. The methylation level of this molecular marker is significantly negatively correlated with shoot tissue regeneration ability; the lower the methylation level, the stronger the shoot regeneration ability of the plant; conversely, the higher the methylation level, the weaker the shoot regeneration ability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, specifically to a DNA methylation molecular marker related to cucumber regeneration ability and its application. Background Technology

[0002] Cucumber (Cucumis sativus L.) is a common annual climbing herbaceous plant belonging to the Cucurbitaceae family and the Cucurbita genus. It typically has a slender, cylindrical shape and crisp, sweet flesh. As an important vegetable crop widely cultivated globally, genetic improvement and germplasm innovation of cucumbers are core requirements for ensuring the high-quality development of the industry. Transgenic technology is a key means of targeted improvement of cucumber traits such as disease resistance, stress resistance, and quality. The ability of bud tissue to regenerate is a core prerequisite for successful transgenic operations—cucumber germplasm with strong regeneration ability can significantly improve transformation efficiency and shorten the breeding cycle; conversely, poor regeneration will hinder the progress of transgenic operations.

[0003] However, cucumber breeding currently faces two major problems: First, the regeneration capacity of bud tissue varies significantly among different cucumber varieties, and traditional screening relies on tissue culture inoculation experiments, which has drawbacks such as long cycle, cumbersome operation, and great interference from environmental factors, which seriously restricts the screening efficiency of high regeneration capacity germplasm; Second, although some molecular mechanisms regulating cucumber bud tissue regeneration capacity have been identified, there is still a lack of precise molecular markers that can be directly used to assist breeding, resulting in the breeding process relying heavily on empirical selection, making it difficult to achieve targeted and efficient breeding.

[0004] In eukaryotes, a methyl group can be introduced onto the 5th carbon atom of the cytosine base of a nucleotide under the catalysis of DNA methyltransferase; this phenomenon is called DNA methylation. DNA methylation, as a core epigenetic regulatory mechanism, participates in multiple processes such as plant growth, development, and stress response by influencing gene expression. Previous studies have shown that the WIND1 gene family is a key regulatory gene family for callus formation and shoot regeneration in plants, and its expression level is closely related to plant regeneration capacity. Furthermore, gene-associated differentially methylated regions (DMRs) can influence biological traits by regulating target gene expression. Therefore, identifying DNA methylation molecular markers associated with the cucumber CsWIND1 gene and establishing a rapid method for identifying regeneration capacity based on these markers is of significant theoretical and practical importance for solving the problem of screening high-regeneration germplasm in cucumber transgenic breeding and improving breeding efficiency. Summary of the Invention

[0005] One of the objectives of this invention is to provide a DNA methylation molecular marker related to cucumber regeneration capacity and its application, which provides a new technical means for material screening for efficient breeding of transgenic cucumbers, deepens the understanding of the mechanism by which DNA methylation regulates the strength of cucumber tissue regeneration capacity, and has important practical significance for improving cucumber bud tissue regeneration efficiency and assisting in the upgrading of transgenic breeding technology.

[0006] In a first aspect, the present invention provides a DNA methylation molecular marker related to cucumber regeneration capacity, which is located at positions 612-883 of the nucleotide sequence of the CsWIND1 gene, the nucleotide sequence of the CsWIND1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.2.

[0007] Secondly, the present invention provides a primer pair for amplifying the aforementioned molecular marker, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4.

[0008] Thirdly, the present invention provides the application of the above-mentioned molecular markers in detecting the regeneration ability of cucumber bud tissue or in selecting cucumber varieties with strong bud tissue regeneration ability.

[0009] Furthermore, the degree of methylation of molecular markers is negatively correlated with the regenerative capacity of bud tissue.

[0010] Furthermore, when the methylation level is <35%, it is considered low methylation, and the bud tissue regeneration ability is relatively strong; when the methylation level is ≥35%, it is considered high methylation, and the bud tissue regeneration ability is relatively weak.

[0011] Fourthly, the present invention provides a method for detecting the regeneration capacity of cucumber shoot tissue, using the aforementioned molecular markers or primer pairs for detection.

[0012] Furthermore, the detection method includes: extracting genomic DNA from the cucumber callus tissue to be tested; treating it with bisulfite and purifying and recovering it; using the purified and recovered DNA as a template, performing PCR amplification using primer pairs shown in SEQ ID NO.3 and SEQ ID NO.4; and sequencing and analyzing the methylation level data of the PCR amplification products.

[0013] Fifthly, the present invention provides a method for breeding cucumber varieties with strong bud tissue regeneration ability, by using the above-mentioned molecular markers or primer pairs for detection, and screening out plants with low methylation levels of the CsWIND1 gene.

[0014] The beneficial effects of this invention are as follows: 1. This invention identifies a DNA methylation molecular marker located within nucleotides 612–883 of the CsWIND1 gene promoter region. Based on this molecular marker, the methylation level of the CsWIND1 gene can be analyzed. The methylation level of this molecular marker is significantly negatively correlated with shoot regeneration capacity; the lower the methylation level, the stronger the shoot regeneration capacity of the plant; conversely, the higher the methylation level, the weaker the shoot regeneration capacity.

[0015] 2. The molecular markers of this invention can be used to screen cucumber materials for efficient cultivation of transgenic cucumbers, and can improve the breeding rate of superior varieties with strong bud tissue regeneration ability.

[0016] 3. The molecular markers and their amplification primers of this invention not only provide a theoretical basis and genetic support for distinguishing the bud tissue regeneration ability of different cucumber varieties, but can also be directly applied to the breeding of cucumber germplasm with high bud tissue regeneration ability. They can efficiently screen out cucumber materials suitable for transgenic operations and provide technical assistance for the cultivation of transgenic cucumbers. Attached Figure Description

[0017] Figure 1 This is a map showing the DNA methylation distribution of the CsWIND1 gene in cucumber germplasm XTMC on days 0, 2, and 6 of shoot regeneration induction.

[0018] Figure 2 The expression level of the CsWIND1 gene at different regeneration stages.

[0019] Figure 3 Phenotypic diagrams of explants from cucumber varieties with different bud regeneration abilities.

[0020] Figure 4 This is a statistical chart showing the number of buds regenerated after 28 days of cultivation for cucumber varieties with different bud regeneration abilities.

[0021] Figure 5 The methylation level of the CsWIND1-DMR region in cucumber varieties with different bud regeneration abilities on day 6 of culture. Detailed Implementation

[0022] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the experimental methods in the embodiments are conventional methods, performed in accordance with the techniques or conditions described in the literature in the field or in accordance with the product instructions.

[0023] A DNA methylation molecular marker associated with cucumber regeneration ability is located at positions 612-883 of the nucleotide sequence of the CsWIND1 (CsaV4_2G002361) gene, the nucleotide sequence of the CsWIND1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.2.

[0024] A primer pair for amplifying the aforementioned molecular marker, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3: ATTTTTTGTTATTTGTTAGTTTTTTTT, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4: AACTTTTATAACTTTTAACTCTCATAAATA.

[0025] The background materials for this invention are cucumber varieties: XTMC, YZ241, YZU014A, YZU095A, YZU106A, YZU107A, and YZU112A. An article entitled "A genome-wide association study reveals molecular mechanism underlying powdery mildew resistance in cucumber" was published in Genome Biology in 2024. The above germplasm resources are preserved in the applicant's laboratory germplasm bank.

[0026] Example 1: DNA methylation and gene expression analysis during bud regeneration Studies have shown that the acquisition of callus pluripotency in the early stage of cucumber cotyledon node bud regeneration is highly correlated with regeneration. In this embodiment, cucumber germplasm XTMC was used as the experimental material. Samples were collected on day 0, day 2 and day 6 of bud regeneration induction, and the DNA methylation level was systematically analyzed using whole-genome bisulfite sequencing technology. The bisulfite conversion reaction system was as follows: DNA 10-20 μl (1 ng-2 μg), CT Conversion Reagent 130 μl, and ddH2O added to a total volume of 150 μl. The PCR amplification system was as follows: bisulfite-modified genomic DNA 3 μl, 2×EpiArt HS TaqMasterMix 25 μl, forward and reverse primers 2 μl each, and ddH2O 3 μl. The amplification program was as follows: (1) 95℃ for 3 min; (2) 95℃ for 30 sec, 50℃ for 30 sec, 72℃ for 30 sec, 45 cycles; (3) 72℃ for 5 min.

[0027] The results showed that the DNA methylation level in the promoter region of the CsWIND1 gene decreased significantly with culture time. Figure 1 ), and the expression level of this gene showed a corresponding upward trend ( Figure 2 The two showed a clear negative correlation. Based on the aforementioned dynamic methylation regions, methylation-specific PCR primers were designed using the MethPrimer online tool (https: / / methprimer.com / ) for subsequent validation and molecular marker development.

[0028] The nucleotide sequence of the upstream primer is: ATTTTTTGTTATTTGTTAGTTTTTTTT (SEQ ID NO.3). The nucleotide sequence of the downstream primer is: AACTTTTATAACTTTTAACTCTCATAAATA (SEQ ID NO.4).

[0029] Example 2: Identification of cucumber varieties with different bud regeneration abilities To evaluate the shoot regeneration ability of cucumber germplasm resources, this embodiment randomly selected six materials from the germplasm bank preserved in the laboratory and conducted shoot regeneration experiments together with XTMC. All materials were induced to regenerate shoots under the same culture conditions, and the morphology of the explants was observed after 28 days of culture. Figure 3 ), and count the number of regenerated buds ( Figure 4 Using the XTMC variety, known for its strong regeneration ability, as a reference standard, materials with an average number of regenerated buds higher than XTMC were classified as strong regeneration varieties, while those with an average number lower than XTMC were classified as weak regeneration varieties.

[0030] The results showed that among the 7 materials tested, YZU014A had a significantly higher number of regenerated buds than XTMC and was identified as a strong regeneration variety; the other 6 materials had a lower number of regenerated buds than XTMC and were classified as weak regeneration varieties.

[0031] Example 3: Method for detecting the regeneration capacity of cucumber shoot tissue Step S1: Extract genomic DNA from the cucumber to be tested.

[0032] Using the seven cucumber varieties mentioned above, callus tissue was collected after culturing in the same environment for 6 days. Genomic DNA was extracted from the leaves using a rapid plant genomic DNA extraction system (Tiangen), and the experimental procedures were performed according to the kit instructions. The specific steps are as follows: (1) Take 100mg of cucumber callus tissue and grind it thoroughly with liquid nitrogen. Add 400μl of buffer FP1 and 6μl of RNase A (10mg / ml), vortex for 1min, and let stand at room temperature for 10min.

[0033] (2) Add 130 μl of buffer FP2, mix thoroughly, and vortex for 1 min.

[0034] (3) Centrifuge at 12,000 rpm for 5 min and transfer the supernatant to a new centrifuge tube.

[0035] (4) Centrifuge the supernatant again at 12,000 rpm for 5 min, and transfer the supernatant to a new centrifuge tube.

[0036] (5) Add 0.7 times the volume of isopropanol to the supernatant and mix thoroughly. At this time, flocculent genomic DNA will appear. Centrifuge at 12,000 rpm for 2 min, discard the supernatant and keep the precipitate.

[0037] (6) Add 600 μl of 70% ethanol, vortex for 5 seconds, centrifuge at 12,000 rpm for 2 minutes, and discard the supernatant.

[0038] (7) Repeat step (6).

[0039] (8) Open the lid and invert it, leave it at room temperature for 5-10 minutes to completely dry the residual ethanol.

[0040] (9) Add an appropriate amount of elution buffer TE, incubate at 65℃ for 10-60 min to dissolve the DNA, inverting and mixing several times during the process to aid dissolution, finally obtaining a DNA solution. Determine the concentration and purity of the extracted DNA. Store at 20°C.

[0041] Step S2: Purify DNA after conversion with bisulfite.

[0042] The extracted DNA was treated with bisulfite using the EpiArt Ultrafast DNA Methylation Bisulfite Kit (Novazia, catalog number EM112-01), following the kit's instructions. The specific steps are as follows: (1) Add 10-20 μl of DNA (1 ng-2 μg) and 130 μl of CT Conversion Reagent to a sterile PCR tube, and add ddH2O to make the total volume 150 μl.

[0043] (2) After mixing by vortexing or blowing, briefly centrifuge and collect the reaction solution to the bottom of the tube.

[0044] (3) Place the PCR tube in the PCR instrument and the amplification program is shown in Table 1.

[0045] Table 1 DNA transformation reaction procedure

[0046] (4) Place the EpiArt DNA Columns adsorption column into a 2ml Collection Tube.

[0047] (5) Add 600 μl of E-Binding Buffer to the adsorption column to transfer the converted reaction product into the adsorption column. Gently invert the column 6-10 times to mix the reaction product with the E-Binding Buffer completely.

[0048] (6) Centrifuge at 12,000 rpm for 2 min. Discard the filtrate and return the adsorption column to the collection tube.

[0049] (7) Add 100 μl of E-Wash Buffer (with added ethanol) along the tube wall to the adsorption column, and centrifuge at 12,000 rpm for 1 min. Discard the filtrate and put the adsorption column back into the collection tube.

[0050] (8) Add 200 μl of E-Desulphonation Buffer along the tube wall to the adsorption column and allow it to stand at room temperature (15-25℃) for 15 min. Centrifuge at 12,000 rpm for 1 min. Discard the filtrate and return the adsorption column to the collection tube.

[0051] (9) Add 200 μl of E-Wash Buffer (with added ethanol) along the tube wall to the adsorption column, and centrifuge at 12,000 rpm for 1 min. Discard the filtrate and put the adsorption column back into the collection tube.

[0052] (10) Repeat step (9).

[0053] (11) Centrifuge the empty column at 12,000 rpm for 2 min.

[0054] (12) Transfer the adsorption column to a new 1.5 ml Nuclease-free centrifuge tube (self-provided), and add 10-15 μl of E-Elution Buffer to the center of the adsorption column membrane. Let stand at room temperature for 1-2 min, then centrifuge at 12,000 rpm for 2 min.

[0055] (13) Collect the DNA filtrate and discard the adsorption column. Store the DNA product at -20℃. For long-term storage, it should be placed at -80℃ to prevent degradation.

[0056] Step S3: PCR amplification.

[0057] (1) Design primers. Primer information is shown in Table 2.

[0058] Table 2. Methylation amplification primer information

[0059] (2) Add 3 μl of bisulfite-modified genomic DNA, 25 μl of 2×EpiArt HS Taq Master Mix, 2 μl each of forward and reverse primers, and 18 μl of ddH2O to a Nuclease-free PCR tube.

[0060] (3) Invert the tube and blow it to mix it. After a short centrifugation, collect the reaction liquid to the bottom of the tube.

[0061] (4) Place the PCR tube in the PCR instrument and the amplification program is shown in Table 3.

[0062] Table 3 PCR amplification program

[0063] (5) After obtaining the PCR product, perform gel electrophoresis, cut the target fragment, and recover the target fragment using a common agarose gel DNA recovery kit (Tiangen) according to its steps to obtain the molecular marker product.

[0064] (6) Ligate the recovered target fragment with the 5×TA / Blunt-Zero Cloning Mix vector to prepare the reaction system: 1 μl of 5×TA / Blunt-Zero Cloning Mix and 4 μl of PCR purified product. Gently tap the bottom of the tube to mix, then centrifuge briefly at low speed to collect all liquid at the bottom of the centrifuge tube. Incubate at room temperature (20-37℃) for 5 min. After the reaction is complete, place the centrifuge tube on ice.

[0065] (7) Remove DH5α competent cells from -80℃, quickly place them on ice to thaw, add the ligation product, and gently mix by tapping the bottom of the EP tube. Let stand on ice for 30 min. After heat shock in a 42℃ water bath for 45 sec, quickly return them to ice and let stand for 2 min. Add 700 μl of antibiotic-free LB liquid medium to the centrifuge tube, mix well, and incubate at 37℃ and 200 rpm for 1 h. Centrifuge at 5,000 rpm for 1 min to collect the bacteria. Collect about 100 μl of supernatant, gently pipette to resuspend the bacterial block, and spread it evenly on an LB solid medium plate containing Kna penicillin antibiotic. Invert the plate and incubate overnight at 37℃ for 12 h.

[0066] (8) Pick 20 single clones and add them to 10 μL ddH2O. Mix them thoroughly by pipetting and use them as template bacterial solutions. The systems shown in Tables 4 and 5 are used to identify single clones.

[0067] Table 4. Preparation of solutions for identifying positive clones

[0068] Table 5. PCR reaction procedure for identifying positive clones

[0069] (9) After confirming the positive clone by gel electrophoresis of the PCR product, add the remaining 8 μL of bacterial culture to 1 mL of LB liquid medium containing antibiotics and shake the culture on a shaker at 37°C and 200 rpm for 16 h. Then, use M13F or M13R as primers to perform first-generation sequencing.

[0070] Step S4: Sequencing and analyzing the methylation level of the CsWIND1-DMR region.

[0071] The sequences obtained from sequencing were aligned using SnapGene software. The correctly aligned results were then statistically analyzed using the Kismeth online tool (https: / / katahdin.girihlet.com / kismeth / revpage.pl) to perform DNA methylation data analysis. The results were then plotted using GraphPad Prism software. Figure 4 and Figure 5 Analysis showed that among cucumber varieties with different shoot regeneration abilities, the methylation level of the DNA methylation molecular marker CsWIND1-DMR in the promoter region of the CsWIND1 gene was significantly negatively correlated with their shoot regeneration ability: the lower the methylation level, the stronger the regeneration ability; and vice versa. Therefore, based on the method established in this invention, the shoot tissue regeneration ability can be effectively predicted by detecting the DNA methylation level of CsWIND1-DMR in different cucumber germplasms.

[0072] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A pair of primers, characterized in that, It is used to amplify DNA methylation molecular markers related to cucumber regeneration ability. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

4.

2. Application of DNA methylation molecular markers in detection of cucumber bud tissue regeneration ability or in breeding of cucumber varieties with strong bud tissue regeneration ability, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

2. When the methylation level is <35%, it is considered hypomethylation, and the bud tissue regeneration ability is strong; when the methylation level is ≥35%, it is considered hypermethylation, and the bud tissue regeneration ability is weak.

3. Use according to claim 2, characterized in that, The degree of methylation of molecular markers is negatively correlated with the regenerative capacity of bud tissue.

4. A method for detecting the regenerative capacity of cucumber bud tissues, characterized by, Detection can be performed using the molecular markers of claim 2 or the primer pairs of claim 1. When the methylation level is <35%, it is considered hypomethylation, and the bud tissue regeneration ability is relatively strong; when the methylation level is ≥35%, it is considered hypermethylation, and the bud tissue regeneration ability is relatively weak.

5. The detection method according to claim 4, characterized in that, include: Genomic DNA was extracted from cucumber callus tissue. The DNA was treated with bisulfite and purified; using the purified DNA as a template, PCR amplification was performed using primer pairs shown in SEQ ID NO. 3 and SEQ ID NO. 4; the PCR amplification products were sequenced and methylation level data were analyzed.

6. A method for breeding a cucumber variety having a high ability of shoot organogenesis, characterized by, Using the molecular markers of claim 2 or the primer pairs of claim 1, plants with low methylation levels of the CsWIND1 gene can be screened. When the methylation level is <35%, it is considered hypomethylation, and the bud tissue regeneration ability is relatively strong; when the methylation level is ≥35%, it is considered hypermethylation, and the bud tissue regeneration ability is relatively weak.