Gene osmcs1 for regulating meiosis of rice, and coding protein and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a gene for regulating meiosis of rice OsMCS1 and an encoded protein and application thereof. OsMCS1 The nucleotide sequence is shown as SEQ ID NO. 1. By knocking out the gene in rice OsMCS1 It can be learned that the chromosome separation of the rice after gene knockout is abnormal, and the blastocyst appears partial abortion. Compared with the wild type, the chromosome recombination frequency of the knockout line is increased by 1.5-2.0 times, the genetic recombination frequency is increased, thereby the breeding efficiency is improved, and a new means for improving the genetic breeding efficiency of rice is provided.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a gene that regulates meiosis in rice. OsMCS1 Its encoded proteins and applications. Background Technology

[0002] Meiosis is the core process of sexual reproduction in plants. Crossing over (CO) between homologous chromosomes facilitates the exchange of genetic material through homologous recombination, producing gametes with genetic diversity. This is a crucial foundation for creating new allele combinations in crop breeding (Keeney, 2001; Zamariola et al., 2014). However, due to the high conservation of genes regulating homologous recombination, the recombination rate during meiosis in plants under natural conditions is maintained at a relatively low level. This inherent limitation significantly restricts the improvement of crop breeding efficiency (Li et al., 2019). Therefore, identifying key genes involved in the regulation of meiotic recombination and utilizing modern biotechnology to break the natural constraints on recombination rates and promote crossing over and the exchange of genetic material has become an important approach to improving crop breeding efficiency and accelerating the development of superior varieties.

[0003] In recent years, researchers have cloned several genes regulating meiotic recombination in Arabidopsis thaliana and rice, providing important clues for elucidating the molecular mechanisms of meiosis (Luo et al., 2014; Wang and Copenhaver, 2018). However, the correct pairing, recombination, and segregation of chromosomes, as core links in meiosis and sexual reproduction (Zickler and Kleckner, 1999), still have many unknowns regarding the regulatory network of crossing over. Especially for rice, a globally important food crop, discovering new genes involved in meiotic crossing over is not only of significant biological importance but also lays a crucial scientific foundation for improving the efficiency of rice genetic breeding.

[0004] Currently, research on the roles of genes containing unknown functional domains (such as DUF4210) and chromosome segregation-related domains (such as Chromosome_seg) in the regulation of meiotic crossing over in rice remains scarce. These genes may play crucial roles in meiosis, but their functions and regulatory mechanisms have not yet been systematically elucidated. Therefore, identifying and clarifying the functions of these genes will help to further improve the regulatory network of meiotic crossing over and provide important genetic resources and theoretical basis for developing novel rice breeding technologies. Summary of the Invention

[0005] Based on this, the purpose of this invention is to provide a gene that regulates meiosis in rice, its encoded protein, and its applications.

[0006] To achieve the above objectives, the following technical solutions can be adopted: In a first aspect, the present invention provides a gene for regulating meiosis in rice. OsMCS1 The nucleotide sequence of the gene includes any of the following: (1) The nucleotide sequence as shown in SEQ ID NO.1; (2) A nucleotide sequence as shown in SEQ ID NO.1 obtained by substitution, deletion or insertion of one or more nucleotides, and still having the function of regulating rice meiosis; (3) A nucleotide sequence that is complementary to the nucleotide sequence described in (1) or (2), and can hybridize with it under strict conditions, and has the function of regulating rice meiosis.

[0007] Secondly, the present invention provides a gene for regulating rice meiosis as described above. OsMCS1 The encoded protein, wherein the amino acid sequence of the protein includes any of the following: (1) The amino acid sequence as shown in SEQ ID NO.2; (2) The amino acid sequence shown in SEQ ID NO.2 is obtained by replacing, inserting or deleting one or more amino acids, and still has the function of regulating rice meiosis.

[0008] Thirdly, the present invention provides a gene comprising the above-mentioned gene regulating rice meiosis. OsMCS1 The biological material is selected from at least one of recombinant expression vectors, gene editing vectors, recombinant bacteria, or recombinant gene expression cassettes.

[0009] Fourthly, the present invention provides a gene that regulates rice meiosis as described above. OsMCS1 Application in regulating rice meiosis.

[0010] Fifthly, the present invention provides a gene that regulates rice meiosis as described above. OsMCS1 Application in increasing the frequency of chromosome recombination in rice.

[0011] Sixthly, the present invention provides a gene that regulates rice meiosis as described above. OsMCS1 Application in improving the efficiency of rice genetic breeding.

[0012] Preferably, in the above applications, by knocking out the above-mentioned gene OsMCS1 This aims to increase the frequency of chromosome recombination in rice, thereby improving breeding efficiency.

[0013] In a seventh aspect, the present invention provides a method for regulating rice meiosis, comprising regulating the aforementioned genes. OsMCS1 The expression level; the regulation includes overexpression, silencing, or knockout of the gene. OsMCS1 .

[0014] Preferably, in the above method, the expression level of the gene OsMCS1 is regulated by a gene editing vector, an RNA interference vector, or an overexpression vector, wherein the gene editing vector is a CRISPR / Cas9 vector containing the above-mentioned gene OsMCS1 fragment.

[0015] Eighthly, the present invention provides a method for improving rice breeding efficiency, comprising knocking out the aforementioned genes regulating rice meiosis. OsMCS1 This increases the frequency of chromosome recombination in rice.

[0016] Preferably, in the above method, the expression level of the gene OsMCS1 is regulated by a gene editing vector, an RNA interference vector, or an overexpression vector, wherein the gene editing vector is a CRISPR / Cas9 vector containing the above-mentioned gene OsMCS1 fragment.

[0017] The beneficial effects of this invention include at least: knocking out genes in rice OsMCS1 It can be seen that the gene knockout rice exhibits abnormal chromosome segregation and partial embryo abortion. Compared with the wild type, the knockout line shows a 1.5-2.0 times higher frequency of chromosome recombination, which improves the breeding efficiency and provides a new means to enhance the efficiency of rice genetic breeding. Attached Figure Description

[0018] Figure 1A For genes OsMCS1 And a schematic diagram of the two editing line mutation sites; Figure 1B Wild type (HZ) and mutant OsMCS1 Growth status, pollen count, and seed set rate; Figure 2 Wild type (HZ) and mutant lines osmcs1-1 and osmcs1-2 Comparison of embryonic sac development processes; Figure 3 Subcellular localization assay for OsMCS1 protein; Figure 4 Wild type (HZ) and mutant lines osmcs1-1 and osmcs1-2 Comparison of meiosis processes; Figure 5 Wild type (HZ) and mutant lines osmcs1-1 and osmcs1-2 Comparison of recombination frequencies. Detailed Implementation

[0019] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0020] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.

[0021] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.

[0022] Example 1 This invention provides a gene-edited rice variety, along with the editing process and related performance tests. The unmutated rice variety is wild-type. OsMCS1 The full-length CDS (2157 bp) sequence of the gene is shown in SEQ ID NO. 1. This rice OsMCS1 The sequence of the unmutated protein encoded by the gene (718aa) is shown in SEQ ID NO. 2.

[0023] (1) Through sequence alignment and target site rules, in OsMCS1 Two specific target sites were selected on the first exon of the gene: SG1: TGTTCGTCCTCATTTTGCG (SEQ ID NO.3) and SG2: ATGTTTTAGATTCTTTGAA (SEQ ID NO.4). The Cas9 gene editing vector system for monocotyledons was selected: the CRISPR / gRNA vector was pYL-U3 / U6a~c-gRNA, and the CRISPR / Cas9 binary vector was pYLCRISPR / cas9-MT(I). OsMCS1 Gene knockout vectors were transformed into indica rice Huazhan (HZ) using Agrobacterium-mediated transformation (following the methods described in Lin Yongjun et al., Crop Science, 2002; Hiei Y et al., Plant Cell, 2006). The pYL-U3 / U6a~c-gRNA was designed with two targets, and the gRNA sequences for SG1 and SG2 are shown below: SG1 gRNA: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (SEQ ID NO.5) gRNA for SG2: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (SEQ ID NO.6) (2) Obtain T0 generation, then collect seeds from positive plants, plant T1 generation, and design target site sequencing primers (including upstream primer 33520 F and downstream primer 33520 R, as shown in SEQ ID NO.7 and SEQ ID NO.8, respectively): 33520F: TGGTGGTGGGATGGTGAAAT (SEQ ID NO.7); 33520R: AAACCTGATTCAAAGCCAACAA (SEQ ID NO. 8); (3) Extract DNA from T1 generation single plants, amplify and detect the target site by PCR, compare with wild-type Hwabi, obtain T1 generation homozygous mutants of the target site, and further propagate to obtain stable homozygous lines of the target site mutation. osmcs1-1 and osmcs1-2; The PCR amplification system was as follows: 25µL system: DNA 1µL, Buffer 12.5µL, ddH2O 8.5µL, dNTP Mix (10mMeach) 0.5µL, Primer F+R (10μM) 1+1µL, Taq enzyme 0.5µL; The PCR amplification program was as follows: 95℃, 3min, 35 cycles (95℃ for 15sec, 60℃ for 20sec, 72℃ for 60sec); 72℃, 5min; 4℃, 5min.

[0024] (4) osmcs1-1 and osmcs1-2 Mutant line sequencing, sequencing results as follows Figure 1A As shown. The results indicate that, compared to unmutated rice... OsMCS1 Full-length CDS sequence of the gene. osmcs1-1 There is a single [- / A] insertion at the target site, and its nucleotide sequence is shown in SEQ ID NO.9; Osmcs1-2 The target site has a [A / -] 1-base deletion, and its nucleotide sequence is shown in SEQ ID NO. 10; mutant gene osmcs1-1 The amino acid sequence of the encoded osmcs1-1 protein is shown in SEQ ID NO.11. osmcs1-1 After inserting 1 bp, a frameshift mutation occurs, forming a new stop codon, and the translated protein is 30aa; mutant osmcs1-2 The amino acid sequence of the encoded osmcs1-2 protein is shown in SEQ ID NO.12. Osmcs1-2 After a 11bp deletion, a frameshift mutation occurs, forming a new stop codon, and the translated protein is 16aa. Both types of mutations can cause frameshift mutations in the OsMCS1 protein, prematurely terminating translation, resulting in a truncated protein that loses its function.

[0025] (5) The pollen fertility and seed setting rate of wild-type Huazhan (HZ) and mutant lines were investigated. The details are as follows: I2-KI solution preparation: First, dissolve 8g of KI, then add 1g of I2. After complete dissolution, adjust the volume to 100 mL to prepare a stock solution containing 2% I2. Dilute as needed before use. Stain mature pollen before flowering with 1% I2-KI staining solution. The specific operation is as follows: Use tweezers to remove the rice husk, dissect to obtain 6 anthers, then place the anthers in a drop of potassium iodide water on the slide and crush them thoroughly. After removing the residue, observe and photograph with an electron microscope. Normal pollen can generally accumulate more starch, while aborted pollen does not accumulate starch. The specific staining reaction of I2-KI on starch can be used to distinguish them (the former is blue-black, and the latter is yellow-brown). The results are as follows. Figure 1B As shown, the results indicate that compared to the wild-type Huazhan (HZ), osmcs1 Both lines showed partial pollen abortion, with the seed set rate decreasing to 28%-34% of that of the wild-type Huazhan (HZ).

[0026] Example 2 The embodiments of the present invention provide OsMCS1 Gene mutation line osmcs1-1 and osmcs1-2 Tests on embryonic sac development. Details are as follows: (1) Sample collection, fixation and preservation Materials were collected from spikelets at different developmental stages from sporogenous cells to embryo sac maturity (spikelets 3-8 mm in length, with white anthers and soft, translucent lemmas; spikelets around 8 mm in length, with anthers changing from white to yellow and then to pale yellow, and lemmas becoming hard; spikelets in the pre-flowering stage, with yellow anthers). The tips of the lemmas were carefully removed, and the spikelets were fixed with FAA (formalin-acetic acid-alcohol fixative). Vacuum was applied using a vacuum pump, and after 24 hours of fixation, the spikelets were rinsed with 50% ethanol and transferred to 70% ethanol for storage at 4°C for later use (observation within 4 months; observation of embryo sac cells will become blurred if storage is too long). The ovary and stigma were dissected and separated under a dissecting microscope in 70% ethanol solution (the spikelet branches must be attached, otherwise later observation will be difficult). (2) Sample staining, dehydration, clearing and microscopic imaging (2-1) Rehydration is performed using an alcohol gradient of 70% ethanol for 20 min - 50% ethanol for 20 min - 30% ethanol for 20 min - distilled water for 30 min. (2-2) Mordant treatment with 2% potassium aluminum sulfate dodecahydrate for 30 minutes (the treatment time for young ovaries can be shortened to about 10 minutes). (2-3) Then stain in 4% sucrose eosin Y / B solution for 16-20 hours (depending on the thickness of the material); (2-4) Then use 2% potassium aluminum sulfate dodecahydrate for color separation for 20 minutes, and wash with distilled water 2-3 times, 20 minutes each time; (2-4) Dehydration was carried out using 30% ethanol for 30 min - 50% ethanol for 30 min - 70% ethanol for 30 min - 90% ethanol for 30 min - 100% ethanol for 60 min - 100% ethanol for 60 min - 100% ethanol for 60 min. (2-5) Then, transition to methyl salicylate, with the concentration initially being (1 / 3 methyl salicylate, 2 / 3 anhydrous ethanol), then (1 / 2 methyl salicylate, 1 / 2 anhydrous ethanol), and finally (2 / 3 methyl salicylate, 1 / 3 anhydrous ethanol), each concentration held for 4 hours; then, clear with 100% methyl salicylate overnight for at least 12 hours. (2-6) Place it at the bottom of the live observation culture dish (Nest), first drop a small amount of methyl salicylate on the bottom, then arrange the ovaries in an orderly manner, and scan them under LSM880. If there are black spots in the image, it means there are gaps, and methyl salicylate needs to be added to the black spots; the excitation wavelength is 543nm, and the emission wavelength is 550nm-630nm; use the software that comes with the microscope to record the image of the embryo sac.

[0027] Test results are as follows Figure 2 As shown, the results indicate that, compared to the wild-type (HZ) embryo sac development process ( Figure 2 From (A) to (J) onwards, a normal octetarian blastocyst can be formed, which is beneficial to... osmcs1-1 and osmcs1-2 Extensive observation and statistical analysis of the mutant embryo sac revealed that the megaspore mother cells of the mutant developed normally. Figure 2 (K)), however, during the megasporogenesis stage ( Figure 2 In the middle (L) to (M) range, megaspore dwarfs and tetrads were rarely observed. osmcs1-1 and osmcs1-2 FMs cannot be formed in the middle ( Figure 2 (N)N) and mature embryo sac ( Figure 2 (O)O). Compared to the wild type, osmcs1-1 and osmcs1-2The embryonic sac abortion rate is 25%-45%. The above data indicates... OsMCS1 Genes also affect the development of female gametophytes, mainly causing some embryo sacs to fail.

[0028] Example 3 This invention provides subcellular localization analysis of the OsMCS1 protein and the analysis process. Details are as follows: (1) Rice seedling cultivation After the rice seeds are manually dehulled, they are soaked in 75% ethanol for 5 minutes, then treated with 40% sodium hypochlorite for 30 minutes, followed by washing with ddH2O three times, and then sown on 1 / 2 MS medium with tweezers for 8-10 days (if the seeds are not localized in chloroplasts, etiolated seedlings can be cultured in the dark; seedlings with shorter culture time have shorter leaf sheaths and smaller cells, which is not conducive to observation; seedlings with longer culture time have too old cells and fewer viable cells after transformation).

[0029] (2) Rice leaf sheath treatment and protoplast preparation (2-1) Collect seedlings and use a sharp knife to cut the stem into small sections of about 0.5mm, leaving 1cm at the bottom and only one finger-length leaf sheath in the middle. Remove the leaves and incomplete leaves. Use a sharp knife to cut quickly, the finer the better, and do not tear. (2-2) Place a small section of rice tissue into a 50mL conical flask, add 15mL of 0.6M mannitol solution, let stand in the dark for 15min, and then vacuum for 30min (10mL can be used for the leaf sheaths of 50 seedlings). (2-3) Use a syringe to aspirate the supernatant, or directly use the enzymatic hydrolysate (enzymatic hydrolysate: 3.0 mL 2.0 mol / L Mannitol, 1.0 mL 0.1 mol / L MES, 0.150 g Cellulose RS, 0.075 g Macerozyme, 0.010 g BSA, 10.0 µL 1.0 mol / L CaCl2 and 6.0 mL ddH2O) to directly vacuum, 55℃, for 10 min; after cooling, add to the cut leaf sheath segments, 28℃, 70 rpm, in the dark for 3.5 h, not longer than 4 h. Generally, leaf sheaths from 50 seedlings can be enzymatically hydrolyzed with 10 mL of enzymatic hydrolysate, which can transform at least 5 plasmid combinations; (2-4) Filter the enzyme solution through a 400-mesh sieve and discard it. Collect the filter residue back into the original conical flask. After the enzymatic hydrolysis is complete, add 10 mL of W5 (10.0 mL 1.54 mol / L NaCl, 12.5 mL 1.00 mol / L CaCl2, 2.5 mL 0.20 mol / L KCl, 2.0 mL 0.1 mol / L LMES, pH 5.7) in equal proportions and treat for 10 min (to release protoplasts). (2-5) Filter the solution through a 400-mesh blue filter into a 50mL round-bottom centrifuge tube and filter again. (2-6) Centrifuge at 150g speed for 10min (3 speeds up or down), and discard the supernatant.

[0030] (2-7) Slowly add 1 mL of W5 solution along the tube wall, gently mix the protoplasts, and examine the integrity of the protoplasts under an electron microscope.

[0031] (3) Transient transformation and culture of protoplasts (3-1) Add 5 µg of NLS-mKate-Marker marker plasmid containing the NLS sequence (MDPKKKKV), 200 μL of the target gene plasmid fused with GFP, and 2 mL of protoplast to a 2 mL round-bottom centrifuge tube for fusion, and gently mix them. (3-2) After mixing, add 200 μL of PEG-CaCl2 solution: 40% PEG4000, 0.6 mol / L Mannitol, 100 mmol / L CaCl2, shake gently to mix, and let stand at 28℃ in the dark for 15 min. (3-3) Add 450 μL of W5 solution to terminate the reaction, mix well, collect protoplasts at room temperature at 150 g speed for 3 min (adjust 3 speeds), aspirate 600 μL-800 μL of supernatant, add W5 (discard the amount added), mix well; centrifuge at 150 × g for 2 min (adjust 3 speeds); incubate overnight at 28 °C in the dark (15 h-22 h).

[0032] (4) Fluorescence microscopy observation After gently tapping the protoplast with your finger to resuspend it, use a pipette tip with the tip removed to draw 10 μL onto a glass slide and observe it using a Zeiss LSM880 confocal microscope with a fusion interface. The excitation wavelength of mKate is 588 nm and the emission wavelength is 635 nm, while the excitation wavelength of GFP is 488 nm and the emission wavelength is 507 nm. First, adjust the coarse focus knob in bright field to find a protoplast with a good field of view and appropriate size. Then, use the dual excitation channels of GFP and mKate for imaging, adjusting the exposure time and noise. Finally, click "Snap" to take a picture and save it.

[0033] The results are as follows Figure 3 As shown, the results indicate that only the cell nucleus emits green light under GFP wavelength excitation, suggesting that OsMCS1 is located in the cell nucleus. To ensure the accuracy of the results, a new co-localization experiment was performed. Under mKate wavelength excitation, a red glowing cluster appeared on the cell nucleus. Figure 3 (B) and (F)), and co-localized with the green photophores under GFP excitation wave ( Figure 3In (A) and (E) in bright field, the outline of the cell nucleus is clearly visible. Figure 3 (C) and (G) indicate that the fluorescent signal of OsMCS1-linked GFP co-localizes with the nuclear marker NLSmKate in rice protoplasts. Figure 3 The data above (D and H) indicate that OsMCS1 is a nuclear localized protein.

[0034] Example 4 The embodiments of the present invention provide OsMCS1 Gene mutation line osmcs1-1 and osmcs1-2 Meiosis and the testing process are detailed below: (1) Sampling and preservation Chromosome observation during meiosis in pollen mother cells: First, it is necessary to determine the method of representing the auricle spacing. When the auricle of the flag leaf emerges from the sheath of the second leaf from the bottom and is positioned above the auricle of the second leaf from the bottom, the spacing is "+"; when the auricle of the flag leaf is at the same height as the auricle of the second leaf from the bottom, the spacing is "0"; and when the auricle of the flag leaf is still in the sheath of the second leaf from the bottom, the spacing is "-". Generally, meiosis begins when the auricle spacing is close to -10 cm, is most active when the auricle spacing is between -3 and 0 cm, and finally ends when the auricle spacing is +10 cm. When the auricle of the flag leaf just emerges from the sheath of the second leaf from the bottom, the young spike is in the most vigorous meiotic stage. Sampling time: 8:00-10:00 AM or 4:00-6:00 PM. Peel off the entire inflorescence and immediately immerse it in Carnoy's solution (ethanol:acetic acid = 3:1). After 48 hours, wash it 3-5 times with 70% ethanol until the acetic acid odor disappears. It can be stored in 70% ethanol at 4°C for up to 2-4 months, but the longer the storage time, the worse the observation effect.

[0035] (2) Cleaning and enzymatic hydrolysis About 40 anthers were picked out under a dissecting microscope. Before adding the enzymatic digest (cellulase and pectinase), the anthers were washed 3-4 times with 200 μL PCR tubes. Then, the anthers were enzymatically digested in a 37℃ water bath for about 15 minutes. After digestion, the anthers were temporarily placed on ice. If the experiment was to continue, the anthers were washed again with water 3-4 times and then the digestion was stopped.

[0036] (3) Microscopic observation and photography Dissect the anthers with a needle under a 1× dissecting microscope eyepiece, slowly crushing them while keeping the water content low. Remove any remaining residue; if too much water is present, blot it dry with paper. On a 45℃ slide spreader (XY-2 digital display constant temperature heating plate), wait until the water forms a film, then add 20-30 μL of 60% glacial acetic acid. Mix thoroughly with a 10 μL pipette tip for about 1.5 minutes. Quickly drip 70-80 μL of pre-cooled Carnot solution (pre-cooled to -20℃) from 40 cm directly above the sample onto the slide, then dry. Draw a circle on the back of the slide, add 8 μL of DAPI solution in the dark, cover with a coverslip, and gently press to remove air bubbles and excess liquid around the edges. Let stand in the dark for 5 minutes. Observe under a fluorescence microscope using the DAPI channel. First, locate the chromosomes at 10× and 20×, then observe under a 100× oil immersion microscope. When taking pictures, adjust the contrast or brightness as needed. Press "Snap" to take the picture. To save the images, simply close the software and press Enter to quickly save all images. The prepared slides should be viewed immediately and can be stored in an immunoassay chamber at 4°C in the dark for one week.

[0037] The results are as follows Figure 4 As shown, the results indicate that the knockout mutant... Osmcs1-1 and Osmcs1-2 The chromosomes in pollen mother cells (PMCs) during meiosis do indeed exhibit abnormalities. This can be compared with the meiotic chromosome behavior of wild-type HZ. Figure 4 From (A) to (H), it can be found that Osmcs1-1 and Osmcs1-2 The mutants have more randomly distributed monovalents (e.g., during diastasis recti and metaphase I) Figure 4 In late stage I, the mutant chromosomes are unevenly distributed in the two daughter cells. In telophase II, due to delayed chromosome migration, some chromosome bridges form. Micronuclei appear in the tetrad stage. Figure 4 (P) and (X)). The above data shows that OsMCS1 These are genes involved in the crossing over of meiosis in PMCs.

[0038] Example 5 This invention tested mutations via gene editing technology. OsMCS1 The extent to which genes increase chromosome recombination rates and the testing results are as follows: Cultivation of wild-type Hua Zhan (HZ) and OsMCS1 Gene knockout lines ( osmcs1-1 and osmcs1-2 ), 100 individual plants from wild type and knockout line were resequencing (10×) for analysis. The recombination frequency of wild type and gene knockout line was calculated by directly comparing the frequency and location of chromosome segment exchange: recombination frequency = (number of recombinant individuals / total number of individuals) × 100%.

[0039] The results are as follows Figure 5 As shown, the results indicate that the recombination frequency of the knockout lines is 1.5-2 times higher than that of the wild type. OsMCS1 Gene knockout lines, compared to wild-type lines, can increase the recombination frequency of their own chromosomal segments. The recombination frequency directly affects the efficiency of rice genetic breeding. If superior genes are located in low-activity regions of chromosomes, the low recombination rate will limit the combination of superior genes, while gene editing technology can prevent this. OsMCS1 Genes can increase recombination frequency, accelerate the breeding process, and provide new pathways for crop improvement.

[0040] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. Knockout or silence of genes regulating meiosis in rice OsMCS1 Application in increasing the frequency of chromosome recombination in rice, gene OsMCS1 The nucleotide sequence is shown in SEQ ID NO.

1.

2. Knockout or silencing genes that regulate meiosis in rice OsMCS1 Its application in improving the efficiency of rice genetic breeding involves gene knockout. OsMCS1 To increase the frequency of chromosome recombination in rice, thereby improving breeding efficiency, gene... OsMCS1 The nucleotide sequence is shown in SEQ ID NO.

1.

3. A method for increasing the frequency of chromosome recombination in rice, characterized in that, Including regulatory genes OsMCS1 The expression level; the regulation includes silencing or knocking out the gene. OsMCS1, Gene OsMCS1 The nucleotide sequence is shown in SEQ ID NO.

1.

4. A method for improving rice breeding efficiency, characterized in that, This includes knocking out genes that regulate meiosis in rice. OsMCS1 Increase the frequency of chromosome recombination in rice, genes OsMCS1 The nucleotide sequence is shown in SEQ ID NO.

1.

5. The method according to claim 3 or 4, characterized in that, The expression level of the gene OsMCS1 was regulated using a gene editing vector or an RNA interference vector, wherein the gene editing vector was a CRISPR / Cas9 vector containing a fragment of the gene OsMCS1.

Images